Background: More and more chronic kidney disease (CKD) patients are accompanied with hyperuricaemia. As is known, hyperuricaemia is an independent hazard of both cardiovascular diseases (CVD) and chronic kidney diseases. We aim at identifying Single Nucleotide Polymorphism (SNP) difference of hURAT1 (rs7932775) and ABCG2 (rs3825016) on CKD patient with hyperuricemia and/or gout. Methods : All forty-two CKD patients were divided into two groups : hyperuricemia, and control group. 24 hour s urine sample and serum were prepared for testing biochemistry parameters. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method is used to anal yze hURAT1 and ABCG2 single nucleotide polymorphisms in different group s . Results: 17 patients have CT SNP of hURAT1 (rs7932775) and 13 patients have CT SNP of ABCG2 (rs3825016) in hyperuricemia group, while only 5 persons and 6 persons have the same mutations in control group respectively. 7 patients have CT SNP of both hURAT1 (rs7932775) and ABCG2 (rs3825016) in hyperuricemia group, while only 2 persons have the same mutations in control group. CT mutation rate s of hURAT1 (rs7932775) and ABCG2 (rs3825016) in hyperuricemia group were 60.7% (17/28) and 50% (13/28) respectively, higher than that of control group (35.7% (5/14) and 42.8% (6/14)). What is more, Double SNP mutations in both hURAT1 (rs7932775) and ABCG2 (rs3825016) in hyperuricemia group w ere 25% (7/28), higher than that of control group (14.2%, 2/14). Conclusion: There are higher mutation rates of CT SNP in hURAT1 (rs7932775) and/or ABCG2 (rs3825016) in hyperuricemia group. We can conclude that hyperuricemia is a high risk factor in progress of CKD, which is necessary to take measures of decreasing serum uric acid to delay CKD progress.
More and more chronic kidney disease (CKD) patients are accompanied with hyperuricaemia. As is known, hyperuricaemia is an independent hazard of both cardiovascular diseases (CVD) and chronic kidney diseases [
But there have been not clearly understood about SNP identifying both URAT1 and CABG2 in hyperuricemia with CKD. So our aim is to identify and analyze Single Nucleotide Polymorphism (SNP) differences of hURAT1 (rs7932775) and ABCG2 (rs3825016) on CKD patient with hyperuricemia in order to identify uncommon genetic variants with increased penetrance that might provide opportunities for clinical translation.
1) All forty-two patients (M/F 24/22) were enrolled from outpatient and hospitalized from Jan. 2016 to Aug. 2017. Their mean age is 55 years. Patients were divided into two groups: Hyperuricemia, and control group. The groups were matched by age, body mass index, metabolic syndrome and use of anti-hypertensive medication.
2) Diagnostic criteria: serum creatine 123 - 701 umol/L, eGFR 90 - 15 ml/min, CKD 2 - 5 phase.
Chronic Kidney Disease (CKD) is defined by:
eGFR < 60 mL/min/1.73 m2 that is present for ≥ 3 months or Markers of kidney damage present for ≥ 3 months: a) Albuminuria ≥ 3 mg/mmol; b) Urine sediment abnormalities; c) Structural or pathological abnormalities.
Hyperurecimia refers to the normal urine diet under the condition of two fasting uric acid levels. The male is higher than 420 umol/L; the female is higher than 360 umol/L.
Exclusion criteria: acute infection; liver function failure, myelosuppression, malignant tumor, children or elder persons (>80 years).
3) Biochemistry parameters detection
24 hours urine sample and serum were prepared in both groups patients in for testing biochemistry parameters by Biochemical Analyzer.
4) Single Nucleotide Polymorphism (SNP) identifying of hURAT1 (rs7932775) and ABCG2 (rs3825016) [
Fasting blood samples were (5 ml) extracted in the median cubital vein, DNA is extracted by method of salt bath, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method is used to analysis the case group and control group hURAT1, determination of ABCG2 single nucleotide polymorphisms. The identifying method is referred to the literature. The SNP identifying had been finished in Shanghai Genechem Co., Ltd.
Premier were designed as followed:
5) Statistical analysis
All data were statistically processed by SPSS 18.0 software, and the data were represented by x ± s. Variance analysis was conducted. The comparison of the frequencies of genotypes and alleles, genotypes and alleles was conducted by using the direct count method.
Biochemistry parameters in 24 h urinary and serum.
