Microalgae with high oil productivities are most desired in biodiesel production. Chlorella lewinii SUB3545914, was isolated and assessed for its growth rates, lipid productivities and fatty acid profiles under heterotrophic cultivation. The alga was isolated after enrichment in BG-11 medium (pH = 7.3) under a light intensity of approximately 17.5 μE·m -2·s -1 at 30°C ± 2°C. In addition to morphology, polymerase chain reaction (PCR) and metagenomics were used for isolate identification. The DNA was sequenced and multiple sequence alignment of the BLASTED results revealed 95% similarity to Chlorella lewinii. Maximum growth (3.15 ± 0.06 g·L -1), lipid content (44.0%) and lipid volumetric productivities (118.80 ± 3.02 mg·L -1·day -1) in glucose supplemented media were more appreciable in comparison with the glycerol counterparts. Similarly, the highest growth (2.03 ± 0.68 g·L -1), lipid content (31.47%) and lipid productivities (47.21 ± 2.08 mg·L -1·day -1) in glycerol supplemented media were more than those got under autotrophic cultivation. Chlorophyll contents did not vary remarkably in heterotrophic cultures. The major fatty acids obtained by Gas Chromatography Mass Spectrometry (GC-MS) were oleic and Octadecanoic acids for all the culture conditions. Chlorella lewinii is appropriate for accumulating lipids for biodiesel under heterotrophic cultivation on glucose because of high lipid volumetric productivities.
The demand for petroleum products is increasing because of the rising world population and industrialization. Although petro-diesel is currently cheaper than biodiesel, the interest in the development of technologies for the production of biodiesel has been on the increase due to its production from renewable biological sources. It is ecologically friendly, releasing comparatively very little carbon monoxide, much less hydrocarbons particulate matter (HPM) and no sulfur and aromatic compounds to the environment during combustion [
Feedstock from biomasses is robustly being exploited for possible substitution of the ecologically non-friendly fossilized resources. Consequently, vegetable oils have been the key candidate in this pursuit. A major demerit of the use of this oil is that biodiesel produced from vegetable oils is usually expensive. In addition, they contain high proportions of undesirable free fatty acids (FFA) that constitute serious conversion problems during transesterification [
Microalgae with high oil productivities are most desired in biodiesel production. The obvious reasons for use of microalgae include fast growth rate [
Besides, some heterotrophically cultivated microalgae produce higher oils than their photoautotrophic counterparts [
The study investigated the oil producing potential of a novel microalga―Chlorella lewinii SUB3545914.
The microalga, Chlorella lewinii was isolated from a fresh water body in North East Nigeria [
The algal culture broth sample was centrifuged at 14,000 revolutions per minute (rpm) for 10 min in a micro-centrifuge (EppendorfTM 5424 Micro-centrifuge). This was washed 3 times using 1 mL of ultra-pure water with another centrifugation at 12,000 rpm for 5 min. DNA extraction and purification were done using ZRSoil DNA MiniPrep (TM50 Preps, Model D6001, Zymo Research, California, USA). A 50 - 100 mg of the cells was suspended in 200 µL of sterile water and was transferred into a lysis tube (ZRBashingBeadTM). This was followed by the addition of 750 µL of lysis solution. The bead containing the solution was added to the bead beater which had a 2 mL tube holder fitted to it. This was spun at 12,000 rpm for 5 min according to the method reported by Ogbulie and Nwaokorie [
Identification of the isolate utilised18SrRNA sequencing with ITS-1 and ITS-4 as universal primers. The primer sequences were 18S forward-'TTTCTGCCCTATCAACTTTCGATG'
18S reverse-'TACAAAGGGCAGGGACGTAAT'
ITS-1 TCCGTAGGTGAACCTGCG G
ITS-4 TCCTCCGCT TAT TGA TAT GC
Sequencing was done by Sanger dideoxy sequencing method (Sanger SequencerTM 3730/3730XL) DNA Analyzers. The result was analyzed by direct blasting on http://blast.ncbi.nlm.nih.gov. The BLAST results show top hits with minimum E-score (0.0) and 95% - 100% identical similarities were used to identify the alga.
