This study aims to evaluate the preventive effects of anthocyanins extracts (MAEs) from mulberry variety PR-01 against N-nitrosodiethylamine (NDEA)-induced hepatocarcinogenesis in rats. It was found that 150 mg·kg - 1 MAEs treatment significantly reduced the NDEA-induced hepatic nodules incidence and hepatocellular carcinoma incidence by 58.30% and 41.70% compared to the model group. Meanwhile, MAEs significantly restored the elevated the liver function enzymes, inhibited the tumor necrosis factor alpha and interleukin-6 levels, elevated the serum interleukin-10 and interferon-γ and increased hepatic glutathione-S-transferase and UDP-glucuronosyltransferase 2B1 enzyme activity. Moreover, 150 mg·kg - 1 MAEs supplement enhanced glutathione content and the activities of superoxide dismutase, catalase, glutathione peroxidase activities but reduced the malondialdehyde and thiobarbituric acid-reactive substances content by 37.90% and 44.52%. Furthermore, MAEs pretreatment maintained nuclear factor erythroid 2-related factor 2 (Nrf2), Kelch-like ECH-associated protein 1, heme oxygenase-1, and NAD(P)H: quinine oxidoreductase1 stimulation and inhibited the expression of TNF-α, nuclear factor-kappaB (NF-κB), and cyclooxygenase-2 (COX-2), indicating that MAEs exhibit effectively prevention effects against liver cancer via decreased lipid peroxidation, induced Nrf2-mediated antioxidant enzymes and attenuating the inflammatory mediators COX-2 through NF-κB pathway. Thus, MAEs of mulberry variety PR-01 may be used as a good functional dietary supplement against liver cancer.
According to the histological classification, primary liver cancer can be divided into hepatocellular carcinoma (HCC), cholangiocarcinoma and mixed liver cancer, among which HCC is the most common [
In the past few decades, dietary studies have shown that regular consumption of fruits and vegetables reduces the risk of chronic diseases such as heart disease and cancer [
Mulberry (Morus alba L.) fruit has been traditionally used in Chinese medicines for its pharmacological effects including antioxidant activity, anti-inflam- matory, hepatoprotective effect, and anti-diabetic properties, etc. [
In our preliminary work, we have found that black mulberry fruit is abundant in anthocyanins, especially the new cultivars, mulberry variety PR-01, which the anthocyanins content is 193.00 mg・100g−1, 10.16-fold that of the common variety (19.00 mg・100g−1) [
Fresh mature mulberry variety PR-01 fruits was obtained in May 2016 from the Institute of Agricultural Product Quality, Fujian Agriculture and Forestry University (Fujian, China) and stored at −80˚C on the same day.
All chemicals were ordered from Sigma-Aldrich (Shanghai, China) or Beijing Dingguo Changsheng Biotech Co., Ltd. (Beijing, China). TRIzol reagent, HiScript II Q RT SuperMix for qPCR (+cDNA wiper) and AceQTM qPCR SYBRR Green Master Mix were purchased from Takara Co., Ltd. (Dalian, China). Rabbit polyclonal antibodies nuclear factor-kappaB (NF-κB), cyclooxygenase-2 (COX-2), tumor necrosis factor alpha (TNF-α), Kelch-like ECH-associated protein 1 (Keap1), NAD(P)H:quinine oxidoreductase1 (NQO1), heme oxygenase-1 (HO-1) and Nrf2 were purchased from Santa Cruz Biotechnology or Cell Signaling (Danvers, MA, US).
The PR-01 mulberry anthocyanin rich-extract was extracted as previously described [
Reference to previous study [
A = (A520 nm − A700 nm) pH 1.0 − (A520 nm − A700 nm) pH 4.5 (1)
The total anthocyanin content of MAEs was calculated according to the formula derived by Wrolstad et al. [
Total anthocyanin content (mg・g−1) = A × M W × D F × V × 1000 ε × 1 × M (2)
where MW is the molecular weight of cyclamine-3-glucoside (449.2), DF is the dilution, ε is the molar absorptivity (29,600), l is the optical path (1.0 cm), V is the total volume of MAEs diluents (1.0 ml), and M (0.01 g) is the weight of the MAEs.
