Decreasing the hardness of pomegranate seeds by reducing the content of lignin is an effective way to develop soft-seeded pomegranate. Laccases (LAC) is a key regulatory factor in lignin synthesis. The full-length sequence of PgLAC was obtained from “ Punica granatum cv. Hongyushizi”, by using RACE and RT-PCR methods. PgLAC had an open reading frame of 1716 bp and encoded a protein of 571 amino acids. Phylogenetic tree analysis showed that PgLAC was most closely related to the LAC 5 ortholog identified in Eucalyptus grandis ( EgLAC 5). Expression analysis showed that expression of PgLAC was higher in “Hongyushizi”, while lower in “Huiliruanzi” and “Tunisiruanzi”; PgLAC was predominantly expressed in stems; From 20 to 80 days after full bloom, the expression of PgLAC increased and reached a maximum at 80 d, then gradually decreased. These results suggested that PgLAC may be a candidate gene for reducing the hardness of pomegranate seeds.
Pomegranate is popular due to the high nutritional value and health benefits [
Laccase enzyme, belongs to the family of ceruloplasmin oxidase, which can be combined with a plurality of copper ions [
In this study, LAC homologous gene PgLAC was cloned from pomegranate, and the expression level in different pomegranate cultivars, tissues and developmental stages was detected by real-time quantitative PCR. This study lays a foundation for further research on the function analysis of PgLAC, and also provides gene resources for breeding new cultivars of soft-seeded pomegranate.
Pomegranate cultivars used in this study were all collected from Germplasm Resources Garden of Pomegranate in Anhui Agricultural University. The fruits of “Huiliruanzi”, “Hongyushizi” and “Tunisiruanzi” in similar cultivation environment were collected. The arils and kernels were removed from the seeds, then the seed coats were soaked in liquid nitrogen, and eventually were taken back to the laboratory and store in a −80˚C refrigerator. For the expression analysis experiments, flowers, stems, leaves and the seeds of 20 d, 40 d, 60 d, 80 d, 100 d and 120 d of “Hongyushizi” were collected, respectively. After the same treatments to seeds as mentioned above, the tissues and seed coats were taken back to the laboratory and stored in a −80˚C refrigerator.
The total RNA was extracted from the seed coats of “Hongyushizi” using Trizol reagent (Invitrogen), and digested with DNase I (TaKaRa). Then cDNA was synthesized using reverse transcriptase M-MLV (Promega). According to the LAC sequences of other species that have been published, we designed degenerate primers LAC-PF/LAC-PR to clone the intermediate fragment. Based on the obtained sequence, 5’ end specific primers LAC-5’GSP1, LAC-5’GSP2 and 3’ end specific primers LAC-3’GSP1, LAC-3’GSP2 were designed. LAC-5’GSP1/UPM Long were used for the first round amplification, and the PCR products were used as template, then LAC-5’GSP2/NUP were used for the second round of amplification to obtain the 5’ end sequence of PgLAC. Similarly, 3’ end sequence of PgLAC was obtained. The three parts were spliced, and primers LAC-QC-F/LAC-QC-R were used to amplify the full-length sequence (
PgLAC was compared with the homologous sequences of other species in the NCBI database using DNAMAN 5.0 software; the phylogenetic tree was constructed using MEGA 5.05 and maximum likelihood method with 1000 bootstrap replications [