There have differences in24 h urinary protein, creatine and UA between Control and Hyperuricemia group (p < 0.05). But there have no difference in 24 h urinary UA between these groups (p > 0.05).
Single Nucleotide Polymorphism (SNP) of hURAT1 (rs7932775) and ABCG2 (rs3825016).
From
Patient | Gender | Age (year) | Underlying diseases | rs7932775 | rs3825016 |
---|---|---|---|---|---|
1 | M | 43 | / | CC | CC |
2 | F | 76 | CHD, hypertension | TT | CT |
3 | F | 64 | MN hypertension | CT | CC |
4 | F | 33 | SLE | CT | CC |
5 | F | 33 | erythema nodosum | CC | CC |
6 | F | 65 | glomerulonephritis | TT | CT |
7 | M | 43 | DKD T2DM hypertension | TT | CC |
8 | F | 60 | glomerulonephritis | CT | CC |
9 | M | 62 | T2DM glomerulonephritis | TT | CT |
10 | M | 62 | CAPD CKD5d T2-DM hypertension | CC | CC |
11 | F | 55 | Urinary tract infection biliary alculus | CT | CT |
12 | F | 71 | Pyelonephritis hypertension CHD | TT | CT |
13 | F | 58 | Pyelonephritis | CC | CC |
14 | F | 60 | / | CT | CT |
15 | M | 77 | CKD Hypertension HUA | CT | CC |
16 | F | 62 | HUA T2DM Stroke | CT | CT |
17 | F | 44 | hypertension HUA IgAN | TT | CT |
18 | M | 64 | CKD4 2-DM hypertension HUA | TT | CT |
19 | M | 32 | IgAN CKD3 Postoperative of left kidney cancer Resection | CT | CT |
20 | M | 54 | rhabdomyolysis interstitial nephritis | CT | CC |
21 | M | 80 | HUA CDK5d hypertension T2DM CHD | CT | CC |
22 | M | 67 | HUA | CT | CT |
23 | M | 35 | HUA CAPD Hypertension C3 glomerulonephritis | CT | CC |
24 | M | 70 | HUA gout | CT | CC |
25 | F | 56 | HUA hypertension Postoperative of Heart valve replacement | CT | CT |
26 | M | 70 | HUA hypertension CKD3 phrase T2DM | TT | CT |
27 | M | 37 | pyelonephritis | CC | CC |
28 | M | 50 | Gout HUA | CT | CT |
29 | M | 60 | HUA | TT | TT |
30 | M | 43 | CKD5d phase hypotension | TT | CC |
31 | M | 58 | MHD CKD5d phase | CT | CT |
32 | M | 28 | Gout hypertension HUA | CC | CC |
33 | F | 47 | CKD4 phrase hypertension | CT | CC |
34 | F | 40 | HUA HSPN Hypertension | TT | TT |
---|---|---|---|---|---|
35 | F | 73 | CKD5 phrase T2DM Hypertension | CT | CC |
36 | F | 56 | HUA hypertension | TT | CT |
37 | M | 22 | HUA Rhabdomyolysis | TT | CT |
38 | M | 50 | Gout T2DM | CT | CT |
39 | M | 70 | CKD4 Phrase gout Hypertension | CT | CC |
40 | M | 26 | HUA urinary tract infection | CT | CC |
41 | M | 37 | CAPD CKD5d phrase Hypertension | TT | CT |
42 | F | 62 | CKD4 phrase Gout Hypertension | CT | CC |
Patient 1 - 14 refer to control group, patients 15 - 42 refer to hyperuricemia group patients. 17 patients have CT SNP of hURAT1 (rs7932775) and 13 patients have CT SNP of ABCG2 (rs3825016) in hyperuricemia group, while only 5 persons and 6 persons have the same mutations in control group respectively. 7 patients have CT SNP of both hURAT1 (rs7932775) and ABCG2 (rs3825016) in hyperuricemia group, while only 2 persons have the same mutations in control group.