Biomass concentrations were measured at a two-day interval until a stationary phase was reached, and the specific growth rate (µ) was calculated as according to Liang et al. [
μ = ( ln N t − ln N 0 ) t − t 0 (1)
where Nt = cell density at a time (t) and N0 = cell density at the start of the exponential phase (t0).
A 10 mL sample of the culture broth was centrifuged (3000 X g for 20 min) and the pellets washed three times by further centrifugation (3000 X g for 10 min) using sterile deionized water. The weight of the wash (W1) was recorded, followed by drying in an air oven (70˚C) for 6 - 8 h until a constant weight was obtained and then re-weighed (W2).
CellDryWeight ( CDW ) = W 2 − W 1 (2a)
Converting to g・L−1, CDW ( g L ) = W 2 − W 1 V × 1000 1 (2b)
where: w2 = weight of filter paper and dried cells (g)
w1 = weight of filter paper (g)
v = volume of culture (mL)
Methanol and water were used to extract chlorophyll using the method of Becker [
Chlorophyll a ( mg ⋅ L − 1 ) = ( 16.5 × A 665 ) − ( 8.3 × A 650 ) (3) [
Chlorophyll b ( mg ⋅ L − 1 ) = ( 33.8 × A 650 ) − ( 12.5 × A 665 ) (4) [
Chlorophyll a + b ( mg ⋅ L − 1 ) = ( 4.0 × A 665 ) − ( 225.5 × A 650 ) (5) [
The lipid content of the microalga was extracted from the dry cell mass using the protocol of Bligh and Dyer [
Lipid productivity ( g ⋅ L − 1 ⋅ d − 1 ) = Total algae biomass ( g ) × lipid content ( % ) Working volume ( i ) × Cultivation time ( d ) ( 6)
Fatty acid content of the algal oil was determined by gas chromatography mass spectrometry (GC-MS) (Shimadzu, Japan, Model GCMS-QP 2010 Plus) [
The data generated from the research were analyzed using Statistical Package for Social Sciences (SPSS) version 16.0. One way analysis of variance and other descriptive statistics were employed.
Microscopic examination of the isolate showed that it has an oval to circular unicellular structure appearing singly except for dividing cells that appeared double. The full nucleotide sequence information is given in the supplementary section. Multiple alignment of the amplified sequence revealed 95% sequence similarity to Chlorella lewinii (
The effects of glucose concentration as the sole carbon source on the growth and lipid contents of Chlorella lewinii are presented in
There was no statistically significant difference (p < 0.05) in the lipid concentration at the exponential and stationary growth phases in the media with 2% and 4% glucose. The maximum chlorophyll a + b contents obtained in this study ranged from 3.30 ± 0.03 to 5.50 ± 0.04 mg・g−1 cell (
The glycerol concentration that supported the highest cell growth was 0.25 mL・L−1 (
Comparison of the maximum cell growth and lipid production under photoautotrophic and heterotrophic cultivation of Chlorella lewinii is presented in
S/No | Strain | Max score | Total score | Query cover (%) | E value | Identity (%) | Accession |
---|---|---|---|---|---|---|---|
1 | Chlorella lewinii KU213 | 1203 | 1203 | 97 | 0.0 | 95 | KM061460 |
2 | Chlorella lewinii KU217 | 1197 | 1197 | 97 | 0.0 | 95 | KM061462 |
