<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2014.413105</article-id><article-id pub-id-type="publisher-id">AiM-50653</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject><subject> Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Influence of Sub-Lethal and Lethal Concentrations of Chlorhexidine on Morphology and Glucosyltransferase Genes Expression in &lt;i&gt;Streptococcus mutans&lt;/i&gt; UA159
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>ndréa</surname><given-names>Cristina Barbosa da Silva</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rafael</surname><given-names>Nóbrega Stipp</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Renata</surname><given-names>de Oliveira Mattos-Graner</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Fábio</surname><given-names>Correia Sampaio</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Demetrius</surname><given-names>Antônio Machado de Araújo</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib></contrib-group><aff id="aff4"><addr-line>Department of Biotechnology, Center of Biotechnology, Brazilian Northeast Network on Biotechnology, 
Federal University of Paraiba, Joao Pessoa, Brazil</addr-line></aff><aff id="aff2"><addr-line>Department of Oral Diagnosis, Piracicaba Dental School, University of Campinas, UNICAMP, Sao Paulo, Brazil</addr-line></aff><aff id="aff1"><addr-line>Graduate Program in Dentistry, Center of Sciences, Technology and Health, State University of Paraiba, 
UEPB, Campina Grande, Brazil</addr-line></aff><aff id="aff3"><addr-line>Department of Clinical and Social Dentistry, Health Science Center, Brazilian Northeast Network on 
Biotechnology, Federal University of Paraiba, Joao Pessoa, Brazil</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>andreacbsilva@gmail.com(NCBDS)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>08</day><month>10</month><year>2014</year></pub-date><volume>04</volume><issue>13</issue><fpage>945</fpage><lpage>954</lpage><history><date date-type="received"><day>18</day>	<month>August</month>	<year>2014</year></date><date date-type="rev-recd"><day>12</day>	<month>September</month>	<year>2014</year>	</date><date date-type="accepted"><day>2</day>	<month>October</month>	<year>2014</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Chlorhexidine (CHX) is regarded as one of the most successful antiplaque agents in controlling the formation of dental biofilm. Nevertheless, molecular mechanisms of their effects in 
  Streptococcus mutans
   are largely unknown. In this work, the effects of sub-lethal and lethal concentrations of chlorhexidine (CHX) on planktonic or biofilm-organized 
  Streptococcus mutans
   cells were investigated in dose- and time-dependent manner. The Minimum Inhibitory Concentration (MIC) and the Minimum Bactericidal Concentration (MBC) for planktonic cells and biofilm conditions were determined by standard methods. Quantitative PCR (qPCR) was used to quantify the relative levels of 
  glucosyltransferase B
   (
  gtfB
  ), 
  gtfC
   and 
  gtfD
   transcription of 
  S. mutans
   in the presence of CHX. The CHX activity in the initial biofilm structure and morphological alterations in planktonic cells were examined by Scanning Electron Microscopy (SEM). The results indicate that CHX increased expression of 
  gtfC
   and 
  gtfD
   in planktonic 
  S. mutans
   cells and CHX reduced the expression of 
  gtfB
  , 
  gtfC
  , and 
  gtfD
   in biofilms. High concentrations of CHX resulted in several wilted 
  S. mutans
   planktonic cells with spilled intracellular material, while decreased cells’ chain length and matrix was found when the initial biofilm was exposed to increasing concentrations of CHX. CHX’s effects against 
  bacteria depend on the type of growth organization and the concentration and time of exposure to the drug. At sub-lethal concentrations, CHX affects the expression of glucosyltransferases, which may have anticariogenic effect.
 
</p></abstract><kwd-group><kwd>Planktonic Cells</kwd><kwd> Biofilm</kwd><kwd> Microorganism</kwd><kwd> Scanning Electron Microscopy</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chlorhexidine (CHX) is a successful chemical plaque control used routinely in general dental practice for controlling the formation of dental biofilms [<xref ref-type="bibr" rid="scirp.50653-ref1">1</xref>] . Considering its clinical application in Cariology, this drug can be used as “shock treatment” in patients with high risk and caries activity [<xref ref-type="bibr" rid="scirp.50653-ref2">2</xref>] . In this case, 0.12% CHX is generally used in association with a prophylactic regimen containing oral hygiene instructions, dietary advice, professional dental prophylaxis and topical fluoride application [<xref ref-type="bibr" rid="scirp.50653-ref3">3</xref>] .</p><p>S. mutans is the main causative agent of human dental caries, mainly as a result of its ability to adhere to teeth surfaces and its acidogenicity [<xref ref-type="bibr" rid="scirp.50653-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.50653-ref5">5</xref>] . Such bacteria produce three glucosyltransferases, GtfB, GtfC, and GtfD, which synthesize soluble and insoluble glucan polymers from sucrose [<xref ref-type="bibr" rid="scirp.50653-ref6">6</xref>] . These polysaccharides enhance the colonization of cariogenic bacteria and promote the formation of dental plaque on tooth surfaces [<xref ref-type="bibr" rid="scirp.50653-ref7">7</xref>] .</p><p>Despite studies having already proved that CHX has been efficient on plaque control [<xref ref-type="bibr" rid="scirp.50653-ref8">8</xref>] - [<xref ref-type="bibr" rid="scirp.50653-ref11">11</xref>] , few investigations have focused on structural or molecular changes that can occur in cells, the biofilm matrix, or both [<xref ref-type="bibr" rid="scirp.50653-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.50653-ref13">13</xref>] , when exposed at sub MIC and MIC concentrations of this drug.