Quantifications of anthocyanin monomers were performed on a LC-MS/MS (Thermo Fisher Scientific Inc., SAN JOSE, Calif.) with a MRM mode. The LC-MS analysis was carried out using a LC-MS system comprising of a LC (2010, Finnigan, USA) and LCQ Fleet Ion Trap LC/MS (LCQ Fleet, Thermo Fisher Scientific). Mass spectrum condition: positive ion scanning (ESI+, m/z 200 ~ 1200), the collision induced dissociation voltage was 150 V; capillary voltage: 3.8 kV; taper hole voltage: 30 v. Voltage of photoelectric multiplier: 650 V; Ion source temperature: 120˚C; Take off the solvent temperature: 250˚C.
Separation of anthocyanins in MAEs was on a 2.1 × 150 mm, 1.7 μm ACQUITY UPLC BEH C18 column (Waters, UK) analyzed by UPLC using a ACQUITY UPLC H-Class system with a 2996 PDA detector (Waters, Milford, MA, USA). Anthocyanin standards (Sigma-Aldrich, Shanghai, China) were used for quantitative determination.
All animal studies were conducted in accordance with Chinese National Guidelines for the Care of Laboratory Animals and approved by the Animal Ethics Committee of the Laboratory Animal Center, Fujian University of Traditional Chinese Medicine (Fujian, China). Four-week-old SPF-grade male Wistar rats were purchased from Shanghai slac laboratory animal Co., Ltd. with animal production license No.: SCXK (HU) 2012-0002. All animals were housed in an SPF barrier system of the Laboratory Animal Center, Fujian University of Traditional Chinese Medicine. Breeding conditions were as follows: temperature 20˚C ~ 25˚C, relative humidity 40% ~ 60%, 12 h day/night alternation.
Rats were fed with a rodent diet and had tap water ad libitum. After a week of adaptive feeding, the rats were randomly divided into five groups. The control group (Control), model group (NDEA), NDEA + low-dose MAEs (MAEs-75), NDEA + high-dose (MAEs-150), and NDEA + cyanidin-3-glucoside (C3G-150). The animal experiment design is showned in
UniProt ID | Gene symbol | Forward primer (5’-3’) | Reverse primer (5’-3’) |
---|---|---|---|
AF304364.1 | Nrf2 | ACCCACCGCCTGGGTTCAGT | TGTGCCCTTGAGCTGGCGAC |
NM_173295.1 | UGT2b1 | TTAGACCTGGAGCCTGTGGAAA | GCCGAAGATACAAGAACCGTGA |
NM_017014.1 | GST | AGAGCAGCCGCTACCTCTCAAC | CCAATGTGGACAGGTCCTCCCT |
NM_001159613.1 | NQO1 | CCAGCAGCCCGGCCAATCTG | AGGTCCGACACGGCGACCTC |
NM_182864.2 | Keap1 | TGATGGACAAACCCAACTCA | CACTGGACAGGAAACCACCT |
NM_001004027.1 | HO-1 | AGGCTGAGAATGCCGAGTTC | TGTGGTACAAGGACGCCATC |
NM_214022.1 | TNF-α | GGAACTGGCAGAGGAGGCGC | CCCCGCCACGAGCAGGAATG |
NM_199267.2 | NF-κB | TGATGACATACTCCCACAAG | CAATATCCCCAGACCTAAC |
S67722.1 | COX-2 | ACCAGCAGTTCCAGTATCAGA | AAGTGAGCAAGTCCGTGTTC |
NM_017008.4 | GAPDH | CGGAGTCAACGGATTTGGTCGTAT | AGCCTTCTCCATGGTGGTGAAGAC |
blood samples and blood samples were centrifuged at 3000 rpm at 4˚C for 10 min to obtain serum. Livers were fully excised from the animal and accurately weighed [
The levels of serum aspartate transaminase (AST), alanine aminotransferase (ALT), γ-glutamyl transpeptidase (GGT), total bilirubin (TBiL), alkaline phosphatase (ALP), Blood Urea Nitrogen (BUN), and creatinine were detected according to the instructions of commercial kits (Nanjing Jiancheng Bioengineering Engineering Institute, Nanjing, China) using Infinite M200 PRO Varioskan Flash (TECAN, Switzerland). The levels of serum alpha fetal protein (AFP), carcino embryonie antigen (CEA), TNF-α, interleukin-6 (IL-6), interleukin-10 (IL-10) and interferon-γ (IFN-γ) were measured by ELISA kit (CUSABIO Biotech Co., Ltd., Wuhan, China) according to manufacturer’s instructions.