3 | Chlorella lewinii KU215 | 1197 | 1197 | 97 | 0.0 | 95 | KM061461 |
4 | Chlorella lewinii KU220 | 1192 | 1192 | 97 | 0.0 | 95 | KM061464 |
5 | Chlorella lewinii KU201 | 1181 | 1181 | 97 | 0.0 | 95 | KM061450 |
6 | Chlorella lewinii | 1177 | 1177 | 90 | 0.0 | 97 | LC172265 |
7 | Chlorella lewinii | 1166 | 1166 | 96 | 0.0 | 94 | FM205861 |
8 | Chlorella lewinii spIso4 | 813 | 813 | 99 | 0.0 | 86 | JX041600 |
9 | Chlorella lewinii KU209 | 795 | 795 | 97 | 0.0 | 86 | KM061458 |
10 | Chlorella sorokiniana strain CCTCCM 209220 | 756 | 758 | 95 | 0.0 | 92 | KP64522 |
Glucose concentration (g・L−1) | Max. Chlorophyll a + b (mg・g−1 cell) | Specific growth rate, (µd−1) | Max. Biomass concentration (gL−1) | Biomass productivity (g・L−1・day−1) | Lipid content (%) | Lipid productivity (mg・L−1・day−1) |
---|---|---|---|---|---|---|
10.0 | 3.30 ± 0.03 | 0.17 ± 0.03 | 2.04 ± 0.12 | 0.20 ± 0.01 | 28.17 | 56.34 ± 1.50 |
20.0 | 4.50 ± 0.19 | 0.18 ± 0.02 | 2.49 ± 0.17 | 0.25 ± 0.01 | 32.33 | 80.83 ± 2.07 |
30.0 | 4.80 ± 0.25 | 0.19 ± 0.03 | 2.72 ± 0.29 | 0.32 ± 0.02 | 32.67 | 104.45 ± 1.05 |
40.0 | 5.50 ± 0.04 | 0.19 ± 0.01 | 3.15 ± 0.06 | 0.27 ± 0.03 | 44.00 | 118.80 ± 3.02 |
aResults are means of triplicate tests.
Glycerol concentration (mL・L−1) | Max. Chlorophyll a + b (mg・g−1 cell) | Specific growth rate, (µd−1) | Max. Biomass concentration (g・L−1) | Biomass productivity (g・L−1・day−1) | Lipid content (%) | Lipid productivity (mg・L−1・day−1) |
---|---|---|---|---|---|---|
0.25 | 4.90 ± 0.60 | 0.16 ± 0.01 | 2.03 ± 0.68 | 0.18 ± 0.01 | 22.55 | 40.59 ± 2.25 |
0.50 | 4.50 ± 0.55 | 0.15 ± 0.04 | 1.84 ± 0.03 | 0.16 ± 0.01 | 22.03 | 35.25 ± 0.38 |
0.75 | 4.00 ± 0.30 | 0.12 ± 0. 01 | 1.95 ± 0.13 | 0.17 ± 0.02 | 22.98 | 39.07 ± 1.15 |
1.00 | 3.50 ± 0.14 | 0.12 ± 0.02 | 1.69 ± 0.31 | 0.15 ± 0.02 | 31.47 | 47.21 ± 2.08 |
bResults are means of triplicate tests.
Culture mode | Max. biomass conc. (g・L−1) | Max. specific growth rate (µd−1) | Max. lipid content (%) | Biomass productivity (g・L−1・day−1) | Max. Lipid productivity (mg・L−1・day−1) | Max. Chlorophyll a + b (mg・g−1 cell) |
---|---|---|---|---|---|---|
Photoautotrophic | 1.02 ± 0.03 | 0.16 ± 0.01 | 16.6 | 0.13 ± 0.02 | 21.58 ± 1.30 | 39.71 ± 2.05 |
Heterotrophic (glucose supplement) | 3.15 ± 0.13 | 0.35 ± 0.01 | 44 | 0.27 ± 0.3 | 118.80 ± 3.02 | 5.50 ± 0.04 |
Heterotrophic (glycerol supplement) | 2.03 ± 0.68 | 0.19 ± 0.03 | 31.47 | 0.15 ± 0.02 | 47.21 ± 2.08 | 4.90 ± 0.60 |
(3.15 ± 0.13 g・L−1) and glycerol (2.03 ± 0.68 g・L−1) were respectively 5.5 and 2.2-folds higher than the values obtained in photoautotrophic culture but the chlorophyll contents of the alga under photoautotrophic culture condition were 7 times the values obtained in heterotrophic cultures (
Comparison of chemical composition of the oils from Chlorella lewiniiSUB3545914 under different growth conditions showed that major fatty acid obtained was oleic acid (C18:1) for all the culture methods. Other fatty acids were myristic acid (C14:0), stearic acid (C18:0) and linoleic acid (C18:3). Over 70% of the fatty acids were oleic and stearic acids.