</p><p>The aim of this study was to evaluate the in vitro antibacterial effects of CHX digluconate on S. mutans plan- ktonic or biofilm cells in a dose- and time-dependent manner.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Bacteria, Growth Conditions and Chemicals</title><p>S. mutans UA159 was acquired from ATCC (Cat. #700610), which had its genome sequenced [<xref ref-type="bibr" rid="scirp.50653-ref14">14</xref>] . This microorganism was grown in Brain Heart Infusion (BHI) (Difco, MD, USA) at 37˚C and atmosphere enriched with 10% CO<sub>2</sub>. Chlorhexidine digluconate (20% aqueous solution, Cat. #C9394) was purchased from Sigma-Aldrich (St. Louis, MO, USA).</p></sec><sec id="s2_2"><title>2.2. CHX MIC and MBC Assay for Planktonic Cells</title><p>The MIC and MBC for planktonic cells were determined by overnight standard 96-well plate microdilution method and agar plating [<xref ref-type="bibr" rid="scirp.50653-ref15">15</xref>] . Two-fold dilutions of the drug were prepared in each test well containing Brain Heart Infusion broth (BHI), with CHX concentrations ranging from 0.56 &#181;g/ml to 72 &#181;g/ml. Aliquots of bacterial suspension (20 &#181;L), adjusted spectrophotometrically to match the optical density of A<sub>550nm</sub> = 0.5, were added to each 180 &#181;L of drug-containing culture medium. Control wells included culture medium only, culture medium and CHX, and wells without CHX. Plates were closed and incubated for 18 h at 37˚C and atmosphere enriched with 10% CO<sub>2</sub>. After incubation, MIC was determined visually and defined as the lowest drug concentration in which growth-turbidity was not observed. Assays were repeated three times in duplicate. Viable counting from control wells and from test wells was performed on BHI agar plates to determine MBC. MBC was defined as the lowest drug concentration in which no colony-forming units were observed on the plate.</p></sec><sec id="s2_3"><title>2.3. CHX MBC Assay for Biofilm Cells (MBC-b)</title><p>Biofilm analyses were formed in 20 mm diameter, 15 mm deep polystyrene multidishes (six wells plates), by incubation of 20 &#181;L of bacterial suspension (A<sub>550nm</sub> = 0.5) and 5 mL BHI supplemented with 0.1% sucrose. After 18 h of growth, CHX was added directly to media-containing wells at final concentrations of 50 &#181;g/ml, 100 &#181;g/ml, 500 &#181;g/ml, 800 &#181;g/ml or 1000 &#181;g/ml. Wells which did not receive CHX were set as control. Whole plate was closed and homogenized on an orbital mixer (80 rpm) for 60 s, and incubated for additional 5 min at 37˚C and atmosphere enriched with 10% CO<sub>2</sub>. Afterwards, the medium was aspirated and biofilm was washed three times with 5 mL of 0.9% NaCl solution (saline) to remove non-adherent cells. Whole biofilm layer was dislodged with the aid of a cell disrupter (Lifter Cell/3008; Costar, Corning, NY) in presence of 2 mL saline. Part of dislodged biofilm suspension was subjected to expression analysis (below) and part (50 &#181;L) subjected to dilution for viable counting onto BHI agar plates aiming at quantifying MBC in the biofilm (MBC-b). MBC was defined as the lowest drug concentration after exposure that prevented colony forming units growing on agar medium. Assays were performed in duplicate and repeated three times.</p></sec><sec id="s2_4"><title>2.4. Analysis of gtf Expression in Planktonic Cells under CHX</title><p>The expression levels of all genes were normalized by amplification of 16S rRNA of S. mutans as an internal standard. Overnight S. mutans broth culture was inoculated into 300 mL of pre-warmed BHI and let growth until reaches A<sub>550nm</sub> = 0.3. Homogenized culture was then distributed into 20 mL aliquots in new tubes, and exposed to sub-lethal doses of CHX at 1.1 &#181;g/ml, 2.2 &#181;g/ml and 4.5 &#181;g/ml each. Tubes which received the same volume of saline instead of CHX were set as control. All tubes were incubated for 2, 4 and 6 h at 37˚C, 10% CO<sub>2</sub>. Aliquots of cultures (50 &#181;L) at each time point were subjected to viable counting onto BHI agar plates. Suspensions were quickly cooled on ice and centrifuged at 5500 g at 4˚C for 4 min. Cells were washed in cold saline and stored with 220 &#181;L of 10 mM Tris, 1 mM EDTA, pH 8.0 (TE) at −80˚C until use.</p></sec><sec id="s2_5"><title>2.5. Analysis of gtf Expression in Biofilm Cells under CHX</title><p>Biofilms exposed to CHX at 100 &#181;g/ml, 500 &#181;g/ml and 800 &#181;g/ml were selected to analysis of gtf expression. Dislodged cell suspensions were centrifuged, washed in cold saline and stored with 220 &#181;l of TE at −80˚C, until use.</p></sec><sec id="s2_6"><title>2.6. RNA Isolation from Planktonic Cells and Biofilms</title><p>Total S. mutans RNA from either planktonic cells or biofilms was extracted and purified using an RNeasy RNA isolation column (Qiagen-Sciences, MD). Briefly, frozen cells were mechanically disrupted with 0.16 g of 0.1 mm diameter Zirconium Beads (Biospec, OK, USA) on a Mini-bead beater (Biospec), at maximum power (3 cycles of 30 s with 60 s on ice). Further RNA purification, followed by digestion with on-column RNase-free DNase I, was performed as recommended by the manufacturer. To remove small traces of remaining DNA, purified RNA was treated with DNase I (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. RNA sample concentrations were determined at A<sub>260nm</sub> (NanoDrop, Thermo Scientific, USA) and integrity by 1.2% formaldehyde agarosegels stained with ethidium bromide [<xref ref-type="bibr" rid="scirp.50653-ref17">17</xref>] .