Precisely 1 gram of liver was taken, rinsed with cold PBS, pH 7.4, dried with paper wipe, and placed in a 10-mL centrifuge tube. Then the tissue homogenate was centrifuged at 3500 rpm for 15 min. The supernatant was collected in a 10-mL centrifuge tube (namely 10% liver homogenate), immediately frozen in liquid nitrogen and stored at −20˚C until use [
Hepatic tissues from each group were washed with cold physiological saline and rapidly excised after the rats were sacrificed. The tissue samples were immediately fixed in 4% phosphate-buffered paraformaldehyde for 48 h, then dehydrated in a graded ethanol series, cleared in xylene and embedded in paraffin. Sections (4 μm thick) were stained with hematoxylin and eosin (H&E) according to published methods [
The proteins expression of inflammatory markers in liver tissue was detected by the SABC immunohistochemical method. The main steps are as follows: paraffin section (4 μm thick) was de-waxed and incubated with sodium citrate buffer (pH 6.0) at 37˚C for 5 min (twice), then washed with 0.1 M PBS for 5 min (3 times), incubated with 3% hydrogen peroxide at 37˚C for 10 min, washed with PBS for 5 min (3 times) and placed in a blocking solution at room temperature for 1.5 - 3 h. The sections were incubated with rabbit polyclonal antibodies, NF-κB, COX-2, and TNF-α (Cell Signaling, Danvers, MA, USA) with TBS and Tween 20 overnight at 4˚C. Then sections were washed with PBS and incubated with HRP-labeled sheep-anti-rabbit secondary antibody at 37˚C for 1 - 2 h followed by streptavidin-biotin-peroxidase at room temperature for 30 min. The slides were washed and the immunoprecipitation was visualized by treating with 3, 3'-diaminobenzidine for color development for 25 min. Then slides were counterstained with hematoxylin and the brown color signifying the presence of antigen bound to antibody was detected by light microscopy. For the negative control, TBS was used instead of a primary antibody. From ten randomly selected sections of each slide, 500 cells were counted. The percentage of positive cells for each group was calculated using the Image-Pro Plus 6.0 image analysis system.
Liver tissue was lysated in RIPA lysis buffer containing protease inhibitor cocktail protease inhibitors and phosphatase inhibitors according to the M-PER (R) Mammalian Protein Extraction Reagent (Thermo Scientific, Fair Lawn, NJ, USA). The protein extraction was collected and the concentrations were quantified using a BCA kit (Biotechnology Development Co., Ltd., Beijing, China). The same amount of proteins was separated using 10% SDS-polyacrylamide gel and transferred to polyvinylidence fluoride (PVDF) membranes. After blocked with 5% skim milk for 1 h at room temperature, membranes were incubated with various antibodies against Nrf2 (1:2000), NQO1 (1:1000), HO-1 (1:2000), Keap1 (1:500), NF-κB (1:4000), COX-2 (1:500), TNF-α (1:1000), and β-actin (1:2000) which purchased from Cell Signaling Technology (Danvers, MA, USA) or Santa Cruz Biotechnology (Santa Cruz, CA, USA) overnight at 4˚C. Then membranes were washed and exposed to HRP-conjugated secondary antibodies (1:10,000) at room temperature for 1 h. Immunoreactive bands were detected by enhanced cheiluminescence solution (CUSABIO Biotech Co., Ltd., Wuhan, China) and exposed to X-ray film using the Bio-Rad Chemi Doc XRS imaging System. The immunoreactive bands were visualized and quantified using Quantity One software and normalized to β-actin.