Two grams of RNA from different samples digested by DNase I (TaKaRa) was reverse transcribed into cDNA. Quantitative real-time PCR (qRT-PCR) was performed using an ABI 7500 Fast Real-time PCR system and SYBR®Premix Ex Taq™ II (TaKaRa). Amplification was carried out by an initial denaturation at 95˚C for 30 s, followed by 40 cycles of amplification (denaturation at 95˚C for 15 s, annealing at 60˚C for 30 s and extension at 72˚C for 1 min). PgACTIN was used as the reference gene. The results were analyzed using ABI 7500 software, and relative expression was calculated using the 2−ΔΔCT method [
Based on the conserved regions of LAC in Arabidopsis, grape, tobacco, apple,
Primers | Sequence 5’-3’ | Usage |
---|---|---|
LAC-PF | GAAGGHACACTTTGGTGGCA | Amplification formiddle fragments of PgLAC |
LAC-PR | ACATCBGTGGTTTGTCCTGG | |
LAC-5’GSP1 | TCGTCTCACCAGAATCAATCGG | Amplification for5’ race of PgLAC |
LAC -5’GSP2 | CGGTGTCTTGCTTGGTCTCCAT | |
LAC-3’GSP1 LAC-3’GSP2 | CTAAGCCAAAGCGTGAAACTCC GTGCTCCCAATGTCTCCGATGC | Amplification for3’ race of PgLAC |
LAC-QC-F | CACTCTCTGCCACCTTTTGATCAG | Amplification for full-length of PgLAC |
LAC-QC-R | CTACTTTATCTTATAGAATCAAAT | |
LAC-RTPF | CCTGGTAGAAGACGGAGTCGGGGAG | qRT-PCR primers |
LAC-RTPR | GGGCGGTGTGACGGTGCTATTATT | |
PgACT-PF | AGTCCTCTTCCAGCCATCTC | Amplification for PgACTIN |
PgACT-PR | CACTGAGCACAATGTTTCCA |
plum and other species, degenerate primers were designed to amplify the intermediate fragment with a length of 449 bp (
PgLAC displayed high similarities with other LAC protein sequences. For example, the similarity between PgLAC and EgLAC5, VvLAC12, RcLAC12 reached to 86.51%, 83.54% and 81.11%, respectively. Sequence analysis indicated that the conserved PgLAC binding domains contained three copper ions of laccase gene family: T1 (84 - 131) with four H (histidine) residues, T2 (232 - 270) containing N (aspartic acid), L (leucine), V (valine), K (Lai Ansuan), P (proline), Q (glutamine) and T (threonine) residues, T3 (472 - 545) with two H (histidine) residues, C (cysteine), and L (leucine) residues (
In order to determine the phylogenetic relationship between PgLAC and other LACs, MEGA 5.05 software was used for multiple sequence alignments and phylogenetic analysis. The results showed that PgLAC was identical with the origin of LACs in other species, and was indeed a homologue of the LAC family. The phyologenetic tree revealed that PgLAC was placed in one clade with EgLAC5,
whlie it had a distant relationship with VaLAC5 (
In order to investigate the expression level of PgLAC in different cultivars of pomegranate, qRT-PCR was used to detect the relative expression of PgLAC in
The phylogenetic tree was constructed using the maximum likelihood method. The scale bar indicated 0.05 substitutions per site. The accession numbers of selected LACs were listed as follows: Vigna angularis VaLAC5 (XP_017429457.1); Glycine max GmLAC5 (XP_003519418.1); Cajanus cajan CcLAC5 (XP_020208524.1); Gossypium arboreum GaLAC5 (XP_017645108.1); Theobroma cacao TcLAC12 (XP_007008849.2); Ricinus communis RcLAC12 (XP_002520796.1); Jatropha curcas JcLAC12 (XP_012086668.1); Populus euphratica PeLAC12 (XP_011004316.1); Juglans regia JrLAC12 (XP_018838961.1); Ziziphus jujuba ZjLAC12 (XP_015877482.1); Malus domestica MdLAC12 (XP_008343632.1); Prunus persica PpLAC12 (XP_007218932.1); Nelumbo nucifera NnLAC12 (XP_010264533.1); Punica granatum PgLAC (AJD79906.1); Eucalyptus grandis EgLAC5 (XP_010067566.1); EgLAC12 (XP_010031156.1); Vitis vinifera VvLAC12 (XP_002273875.2); Daucus carota subsp. Sativus DcLAC12 (XP_017238938.1); Nicotiana tabacum NtLAC12 (XP_016460452.1); Capsicum annuum CaLAC12 (XP_016575563.1); Solanum tuberosum StLAC12 (XP_006355637.1); Solanum lycopersicum SlLAC5 (XP_004240885.1).