</p></sec><sec id="s2_7"><title>2.7. Reverse Transcription and RT-PCR</title><p>Reverse transcription of experimental samples together with negative controls was carried out with 1 &#181;g RNA using Superscript III RT (Invitrogen, Life Technologies, Carlsbad, CA, USA) as previously described [<xref ref-type="bibr" rid="scirp.50653-ref16">16</xref>] . After reaction, water was added, so that the product concentration was relative to RNA 10 ng/μl. Controls for cDNA synthesis included samples without RNA template and samples without reverse transcriptase.</p><p>Quantification of cDNA was performed using the Step One Plus Real-Time PCR System (Applied Biosystems, Life Technologies, USA) and all primers were constructed by Invitrogen (Invitrogen Life Technologies, Carlsbad, CA, USA) using nucleotide sequence information provided [<xref ref-type="bibr" rid="scirp.50653-ref16">16</xref>] (<xref ref-type="table" rid="table1">Table 1</xref>). Each reaction mixture (25 &#181;L) contained 1&#215; SYBR Green PCR Master Mix (Applied Biosystems), 0.6 &#181;M of each appropriate forward/ reverse primer and 3 &#181;L of cDNA sample (30 ng relative RNA). Cycling conditions included initial denaturation at 95˚C for 10 min, followed by a 50-cycle amplification, consisting of denaturation at 95˚C for 15 s, annealing at 54˚C for 15 s and extension at 72˚C for 30 s each. Controls included reaction mixtures without cDNA template to rule out primer dimers formation or presence of contaminating DNA. A standard DNA amplification curve starting from 300 ng to 0.003 ng (10-fold dilutions) and a melting-point product curve were obtained for each primer set/run. Assays were performed in duplicate with three or more independent RNA samples.</p></sec><sec id="s2_8"><title>2.8. Scanning Electron Microscopy (SEM)</title><sec id="s2_8_1"><title>2.8.1. Planktonic Cells</title><p>The CHX effects on cell morphology were investigated by SEM. Planktonic cells were grown in presence of</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer sequences used in this study (listed 5’ to 3’ end) and amplicon sizes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers (QRT-PCR)</th><th align="center" valign="middle" >Sequence5’-(Forward/Reverse)</th><th align="center" valign="middle" >Annealing Temperature</th><th align="center" valign="middle" >Product size</th></tr></thead><tr><td align="center" valign="middle" >16S rRNA</td><td align="center" valign="middle" >CGGCAAGCTAATCTCTGAAA/GCCCCTAAAAGGTTACCTCA</td><td align="center" valign="middle" >54˚</td><td align="center" valign="middle" >190 bp</td></tr><tr><td align="center" valign="middle" >SMU.910 (gtfD)</td><td align="center" valign="middle" >TGATTCGTGGTATCGTCCTAA/GTTGAGACTTTCTTGGCTGCT</td><td align="center" valign="middle" >54˚</td><td align="center" valign="middle" >199 bp</td></tr><tr><td align="center" valign="middle" >SMU.1004 (gtfB)</td><td align="center" valign="middle" >CGAAATCCCAAATTTCTAATGA/TGTTTCCCCAACAGTATAAGGA</td><td align="center" valign="middle" >54˚</td><td align="center" valign="middle" >197 bp</td></tr><tr><td align="center" valign="middle" >SMU.1005 (gtfC)</td><td align="center" valign="middle" >ACCAACCGCCACTGTTACT/AACGGTTTACCGCTTTTGAT</td><td align="center" valign="middle" >54˚</td><td align="center" valign="middle" >161 bp</td></tr></tbody></table></table-wrap><p>CHX (1.1 &#181;g/ml, 2.2 &#181;g/ml, 4.5 &#181;g/ml) or not (control) for 2, 4 and 6 h. Cultures were centrifuged, washed with saline two times and re-suspended with saline in original’s volume. Bacterial suspensions (50 &#181;L) were applied on cover slip surfaces and subjected to fix process with 55˚C (60 min) and 2.5% glutaraldehyde (30 min). Glutaraldehyde excess was removed, and cells were dehydrated within ethanol series (50% to 100%) for 20 min each. Finally, ethanol was removed and cover slips dried at room temperature. Samples were sputter-coated with gold and analyzed under scanning electron microscope as recommended by manufacturer (JEOL, JSM, 5600LV, Japan).</p></sec><sec id="s2_8_2"><title>2.8.2. Biofilms</title><p>The CHX effects on the initial phases of biofilm formation were investigated by SEM. Sterile glass cover slips (&#216; = 13 mm, GLASTEC, Brazil) were placed in each well of a 24-well plate. BHI medium (1.5 ml) supplemented with 0.1% sucrose containing CHX (1.1 &#181;g/ml, 4.5 &#181;g/ml, 72 &#181;g/ml, 1200 &#181;g/ml or 2000 &#181;g/ml) or not (control) were transferred to wells. Aliquots of 50 &#181;L bacterial suspension (A<sub>550nm</sub> = 0.5) were then added, mixed, and incubated at 37˚C, 10% CO<sub>2</sub> for 2 or 4 h. Biofilm grown on slides was washed three times with PBS to remove non-adherent cells and processed for SEM analysis as previously described.</p></sec></sec><sec id="s2_9"><title>2.9. Statistical Analysis</title><p>Relative expression was calculated by Pfaffl mathematical model [<xref ref-type="bibr" rid="scirp.50653-ref17">17</xref>] . Briefly, cycle threshold values of expression levels (C<sub>t</sub>) obtained from dilution curves were used to determinate quantitative PCR (qPCR) efficiency for each primer set. Each gtf gene of treated cells was normalized to the 16S rRNA gene (internal control) [<xref ref-type="bibr" rid="scirp.50653-ref16">16</xref>] . These values were then compared to those from the non-treated, 16S-normalized control, to determine the changes in gtf genes expression. Using C<sub>t</sub> values, statically significance was obtained at p &lt; 0.01 or p &lt; 0.05, using ANOVA Dunnett Bilateral test, under BioEstat 5.0 free software.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. CHX Antimicrobial Effects</title><p>CHX MIC and MBC for planktonic cells were 2.2 &#181;g/ml and 18 &#181;g/ml, respectively, while CHX MBC for biofilm (MBC-b) was 800 &#181;g/ml (data not shown). Thus, sub-micvalues were established in concentrations lower than 2.2 &#181;g/ml and 800 &#181;g/ml for planktonic cells and biofilm, respectively. Planktonic cells exposed to 4.5 &#181;g/ml CHX and 9 &#181;g/ml CHX reduced the bacterial counts by nearly 6 and 20 fold, respectively. In biofilms, a high coefficient of variation (56.4%, p &lt; 0.01) of CFU/ml counts was observed only in 500 &#181;g/ml CHX. In 100 &#181;g/ml and control groups, these coefficients were below 20% (p &lt; 0.01). In 800 &#181;g/ml, there was no cell growth.