Total RNA was extracted from liver tissue using a TRIzol reagent (Invitrogen, Thermo Fisher Scientific Inc., Beijing, China) according to the manufacturer’s instructions. Real-time PCR was performed using the SYBR Green Kit (Takara Biomedical Technology Co., Ltd., Beijing, China) on the ABI Step One RT-PCR system. Primers designed with Primer Premier 5 and Beacon Designer 8.1 was listed in
Data was presented by mean standard deviation (SD). Data from study was dealed with SPSS 21.0 statistical package. Statistical analysis was performed by one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons or Student’s t-test. A P-value of <0.05 was considered statistically significant. The GraphPad Prism 6.01 was used for the graphical evaluations.
The total anthocyanins content of the PR-01 mulberry anthocyanins rich-extract was (718 ± 8.9) mg・100g−1. UPLC-ESI-MS analysis showed the pelargonidin 3-glucoside (P3G), C3R and C3G is the main anthocyanins (
Groups | No. of animals | Ip administration | Gavage administration |
---|---|---|---|
Every Tuesday and Friday 8:30 am from 2 weeks to 12 weeks | Every day 10:00 am from 1 weeks to 18 weeks | ||
Control | 10 | Physiological saline | Distilled water |
NDEA | 12 | 25 mg/kg NDEA | Distilled water |
C3G-150 | 12 | 25 mg/kg NDEA | 150 mg/kg C3G |
low-dose MAE (MAEs-75) | 12 | 25 mg/kg NDEA | 75 mg/kg MAEs |
high-dose MAEs (MAEs-150) | 12 | 25 mg/kg NDEA | 150 mg/kg MAEs |
Ip, intraperitoneal injection; C3G, cyanidin-3-glucoside; MAEs, mulberry anthocyanins extract; NDEA, N-nitrosodiethylamine. Gavage doses of MAEs intervention groups were calculated by C3G contents. The MAEs and C3G were dissolved in distilled water.
showed that the content of P3G, C3R and C3G in the MAEs is (75.4 ± 6.5) mg・g−1, (105.8 ± 4.1) mg・g−1, and (593.0 ± 12.6) mg・g−1, respectively. The mass spectrum of MAEs is shown in
As shown in
NDEA causes liver damage and consequently releases liver enzymes in its selected dose [
Groups | Intial Body weight (g) | Final Body weight (g) | Body weight gain (g) | Feed intakes (g/day/rat) | Relative liver weights# |
---|---|---|---|---|---|
Control | 141.25 ± 4.87a | 592.42 ± 28.54a | 451.17 ± 28.98a | 27.06 ± 3.48a | 2.92 ± 0.43b |
NDEA | 141.42 ± 4.34a | 514.83 ± 38.32c | 373.42 ± 38.11c | 21.99 ± 1.45c | 4.23 ± 0.64a |
C3G-150 | 141.92 ± 7.97a | 531.33 ± 64.91bc | 389.42 ± 64.40bc | 24.92 ± 2.03b | 3.79 ± 0.62a |
MAEs-75 | 141.92 ± 6.52a | 554.42 ± 42.68b | 413.08 ± 43.53b | 25.28 ± 2.34ab | 3.23 ± 0.49b |
MAEs-150 | 141.08 ± 7.47a | 556.00 ± 21.86b | 414.75 ± 25.21b | 25.08 ± 3.50ab | 3.03 ± 0.38b |
Note: #Relative liver weights equal liver weight/body weight × 100. Values expressed as mean ± S.D. (n = 8 - 10). Values with different superscript letters (a, b, c, d, e) within cultivar are significantly different.