This work has demonstrated, for the first time, that Chlorella lewinii SUB3545914 has the potential for high lipid accumulation. However, other strains of Chlorella have also been used in the production of high lipids for biodiesel [
The microalga demonstrated the ability to grow in BG-11 medium supplemented with varying concentrations of glucose under strict heterotrophic condition. Most importantly, under this growth state, the biomass concentrations increased with increase in glucose concentrations. This attribute of heterotrophy is important because of numerous claims that heterotrophic cultures yield more biomasses and lipids in microalgae [
Although microalgal heterotrophic growth is found to be dependent on glucose concentration [
The highest lipid content of Chlorella lewinii was obtained in culture supplemented with the highest medium glucose, presupposing that lipid accumulation is also dependent on the medium glucose dosage. This aspect is very important because for glucose requirement to be high, the cost of production will also be proportionately high. This may have direct effect on the final product and could defeat the aim of lipid production and microalgal biodiesel production feasibility, which is linked to cost. Previous report by Zhao et al. [
Chlorella lewinii was also able to grow and accumulate lipids in media containing different concentrations of glycerol. In the present study, the growth of Chlorella lewinii showed a somewhat inverse relationship with the initial medium glycerol concentration. This indicates a probable positive event since large volume would not be needed in order to achieve high biomass. Studies on glycerol utilisation by microalgae for lipid accumulations have been documented [
The maximum observable lipid accumulated by Chlorella lewinii was at highest medium glycerol concentration, indicating a direct albeit subtle relationship between medium glycerol and lipid content. This observation supports the report of Liang et al. [
The demonstration that Chlorella lewinii could utilize glycerol for growth and lipid accumulation is important since glycerol is a by-product of biodiesel production. Consequently, the alga could be used to mop up the glycerol generated as waste during biodiesel production, enabling the system to auto-recycle its waste product. The values obtained for maximum biomass and lipid productivities in the present study were higher in glucose medium than in glycerol medium. However, it might be more economical to use crude glycerol from biodiesel plants rather than procure glucose.
Under heterotrophic cultivation, biomass concentrations were higher for both glucose and glycerol-supplemented media than those obtained in photoautotrophic cultures. This supports the argument that heterotrophic cultures yield more biomass than their autotrophic counterparts [
However, the identification of cheap and easily available carbon sources is a major challenge in making the heterotrophic production of biodiesel oil and other high-volume, low-price products economically viable. To this end, for the use of wastewater that contains significantly high carbon sources that can be utilized by oleaginous microorganisms is a very viable alternative. Although the present study has supported the previous ones that heterotrophic cultures yield more biomass and lipids, yet there is another very significant bottleneck associated with heterotrophic cultivation. Contamination is a big challenge and has to be addressed strictly in any heterotrophic culture design.
Oleic acid (C18:1) obtained as the major fatty acid in the present study is an indicator of the quality of a good biodiesel. Oleic acid [mono-unsaturated fatty acid (MUFA)] along with stearic (Octadecanoic) and linoleic acids are the most common fatty acids associated with biodiesel [
This work has demonstrated, for the first time, that Chlorella lewinii SUB3545914 is capable of growing under heterotrophic cultures using both glucose and glycerol as the carbon sources. The biomass concentrations obtained in heterotrophic cultures with glucose (3.15 ± 0.13 g・L−1) and glycerol (2.03 ± 0.68 g・L−1) were respectively 5.5 and 2.2-folds higher than the values obtained in photoautotrophic cultures but the chlorophyll contents of the alga under photoautotrophic culture conditions were 7 times more than the values obtained in heterotrophic cultures. Lipid productivity in heterotrophic culture with glucose was 5.5 times higher than the value obtained in photoautotrophic culture. Consequently, heterotrophic cultivation on glucose was the best culture method for mass cultivation of Chlorella lewini and lipid accumulation.
The authors declare no conflicts of interest regarding the publication of this paper.
Ogbonna, I.O. and Ogbonna, J.C. (2018) Evaluation of Oil Producing Potential of a New Isolate―Chlorella lewinii SUB3545914 for Biodiesel Production under Heterotrophic Cultivation. Journal of Sustainable Bioenergy Systems, 8, 67-81. https://doi.org/10.4236/jsbs.2018.83005