</p></sec><sec id="s3_2"><title>3.2. CHX Effect on 16S Gene Expression</title><p>The values of Ct 16S rRNA gene did not vary in the experiments with planktonic cells [mean ct 13.24 (&#177;0.48)]. Regarding the CHX exposure, there was 7% variation between exposure and no exposure, whereas taking into account the control and minor concentrations (C1: 1.1 &#181;g/ml and C2: 2.2 &#181;g/ml), this variation was less than 5% (data not shown). Thus, the 16S rRNA gene can be successfully used as a reference gene on our conditions. Moreover, Ct values of 16S rRNA did not change in response to CHX in biofilm-growing cells [mean Ct 13.24 (&#177;0.48)]. Ct values of 16S rRNA showed higher coefficient of variation (6.05%) in the group with the highest CHX concentration (C3: 800 &#181;g/ml) than with other groups (C1: 100 &#181;g/ml and C2: 500 &#181;g/ml; &lt;3.0%).</p></sec><sec id="s3_3"><title>3.3. CHX Effect on gtfs Gene Expression</title><p>In planktonic cells, CHX increased gtfC (p &lt; 0.05) and gtfD (p &lt; 0.01) expression only in cell cultures with 6 h growth, at C3 (4.5 &#181;g/ml) concentration, with 9- and 20-fold, respectively (<xref ref-type="fig" rid="fig1">Figure 1</xref>). In the biofilm environment, the expression of gtfB and gtfD was reduced in C2 (500 &#181;g/ml) and C3 (800 &#181;g/ml) concentrations, while there was decreased gtfC expression only for C2 concentration, when compared with the control (p &lt; 0.01) (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec><sec id="s3_4"><title>3.4. SEM Analyses</title><p>SEM analyses of planktonic cells and biofilm exposed or not to CHX are shown in <xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="fig" rid="fig4">Figure 4</xref>.</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Influence of sub lethal concentrations of chlorhexidine (CHX) on the gtfs expression. Planktonic S. mutans cells were grown in absence (0, control) or presence (C2, 2.2 &#181;g/ml; C3, 4.5 &#181;g/ml) of CHX and subjected to qPCR analysis. Planktonic cells were exposed to the CHX from the beginning of growth. mRNA levels of gtfB, gtfC and gtfD in each sample were normalized by respective 16S rRNA. Then, vehicle-treated controls were set at 100%, and levels for treatments (C2, C3) were expressed relative to this value. The results are expressed as means &#177; SD of three separate experiments run in duplicate. *p &lt; 0.05 and **p &lt; 0.01 as compared to control condition</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/11-2270440x6.png"/></fig><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Effects of sub-lethal and lethal chlorhexidine (CHX) pulse-exposition in vitro S. mutans biofilms. Biofilms (18 h growth) were exposed to the CHX for a period of 5 min. mRNA levels of gtfB, gtfC and gtfD in each sample was normalized by respective 16S rRNA. Vehicle-treated controls were set at 100%, and levels for treatments were expressed relative to this value. Reduction in gtfs expression were reached in concentrations ≥ 500 &#181;g/ml. The results are expressed as means &#177; SD of three separate experiments run in duplicate. **p &lt; 0.01 as compared to control condition</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/11-2270440x7.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Scanning electron micrograph of planktonic S. mutans UA159 cells with and without treatment with sub-lethal and lethal concentrations of chlor- hexidine (CHX). Planktonic cells were exposed to the CHX from the beginning of growth. Cells were exposed to CHX at 4.5 &#181;g/ml. Note that after 4 h and 6 h of CHX incubation, several wilted cells (arrows) with spilled intracellular material could be observed (15 kV and 13,000&#215; of magnification)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/11-2270440x8.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Scanning electron micrograph of S. mutans UA159 early biofilm (4 h growth), with and without treatment with sub-lethal and lethal concentrations of chlorhexidine (CHX). Biofilms were exposed to the CHX from the beginning of growth. Biofilms were exposed to CHX which was presented as a gradual decreasing in both the cells’ chain length and their matrix when exposed at 1.1, 4.5 or 72 &#181;g/ml concentrations (15 kV and 1300&#215; of magnification)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/11-2270440x9.png"/></fig><p>Several assays were performed for these morphological analyses and the results are representative of three independent experiments. Cell surfaces did not show any obvious change when cells were exposed to increasing CHX concentrations (1.1, 2.2, or 4.5 &#181;g/ml) for 2 h (data not shown). However, as demonstrated by SEM (Fig- ure 3), after 4 or 6 h of exposure at less than-MBC (4.5 &#181;g/ml), several S. mutans cells wilted or their membranes ruptured and, as a result, lost a substantial amount of cytoplasm material. SEM analyses of initial control biofilms and those treated with CHX are shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>, where a decrease in cell chain length and matrix were found when biofilms were exposed to different CHX concentrations (1.1 &#181;g/ml to 4.5 &#181;g/ml), while 1200 &#181;g/ml and 2000 &#181;g/ml of CHX caused extensive precipitation of unknown material on the slide (data not shown).