Groups | Control | NDEA | C3G-150 | MAEs-75 | MAEs-150 |
---|---|---|---|---|---|
ALT (U/L) | 40.70 ± 8.85d | 85.63 ± 17.78a | 61.50 ± 19.63b | 54.80 ± 11.67bc | 46.10 ± 11.14cd |
AST (U/L) | 83.10 ± 12.71c | 173.13 ± 47.09a | 113.80 ± 23.70b | 98.10 ± 21.56bc | 93.20 ± 13.50c |
TBiL (mg/dl) | 2.32 ± 0.26c | 4.45 ± 0.76a | 3.02 ± 0.41b | 2.89 ± 0.31b | 2.30 ± 0.17c |
ALP (U/L) | 58.60 ± 9.16b | 90.63 ± 14.93a | 78.10 ± 22.81a | 60.20 ± 17.03b | 53.80 ± 9.37b |
GGT (U/L) | 30.26 ± 3.62d | 115.43 ± 14.37a | 68.24 ± 6.08c | 50.55 ± 3.25c | 39.32 ± 6.54cd |
BUN (mmol/L) | 5.40 ± 1.07b | 8.87 ± 1.13a | 7.12 ± 2.67b | 6.02 ± 2.26b | 5.81 ± 1.51b |
Creatinine(μmol/L) | 23.96 ± 9.58e | 68.36 ± 9.86a | 47.15 ± 10.54bc | 33.50 ± 8.85de | 31.43 ± 14.44de |
CEA (ng/ml) | 2.16 ± 0.44d | 7.35 ± 0.57a | 6.76 ± 1.18ab | 5.44 ± 1.85bc | 4.46 ± 1.87c |
AFP (ng/ml) | 22.27 ± 6.18c | 67.54 ± 6.91a | 53.47 ± 16.69a | 45.54 ± 17.76b | 34.28 ± 13.2bc |
Values with different superscript letters (a, b, c, d, e) within cultivar are significantly different.
liver damage in rats.
As one of the most important environmental hepatotoxin and carcinogen, NDEA can cause severe liver damage and lead to severe alterations in the lobular architecture and hampers liver functioning [
As shown in
Hepatic neoplasm-related lesions | Control (n = 10) | NDEA (n = 10) | C3G-150 (n = 11) | MAEs-75 (n = 12) | MAEs-150 (n = 12) | |
---|---|---|---|---|---|---|
Macroscopic lesions | Nodule incidence# | 0 (0) | 10 (100) | 8 (72.7) | 7 (58.3)* | 5(41.7)** |
Max nodule diameter (mm)▲ | ― | 18.73 ± 7.13a | 9.42 ± 5.54b | 4.63 ± 2.46c | 1.87 ± 1.79c | |
Average nodule number# | ND | 71.33 ± 62.11a | 48.10 ± 10.80b | 17.70 ± 3.42d | 6.13 ± 5.22d | |
Microscopic lesions | AHF incidence | 0 (0.0) | 1 (10.0) | 2 (16.7) | 3 (25.0) | 2 (16.7) |
HA incidence | 0 (0.0) | 3 (30.0) | 4 (33.3) | 3 (25.0) | 2 (16.7) | |
HCC incidence | 0 (0.0) | 5 (50.0) | 3 (25.0) | 2 (16.7)* | 1 (8.3)** | |
Total tumor incidence | 0 (0.0) | 8 (80.0) | 7 (58.3) | 5 (41.7) | 3 (25.0)* |
Data are means ± SDs or n (%).Values with different superscript letters (a, b, c, d) within cultivar are significantly different. *P < 0.05 and **P < 0.01 compared with NDEA group by Fisher’s exact test. #Visible nodules (diameter ≥ 1 mm). ▲Max nodule diameter, mean maximum nodule diameter. ND, not detectable; AHF, altered hepatic foci; HA, hepatic adenoma; HCC, hepatocellular carcinoma.
fibrosis in NDEA group animals was more severe compared to rats treated with MAEs or C3G (
These results suggested that MAEs is an effective chemopreventive agent for preventing or delaying NDEA-induced hepatocarcinogenesis in rats, among which the high dose of MAEs has the best effect and is superior to C3G.