“Hongyushizi”, “Huiliruanzi” and “Tunisiruanzi”. The results showed that the expression of PgLAC in “Hongyushizi” was 3.5 times higher than that of “Tunisiruanzi”. The expression of PgLAC in “Huiliruanzi” and “Tunisiruanzi” was lower, and there was no significant difference between the two cultivars (
The expression level of PgLAC in different tissues of pomegranate was detected, with “Hongyushizi” as the material. The results showed that PgLAC was all detected in leaves, petals and stems. The expression in stems and petals was 19.59 times and 3.74 times higher than that in leaves,respectively (
In order to reveal the expression characteristics of PgLAC in different developmental stages of seeds, the pomegranate seeds were collected from 20th day to
120th day, with the time interval of 20 days. The results showed that PgLAC was expressed in all stages of seeds, showing the overall downward trend after rising first. The relative expression remained a low level from 20 d to 60 d, and reached a maximum value at 80 d, then decreased gradually (
Pomegranate is widely cultivated all over the world, and seed hardness is one of the most important economic traits. Compared to hard-seeded pomegranate, soft-seeded pomegranate has a broader market prospect. Lignin content is an important factor in determining the hardness of pomegranate seeds.
More and more studies showed that LACs were involved in lignin synthesis. In this study, the homologous gene of LAC was cloned from pomegranate. The putative amino acid sequence of this gene contained the conserved binding domains of three copper ions, hence it was named PgLAC. Phylogenetic tree analysis suggested that all the LACs originated from the same ancestral origin, which subsequently diverged at different phases of evolution. PgLAC were most closely related to EgLAC5.
The relative expression of PgLAC varied among different cultivars. PgLAC expression was higher in the seeds of “Hongyushizi” with high lignin content, while lower in “Huiliruanzi” and “Tunisiruanzi” with lower lignin content, which indicated that PgLAC expression was correlated with lignin content, and PgLAC may be an important factor affecting seed hardness in different cultivars. The roles of LAC members in plant growth and development varied, and therefore tissue-specific expression were different. For example, studies in Arabidopsis showed that LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers [
stems and lowest expression in leaves. The result indicated that LAC was highly expressed in tissues with high lignin content, which further supported the involvement of PgLAC in the synthesis of lignin in Pomegranate. PgLAC expression in seeds at different stages was also detected. The expression of PgLAC increased rapidly from 20 d to 80 d, suggesting that lignin was rapidly synthesized and accumulated during this period. When the content of lignin reached a certain range, the expression of PgLAC decreased, also the synthesis of lignin reduced. These results implied that PgLAC might play an important role in the synthesis of pomegranate lignin.
Since PgLAC was expressed in several tissues of pomegranate, reducing the total expression level of PgLAC will affect multiple developmental processes. Our study found that PgLAC expression gradually increased in the early stages of seed development, and eventually resulted in lignin accumulation. Therefore, reducing lignin content by regulating the expression level of PgLAC during seed development, may be an effective way to reduce the hardness of the pomegranate seeds. This study lays a theoretical foundation for developing new cultivars of soft-seeded pomegranate by using genetic engineering methods.
This work was supported by the Natural Science Research Project of Anhui colleges and Universities (Grant number KJ2017A154).
Dong, L.L., Xiong, F., Liu, N., Wang, Q. and Zhang, S.M. (2018) Molecular Cloning and Expression Analysis of PgLAC in Pomegranate. American Journal of Molecular Biology, 8, 145-155. https://doi.org/10.4236/ajmb.2018.83012
C, cysteine;
H, histidine;
K, Lai Ansuan;
LAC, Laccases;
L, leucine;
N, aspartic acid;
P, proline;
Q, glutamine;
qRT-PCR, Quantitative real-time PCR;
T, threonine;
V, valine.