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>It is well recognized that S. mutans, when organized in biofilms, has different properties than its planktonic form. Biofilms have a more tolerant phenotype to antimicrobial agents, stress, and host defenses than planktonic cultures do, making them difficult to treat [<xref ref-type="bibr" rid="scirp.50653-ref18">18</xref>] -[<xref ref-type="bibr" rid="scirp.50653-ref20">20</xref>] . Nevertheless, in this study, sub-MIC and MIC concentrations of CHX were selected for the SEM observations and expression analysis in planktonic cells and biofilms to better understand the CHX effect on these cells, since higher concentrations of this drug would cause cell death that could compromise gene expression in this experimental study.</p><sec id="s4_1"><title>4.1. gtfs Genes Expression Analysis</title><p>The gene expression of planktonic cells and biofims were observed in the most appropriate experimental growth periods for planktonic cells (2, 4 and 6 h) and biofilms (18 h). Planktonic cells were exposed to the chlorhexidine from the early growth to analyze its growth kinetics. Biofilms were exposed to CHX for 5 min to mimic the oral cavity environment when exposed to CHX during fast mouthwash with the drug.</p><p>In this study, methods of RNA extraction from planktonic cells and biofilms were similar, which makes possible the direct comparison of these different conditions of the same bacterial microorganism. The polysaccharides elimination of the biofilm, as a prior step to extraction [<xref ref-type="bibr" rid="scirp.50653-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.50653-ref22">22</xref>] , was not necessary in our in vitro conditions due to the shorter time of biofilm formation and low concentration of sucrose.</p><p>The 16S rRNA gene has been successfully used as a reference gene in studies on S. mutans in biofilm and planktonic cells [<xref ref-type="bibr" rid="scirp.50653-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.50653-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.50653-ref23">23</xref>] -[<xref ref-type="bibr" rid="scirp.50653-ref26">26</xref>] . Our results indicated that the expression of 16S rRNA S. mutans remained stable when exposed to a CHX environment regardless of whether it is in planktonic cells or in biofilms. This suggests that the 16S rRNA gene can be used as a reference gene on analysis of expression in the two conditions described above.</p><p>The effect of antimicrobial agents on gene expressions that are heavily involved in biofilm formation is of particular interest to dentistry [<xref ref-type="bibr" rid="scirp.50653-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.50653-ref25">25</xref>] . Different patterns of gene expression between biofilms and planktonic cells were observed [<xref ref-type="bibr" rid="scirp.50653-ref20">20</xref>] . Thus, Li and Burne [<xref ref-type="bibr" rid="scirp.50653-ref27">27</xref>] found that the expression of gtf genes was enhanced in bacteria growing as biofilms compared with planktonic growth, implying thata cell-density-dependent intercellular communication system may play a role of regulating thegtfB/C genes expression [<xref ref-type="bibr" rid="scirp.50653-ref28">28</xref>] .</p><p>According to our findings, CHX inhibited the gtfs expression of S. mutans organized as biofilm (<xref ref-type="fig" rid="fig2">Figure 2</xref>) but increased the gtfs expression in planktonic cells (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Koo et al. [<xref ref-type="bibr" rid="scirp.50653-ref25">25</xref>] demonstrated that apigenin significantly decreased the expression of gtfB and gtfC and increased the expression of gtfD in S. mutans growing in the planktonic state. A similar profile of gtf expression was obtained with biofilms.</p><p>Tam et al. [<xref ref-type="bibr" rid="scirp.50653-ref24">24</xref>] observed that iodine and povidone iodine (PI) in a tetraglycol-carrier cause enhancement of expression of gtfB in S. mutans in biofilms but not in planktonic bacteria. PI in water induced expression of gtfB and gtfC in planktonic bacteria. Thus, the vehicle type used together with the active compound or molecule can determine the increased or decreased expression of these genes.</p><p>It is probable that planktonic cells express more gtfs (<xref ref-type="fig" rid="fig1">Figure 1</xref>) as a defense mechanism against stress when exposed to CHX. Cells from biofilms are more protected, and they do not need to produce more gtfs. In biofilms, CHX inhibited the gtfs expression (<xref ref-type="fig" rid="fig2">Figure 2</xref>). This is a clear indication that CHX at sub-lethal concentrations may have an adverse effect on the adhesion process of these cells on the tooth surface, which is relevant for clinical purposes ofcontrolling oral biofilms’ development in vivo.</p><p>According to Wade [<xref ref-type="bibr" rid="scirp.50653-ref29">29</xref>] , high CHX concentrations, as used in clinical practice, kill the cells, and this is not interesting for the balance of microbiota in the biofilm. Successful antimicrobial agents are able to maintain the oral biofilm at levels compatible with oral health but without disrupting the natural and beneficial properties of the resident oral microflora [<xref ref-type="bibr" rid="scirp.50653-ref30">30</xref>] .</p><p>Thus, in biofilms, low CHX concentrations may have anticariogenic effect by inhibiting the expression of enzymes associated with virulence of S. mutans. Furthermore, CHX when used in concentrations of 0.12% and 0.2% for a long time has many side effects such as teeth pigmentation and taste changes [<xref ref-type="bibr" rid="scirp.50653-ref31">31</xref>] .