Excess reactive oxygen species produced in the processes of NDEA metabolic activation can interfere with the body’s oxidation system, leading to oxidative damage and tissue carcinogenesis, which plays an important role in the pathogenesis of liver cancer [
NDEA’s induction increased microsomal phase I metabolizing enzymes with a
Groups | TBARS (nmol/mg protein) | GSH (mg/g) | GSH-Px (U/mg) | SOD (U/mg) | CAT (U/mg) | MDA (nmol/mg) |
---|---|---|---|---|---|---|
Control | 241.67 ± 11.61c | 4.38 ± 0.71a | 387.53 ± 23.72a | 172.09 ± 14.28a | 35.89 ± 8.58a | 4.73 ± 1.07c |
NDEA | 454.74 ± 25.43a | 1.23 ± 0.34e | 293.02 ± 53.17b | 94.56 ± 20.70c | 14.56 ± 3.10d | 11.55 ± 3.66a |
C3G-150 | 277.36 ± 30.24b | 1.94 ± 1.03d | 363.57 ± 28.85a | 127.47 ± 24.65b | 23.26 ± 5.35c | 8.47 ± 2.18b |
MAEs-75 | 268.96 ± 32.90bc | 2.85 ± 0.70c | 364.78 ± 32.04a | 147.45 ± 36.13b | 28.21 ± 7.27bc | 5.95 ± 2.33c |
MAEs-150 | 252.30 ± 23.09bc | 3.61 ± 0.25b | 380.94 ± 37.81a | 170.77 ± 18.34a | 32.30 ± 5.55ab | 5.30 ± 1.00c |
The data are the mean ± SD from 8 samples for each group and at least three independent measurements. Values with different superscript letters (a, b, c, d) within cultivar are significantly different. TBARS, thiobarbituric acid-reactive substances; GSH, Glutathione; GSH-Px, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase; MDA, malondialdehyde.
simultaneous decrease in the Phase II detoxifying enzyme [
Nrf2-mediated antioxidant, detoxification enzymes and anti-inflammatory signaling are through Nrf2-ARE pathways to protect organisms against cellular damage caused by oxidative stress [
Studies showed that the main cause of NDEA-induced liver cancer is inducing chronic inflammatory response and abnormal repair after liver injury [
increased anti-inflammatory cytokines IL-10 and IFN-γ in serum after NDEA treatment (
NF-κB, TNF-α, and COX-2 plays an important role in the development of inflammation [
that, MAEs obviously decreased the TNF-α, NF-κB, and COX-2 mRNA expression in the livers of MAEs-75 and MAEs-150 group rats, all of which were remarkably higher than that of C3G treatment rats (
The present study indicated that the NDEA-induced liver cancer may be related to the inflammatory reaction in rats, and MAEs may exert anti-inflammation by regulating the levels of inflammatory cytokines and attenuating the inflammatory
mediators COX-2 through NF-κB inhibition pathway.
In vivo studies, we present evidence that MAEs of mulberry variety PR-01 fruits exhibit prevention of NDEA-induced liver damage, fibrosis and hepatocellular carcinoma via reducing liver function enzymes, decreasing lipid peroxidation, promoting antioxidant enzymes, and increasing the hepatic phase II detoxifying enzymes GST and UGT2b1 activity as well as inhibiting the inflammatory responses by blocking NF-κB activation and the release of pro-inflammatory mediators. These findings provided that a promising usefulness for MAEs in the prevention of the liver cancer.
This study was supported by the National Key Research and Development Program of China (2017YFD0100100), the National Key Technology R&D Program of China (2013BAD01B05), the National Natural Science Foundation of China (30600415), the Science and Technology Innovation Platform Development Program of Fujian Agriculture and Forestry University of China (PTJH13001, PTJH12015), and the Science and Technology Innovation Fund of Fujian Agriculture and Forestry University of China (CXZX2017245).
JG Zheng and SF Liao conceived and designed the experiments. SF Liao and JH Liu performed the experiments, analyzed the data. SF Liao drafted the manuscript. JG Zheng and M Xu revised the manuscript.
There is no conflict of interest in this article. All the authors reviewed the paper and approved the final version.
Liao, S.F., Liu, J.H., Xu, M. and Zheng, J.G. (2018) Evaluation of the Liver Cancer Prevention of Anthocyanin Extracts from Mulberry (Morus alba L.) Variety PR-01. Advances in Bioscience and Biotechnology, 9, 423-442. https://doi.org/10.4236/abb.2018.99030
This document file contains Supplementary
Evaluation of the liver cancer prevention of anthocyanin extracts from mulberry (Morus alba L.) variety PR-01.
Peak | Compound | Code | [M-H]+ (m/z) | Fragment (m/z) |
---|---|---|---|---|
1 | pelargonidin 3-glucoside chloride | P3G | 433.09 | 271 |
2 | Cyanidin-3-O-glucoside chloride | C3G | 449.08 | 287 |
3 | Cyanidin 3-rutinoside chloride | C3R | 595.05 | 287,449 |