Premier | Series (5’ to 3’) | Length |
---|---|---|
EX031-E1-F | CAGGACAGGATACCCAGATGGAG | 261 bp |
EX031-E1-R | CAGCCTCACCTGAGCACAGTGG | |
EX031-E3-F | GTCTCCATCATGTGGCTGTGTAC | 299 bp |
EX031-E3-R | CTGCGGTCATAGACCCAGCCATC | |
SNP | message | |
rs7932775 | AGAAATGGGGGCTCTGCGCTCAGCC[C/G/T]TGGCCGTGCTGGGGCTGGGCGGGGT | |
rs3825016 | GTGGCTGGCGGAAGCGGCGGCACTG[A/G]TGGGGCCTCTGGTTGGGGCCCGGCG |
24 h urinary protein | BUN | Creatine | UA | 24 h urinary UA | |
---|---|---|---|---|---|
Control | 1.09 ± 1.58 | 7.26 ± 4.1 | 137.22 ± 148.14 | 282.36 ± 129.28 | 2279.22 ± 790.57 |
Hyperuricemia | 0.88 ± 0.96 | 11.83 ± 8.16 | 303.95 ± 299.21 | 503.18 ± 119.61 | 2283.64 ± 1287.12 |
p | 0.622 | 0.074 | 0.020 | 0.001 | 0.992 |
group was 50% (13/28), higher than that of control group (42.8%, 6/14). What is more, Double SNP mutations in both hURAT1 (rs7932775) and ABCG2 (rs3825016) in hyperuricemia group was 25% (7/28), higher than that of control group (14.2%, 2/14).
A number of epidemiological reports link hyperuricemia with multiple disorders,
such as kidney diseases, cardiovascular diseases and diabetes. Recent studies also showed that expression and functional changes of urate transporters are associated with hyperuricemia. Uric acid transporters are divided into two categories: urate reabsorption transporters, including urate anion transporter 1 (URAT1), organic anion transporter 4 (OAT4) and glucose transporter 9 (GLUT9), and urate excretion transporters, including OAT1, OAT3, urate transporter (UAT), multidrug resistance protein 4 (MRP4/ABCC4), ABCG-2 and sodium-dependent phosphate transport protein . In the kidney, uric acid transporters decrease the reabsorption of urate and increase its secretion. These transporters’ dysfunction would lead to hyperuricemia. As the function of urate transporters is important to control the level of serum uric acid, studies on the functional role of uric acid transporter may provide a new strategy to treat hyperuricemia associated diseases, such as gout, chronic kidney disease, hyperlipidemia, hypertension, coronary heart disease, diabetes and other disorders. Tan [
We aimed to identify and explore Single Nucleotide Polymorphism (SNP) mutations of hURAT1 (rs7932775) and ABCG2 (rs3825016) on CKD patients to provide a new strategy to treat hyperuricemia associated CKD. Genome-wide association studies (GWAS) have confirmed the importance of urate excretion in the control of serum urate levels and the risk of gout and have identified the kidneys, the gut and the liver as sites of urate regulation. Human urate transporter 1 (URAT1) is a member of the organic anion transporter family (SLC22A12) that primarily regulates the renal tubular reabsorption of uric acid. Cho [
Up to now, we have known little about SNP identifying both URAT1 and CABG2 in hyperuricemia with CKD. Our work shows that there are higher mutation rate of SNPs of hURAT1 (rs7932775) or ABCG2 (rs3825016) in CKD with hyperuricemia patients compared to controls. We can conclude that hURAT1 (rs7932775) or ABCG2 (rs3825016) may play a part in progress of CKD by triggering oxidative stress, which is necessary to take decrease serum uric acid to delay CKD progress. We also found the higher SNP mutation of both hURAT1 (rs7932775) and ABCG2 (rs3825016), suggesting the common mechanisms in triggering CKD progress. In the following work, we plan to test SNP of hURAT1 (rs7932775) or ABCG2 (rs3825016) in CKD patients by serum uric acid-lowering drugs Febuxostat and Benzbromarone respectively to explore the common mechanisms from hyperuricemia to CKD progress. SNP mutations patients on followed-up study are more susceptible to cause gout flare and CKD than no-mutation patients, to whom we pay close attention and take intervening measures by giving decreasing serum urice acid medicine. It is worth of further research to explore the exact mechanisms of SNP of URAT1 (rs7932775) and ABCG2 (rs3825016) causing gout and CKD progress.
The work was funded by the project of twelfth group of six talent peak project of Jiangsu Province (No-2015-WSN-089).
The authors declare no conflicts of interest regarding the publication of this paper.
Li, C.Q., Tang, Q., Jiang, H.W., Wu, J., Zhang, J.L., Yuan, F.L., Du, Y. and Du, H.C. (2018) Single Nucleotide Polymorphisms (SNPs) of URAT1 (rs7932775) and ABCG2 (rs3825016) on Chronic Kidney Disease Patients with Hyperuricemia. Chinese Medicine, 9, 118-125. https://doi.org/10.4236/cm.2018.93007