</p></sec><sec id="s4_2"><title>4.2. SEM Analysis</title><p>Radford et al. [<xref ref-type="bibr" rid="scirp.50653-ref32">32</xref>] demonstrated that biofilm formation in vivo can be inhibited using sub-MIC concentrations of CHX. It is possible that the reduction in the formation of the biofilm matrix exposed to low CHX concentrations (<xref ref-type="fig" rid="fig4">Figure 4</xref>) may be related to the affinity of CHX with proteins, as well as the ability to reduce the expression of some gtfs (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>According to Dunne [<xref ref-type="bibr" rid="scirp.50653-ref33">33</xref>] , CHX only kills outer layers of biofilm bacteria, leaving the healthy microorganisms in the inner layers and allowing the growth of these bacteria later when CHX is not present. It is also noteworthy to understand that possible conformational changes in biofilm structure (e.g., water channels) may contribute to the diffusion of CHX into deeper biofilm layers [<xref ref-type="bibr" rid="scirp.50653-ref12">12</xref>] . This variable might explain the unexpected difference in gtf expression in planktonic and biofilm forms because viable cells might be protected by the low diffusion rate of the agent in the biofilm matrix.</p><p>In this study, planktonic cells, when exposed to higher CHX concentrations, suffered membrane rupture (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Tattawasart et al. [<xref ref-type="bibr" rid="scirp.50653-ref13">13</xref>] found similar results on the CHX effect on Pseudomonas stutzeri species sensitive to the drug. Vitkov et al. [<xref ref-type="bibr" rid="scirp.50653-ref34">34</xref>] , using an ex vivo model, showed that some bacterial cells from biofilm sustained ruptured membranes when exposed to CHX. This observation can be explained by the fact that CHX, which is positively charged, binds tightly to negatively charged bacteria membrane, causing its disruption [<xref ref-type="bibr" rid="scirp.50653-ref35">35</xref>] . Under such microbial stress, it is expected that enzyme expression can be altered as observed at concentration 4.5 &#181;g/ml (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec></sec><sec id="s5"><title>5. Advances and Limitations</title><p>This is the first report to investigate the CHX effects on gtf gene expression from planktonic and biofilm-orga- nized S. mutans, as well as examining and relating its effect on cell surface and biofilm structure.</p><p>A limitation to consider is that, despite the experimental model valuating the gene expression applied in this study has been previously validated (20), certainly a model with a hydroxiapatite surface exposed to saliva would make the model resemble the oral cavity even more than expected. On the other hand, salivary mucins could certainly affect S. mutans adherence and interfere with the material for gene expression evaluation. Overall, the two ways to evaluate (gene expression and SEM) complemented each other bring some extra data on biofilms when exposed to CHX.</p></sec><sec id="s6"><title>6. Conclusions</title><p>In summary, CHX’s effects against bacteria depended on the type of growth organization and the concentration and time of exposure to the drug. CHX may affect cell walls and intervene with biofilm formation mechanisms, and at sub-lethal concentrations, reduces the expression of some gtfs in S. mutans biofilms, which may exert anticariogenic effect.</p><p>From a clinical perspective, the primarily purpose of using mouthwashes containing antimicrobials such as CHX is not the cell death, but rather the control or elimination of these biofilm microorganisms’ virulent mechanisms. Hence, frequent low concentrations of these antimicrobials might be enough for controlling the virulent mechanisms of S. mutans without great depletion of their population in the oral environment.</p></sec><sec id="s7"><title>Acknowledgements</title><p>This study was supported by Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo, FAPESP (proc. #07/ 56100-2), Conselho Nacional de Pesquisa, CNPq (proc. #483794/2006-6 and proc. #472988/2009-3) and Coordena&#231;&#227;o de Aperfei&#231;oamento de Pessoal de N&#237;vel Superior (CAPES). RNS and ACBS were supported by FAPESP (#06/55933-8) and CAPES (PNPD/2010), respectively. DAMA and FCS have CNPq fellowships.</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.50653-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Lang, N.P. and Brecx, M.C. (1986) Chlorhexidine Gluconate—An Agent for Chemical Plaque Control and Prevention of Gingival Inflammation. Journal of Periodontal Research, 21, 74-89.  
&lt;br&gt;http://dx.doi.org/10.1111/j.1600-0765.1986.tb01517.x</mixed-citation></ref><ref id="scirp.50653-ref2"><label>2</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Kidd</surname><given-names> E.A.M. </given-names></name>,<etal>et al</etal>. (<year>1991</year>)<article-title>Role of Chlorhexidine in the Management of Dental Caries</article-title><source> International Dental Journal</source><volume> 41</volume>,<fpage> 279</fpage>-<lpage>286</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.50653-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Zickert, I., Emilson, C.G. and Krasse, B. (1982) Effect of Caries Preventive Measures in Children Highly Infected with the Bacterium S. mutans. Archives of Oral Biology, 27, 861-868. &lt;br&gt;http://dx.doi.org/10.1016/0003-9969(82)90042-5</mixed-citation></ref><ref id="scirp.50653-ref4"><label>4</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Loesche</surname><given-names> W.J. </given-names></name>,<etal>et al</etal>. (<year>1986</year>)<article-title>Role of S. mutans in Human Dental Decay</article-title><source> Microbiological Reviews</source><volume> 50</volume>,<fpage> 2118</fpage>-<lpage>2135</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.50653-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Silva, A.C.B., Cruz, J.S., Sampaio, F.C. and Araújo, D.A.M. (2008) Detection of Oral Streptococci in Dental Biofilm from Caries-Active and Caries-Free Children. Brazilian Journal of Microbiology, 39, 648-651.  
http://dx.doi.org/10.1590/S1517-83822008000400009</mixed-citation></ref><ref id="scirp.50653-ref6"><label>6</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Kuramitsu</surname><given-names> H.K. </given-names></name>,<etal>et al</etal>. (<year>1993</year>)<article-title>Virulence Factors of Mutans Streptococci: Role of Molecular Genetics</article-title><source> Critical Reviews in Oral Biology &amp; Medicine</source><volume> 4</volume>,<fpage> 159</fpage>-<lpage>176</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.50653-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Hamada, S. and Slade, H.D. (1980) Biology, Immunology, and Cariogenicity of S. mutans. Microbiological Reviews, 44, 331-384.</mixed-citation></ref><ref id="scirp.50653-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Zanatta, F.B., Antoniazzi, R.P. and Rosing, C.K. (2007) The Effect of 0.12% Chlorhexidine Rinsing in Previously Plaque-Free and Plaque-Covered Surfaces. A Randomized Controlled Clinical Trial. Journal of Periodontology, 78, 2127-2134. http://dx.doi.org/10.1902/jop.2007.070090</mixed-citation></ref><ref id="scirp.50653-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Gjermo, P. and Eriksen, H.M. (1974) Unchanged Plaque Inhibiting Effect of Chlorhexidine in Human Subjects after Two Years of Continuous Use. Archives of Oral Biology, 19, 317-319.  
&lt;br&gt;http://dx.doi.org/10.1016/0003-9969(74)90193-9</mixed-citation></ref><ref id="scirp.50653-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Baehni, P.C. and Takeuchi, Y. (2003) Anti-Plaque Agents in the Prevention of Biofilm-Associated Oral Diseases. Oral Diseases, 9, 23-29. http://dx.doi.org/10.1034/j.1601-0825.9.s1.5.x</mixed-citation></ref><ref id="scirp.50653-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Gunsolley, J.C. (2006) A Meta-Analysis of Six-Month Studies of Antiplaque and Antigingivitis Agents. Journal of the American Dental Association, 137, 1649-1657. &lt;br&gt;http://dx.doi.org/10.14219/jada.archive.2006.0110</mixed-citation></ref><ref id="scirp.50653-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Hope, C.K. and Wilson, M. (2004) Analysis of the Effects of Chlorhexidine on Oral Biofilm Vitality and Structure Based on Viability Profiling and an Indicator of Membrane Integrity. Antimicrobial Agents and Chemotherapy, 48, 1461-1468. http://dx.doi.org/10.1128/AAC.48.5.1461-1468.2004</mixed-citation></ref><ref id="scirp.50653-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Tattawasart, U., Hann, A.C., Maillard, J.Y., Furr, J.R. and Russel, A.D. (2000) Cytological Changes in Chlorhexidine-Resistent Isolates of Pseudomonas stutzeri. Journal of Antimicrobial Chemotherapy, 45, 145-152.  
http://dx.doi.org/10.1093/jac/45.2.145</mixed-citation></ref><ref id="scirp.50653-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Ajdic, D., Mcshan, W.M., Mclaughlin, R.E., Savic, G., Carson, M.B., Primeaux, C., Tian, R., Kenton, S., Jia, H., Lin, S., Qian, Y., Li, S., Zhu, H., Najar, F., Lai, H., White, J., Roe, B.A. and Ferretti, J. (2002) Genome Sequence of Streptococcus mutans UA159, a Cariogenic Dental Pathogen. Proceedings of the National Academy of Sciences of the United States of America, 99, 14434-14439. &lt;br&gt;http://dx.doi.org/10.1073/pnas.172501299</mixed-citation></ref><ref id="scirp.50653-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Koo, H., Rosalen, P.L., Cury, J.A., Park, Y.K. and Bowen, W.H. (2002) Effects of Compounds Found in Propolis on Streptococcus mutans Growth and on Glucosyltransferase Activity. Antimicrobial Agents and Chemotherapy, 46, 1302-1309. http://dx.doi.org/10.1128/AAC.46.5.1302-1309.2002</mixed-citation></ref><ref id="scirp.50653-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Stipp, R.N., Goncalves, R.B., Hofling, J.F., Smith, D.J. and Mattos-Graner, R.O. (2008) Transcriptional Analysis of gtfB, gtfC, and gbpB and Their Putative Response Regulators in Several Isolates of Streptococcus mutans. Oral Microbiology and Immunology, 23, 466-473. &lt;br&gt;http://dx.doi.org/10.1111/j.1399-302X.2008.00451.x</mixed-citation></ref><ref id="scirp.50653-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Pfaffl, M.W. (2001) A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Research, 29, e45. http://dx.doi.org/10.1093/nar/29.9.e45</mixed-citation></ref><ref id="scirp.50653-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Socransky, S.S. and Haffajee, A.D. (2002) Dental Biofilms: Difficult Therapeutic Targets. Periodontology 2000, 28, 12-55. http://dx.doi.org/10.1034/j.1600-0757.2002.280102.x</mixed-citation></ref><ref id="scirp.50653-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Davies, D. (2003) Understanding Biofilm Resistance to Antibacterial Agents. Nature Reviews Drug Discovery, 2, 114-122. http://dx.doi.org/10.1038/nrd1008</mixed-citation></ref><ref id="scirp.50653-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Shemesh, M., Tam, A. and Steinberg, D. (2007) Differential Gene Expression Profiling of Streptococcus mutans Cultured under Biofilm and Planktonic Conditions. Microbiology, 153, 1307-1317.  
&lt;br&gt;http://dx.doi.org/10.1099/mic.0.2006/002030-0</mixed-citation></ref><ref id="scirp.50653-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Cury, J. and Koo, H. (2007) Extraction and Purification of Total RNA from Sreptococcus mutans Biofilms. Analytical Biochemistry, 365, 208-214. http://dx.doi.org/10.1016/j.ab.2007.03.021</mixed-citation></ref><ref id="scirp.50653-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Cury, J.A., Seils, J. and Koo, H. (2008) Isolation and Purification of Total RNA from Streptococcus mutans in Suspension Cultures and Biofilms. Brazilian Oral Research, 22, 216-222.  
&lt;br&gt;http://dx.doi.org/10.1590/S1806-83242008000300005</mixed-citation></ref><ref id="scirp.50653-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Shemesh, M., Tam, A., Feldman, M. and Steinberg, D. (2006) Differential Expression Profiles of Streptococcus mutans ftf, gtf and vicR Genes in the Presence of Dietary Carbohydrates at Early and Late Exponential Growth Phases. Carbohydrate Research, 341, 2090-2097. &lt;br&gt;http://dx.doi.org/10.1016/j.carres.2006.05.010</mixed-citation></ref><ref id="scirp.50653-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Tam, A., Shemesh, M., Wormser, U., Sintov, A. and Steinberg, D. (2006) Effect of Different Iodine Formulations on the Expression and Activity of Streptococcus mutans Glucosyltransferase and Frutosyltransferase in Biofilm and Planktonic Environments. Journal of Antimicrobial Chemotherapy, 57, 865-871. http://dx.doi.org/10.1093/jac/dkl085</mixed-citation></ref><ref id="scirp.50653-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Koo, H., Seils, J., Abranches, J., Burne, R.A., Bowen, W.H. and Quivey, R.G. (2006) Influence of Apigenin on gtf Gene Expression in Streptococcus mutans UA159. Antimicrobial Agents and Chemotherapy, 50, 542-546.  
http://dx.doi.org/10.1128/AAC.50.2.542-546.2006</mixed-citation></ref><ref id="scirp.50653-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Fujiwara, T., Hoshino, T., Ooshima, T. and Hamada, S. (2002) Differential and Quantitative Analysis of mRNA Expression of Glucosyltransferases from Streptococcus mutans MT8148. Journal of Dental Research, 81, 109-113.  
http://dx.doi.org/10.1177/154405910208100205</mixed-citation></ref><ref id="scirp.50653-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Li, Y. and Burne, R.A. (2001) Regulation of the gtfBC and ftf Genes of Streptococcus mutans in Biofilms in Response to pH and Carbohydrate. Microbiology, 147, 2841-2848.</mixed-citation></ref><ref id="scirp.50653-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Klein, M.I., De Baz, L., Agidi, S., Lee, H., Xie, G., Lin, A.H.M., et al. (2010) Dynamics of Streptococcus mutans Transcriptome in Response to Starch and Sucrose during Biofilm Development. PLoS ONE, 5, e13478.  
http://dx.doi.org/10.1371/journal.pone.0013478</mixed-citation></ref><ref id="scirp.50653-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Wade, W.G. (2010) New Aspects and New Concepts of Maintaining “Microbiological” Health. Journal of Dentistry, 38, S21-S25. http://dx.doi.org/10.1016/S0300-5712(10)70007-5</mixed-citation></ref><ref id="scirp.50653-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Marsh, P.D. (2010) Controlling the Oral Biofilm with Antimicrobials. Journal of Dentistry, 38, S11-S15.  
http://dx.doi.org/10.1016/S0300-5712(10)70005-1</mixed-citation></ref><ref id="scirp.50653-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Ciancio, S.G. (1995) Chemical Agents: Plaque Control, Calculus Reduction and Treatment of Dentinal Hypersensitivity. Periodontology 2000, 8, 75-85. &lt;br&gt;http://dx.doi.org/10.1111/j.1600-0757.1995.tb00046.x</mixed-citation></ref><ref id="scirp.50653-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Radford, J.R., Homer, K.A., Naylor, M.N. and Beighton, D. (1992) Inhibition of Human Subgingival Plaque Protease Activity by Chlorhexidine. Archives of Oral Biology, 37, 245-248. &lt;br&gt;http://dx.doi.org/10.1016/0003-9969(92)90045-A</mixed-citation></ref><ref id="scirp.50653-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Dunne Jr., W.M. (2002) Bacterial Adhesion: Sean Any Good Biofilms Lately? Clinical Microbiology Reviews, 15, 155-166. http://dx.doi.org/10.1128/CMR.15.2.155-166.2002</mixed-citation></ref><ref id="scirp.50653-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Vitkov, L., Hermann, A., Krautgartner, W.D., Herrmann, M., Fuchs, K., Klappacher, M. and Hannig, M. (2005) Chlorhexidine-Induced Ultrastructural Alterations in Oral Biofilm. Microscopy Research and Technique, 68, 85-89.  
http://dx.doi.org/10.1002/jemt.20238</mixed-citation></ref><ref id="scirp.50653-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Hugo, W.B. and Longworth, A.R. (1966) The Effect of Chlorhexidine on the Electrophoretic Mobility, Cytoplasmatic Constituents, Dehydrogenase Activity and Cell Walls of Escherichia coli and Staphylococcus aureus. Journal of Pharmacy and Pharmacology, 18, 569-578. &lt;br&gt;http://dx.doi.org/10.1111/j.2042-7158.1966.tb07935.x</mixed-citation></ref></ref-list></back></article>