Placental abruption (PA) refers to the complete or partial separation of a normal placenta from the wall of the uterus before delivery. PA is not only a major cause of bleeding but an important cause of coagulation dysfunction in neonates after birth in the Department of Obstetrics [
RPMI 1640 medium, collagenase II, trypsin (Gibco), fetal bovine serum (Hyclone), epidermal growth factor (Peprotec), VIII detection kit (Antibody Diagnotica), anti-human TF monoclonal antibody (R & D Systems, Inc), goat anti-rabbit immunofluorescene antibody (Zhongshan Golden Bridge Biotech Co., Ltd), BLOCK-iTTM U6 RNAi Entry Vector kit, Gene Juice Transfection Reagent Novagen (Invitrogen), sequences for TF silencing (Shanghai Sangong Biotech Co., Ltd.), plasmid extraction Midi Kit (Qiagen) and other domestic analytically pure reagents were used in this study.
The umbilical cord (about 10 cm ) was collected in an aseptical condition during delivery, and the blood in the umbilical cord was removed by flushing the umbilical cord. Then, 0.1% collagenase II (5 ml) was added, followed by digestion for 12 min at 37˚C. The solution was harvested after digestion, and the umbilical cord was flushed again with PBS. After addition of FBS, centrifugation was done, and the supernatant was removed. The cells were re-suspended in complete medium and then seeded into 25-cm2 dish, followed by incubation at 37˚C in an environment with 5% CO2 for 24 h. Subsequently, epidermal growth factor (EGF) was added, followed by incubation for 48 - 72 h. Immunohistochemistry was done for the measurement of VIII protein expression. Cells of 2nd and 3rd generation were harvested for following experiments.
According to the interference sequences T12 and T6 of TF, shRNA sequence was designed as follow: CACCGTTCCTTCTGACTAAAGTCCGTCCGTCGAAACGGACTTTAGTCAGAAGGAA, and ds oligo were synthesized. After annealing, the ds oligo was connected to the sticky ends of pENTRTM/U6. The resultant products were transformed into competent cells to construct pENTRTM/U6-shRNA/TF. After sequencing, the vectors were used in following experiments.
HUVECs were divided into normal control group and PA group, both of which were further subdivided into 3 subgroups independently: 1) non-transfection group; 2) scramble shRNA transfection group; 3) TF shRNA transfection group (n = 3 per group). The mRNA and protein expression of TF were measured before and after transfection.
1) Transfection: HUVECs were seeded into 12-well plates at a density of 5 × 104/ml. When the cell confluence reached 60% - 80%, 0.5 μg of plasmid DNA was added, and pENTRTM/U6-shRNA/TF was transfected into HUVECs after incubation at 37˚C for 48 h.
2) Detection of TF mRNA expression by RT-PCR: The supernatant in 12-well plates was removed and two step RT-PCR was performed to detect TF mRNA expression. The conditions for reverse transcriptions were as follows: 42˚C for 20 min, 95˚C for 5 min and 5˚C for 5 min. Primers were designed according to the human TF cDNA sequence (NM_001993): 5’-CCGGCACAGCTTTAACAACCT-3’ (forward) and 5’-CGTTTGCTCTCGATTCCATGTG-3’ (reverse). Human β-actin gene (CF62602) served as an internal reference and its primers were as follows: 5’-TGGCACCACACCTTCTACAATG-3’ (forward) and 5’-CCGTGGTGGTGAAGCTGTAGC-3’ (reverse). The conditions for PCR were as follows: 94˚C for 5 min, 32 cycles at 94˚C for 30 s, 50˚C for 30 s and 72˚C for 30 s and a final extension at 72˚C for 5 min. The products were subjected to 1.5% agarose gel electrophoresis, and visualization was done with Bio-rad gel image system. Bands were analyzed with Gel-Pro Analyzer, and the optical density was determined as the mRNA expression. The mRNA expression of TF was normalized to that of β-actin.
3) Detection of TF protein expression by immunofluorescence staining: Coverslips sized 1 cm × 1 cm were placed into 12-well plates and then HUVECs were seeded into 12-well plates at a density of 5 × 104/ml. When the cell confluence reached 60% - 80%, the vectors were transfected into HUVECs. The supernatant was removed, and cells were washed with PBS. After air-drying, cells were fixed in paraformaldehyde at room temperature. Rabbit anti-human TF antibody (1:200) was added, followed by incubation in a humidified environment. Following washing in PBS thrice, FITC conjugated goat anti-rabbit secondary antibody (1:400) was added, followed by incubation for 2 h. Cells were observed under a fluorescence microscope.
Statistical analysis was performed with SPSS version 17.0. Quantitative data are expressed as mean ± standard deviation (X ± SD), and categorical variables as percentages and tested with chi square test or Fisher’s exact test if necessary. Quantitative data were compared with independent sample t test between two groups and one way analysis of variance among groups. A value of P < 0.05 was considered statistically significant.
Under an inverted microscope, monolayer HUVECs were adherent to the bottom, and short-rod like or short spindle shaped. The nucleus was oval, and nucleolus was occasionally observed. Cells formed paving stone arrangement. Immunohistochemistry for VIII showed cells had green fluorescence (
One way analysis of variance showed there was significant difference in the TF mRNA expression between control group and PA group (F = 23.436, P < 0.01). Among different treatment groups, the TF mRNA expression was also significantly different (F = 33.630, P < 0.01). In non-transfection subgroups, the TF mRNA expression was significantly different between control group and PA group (t = 11.71, P < 0.05); in scramble shRNA transfection subgroups, the TF mRNA expression was significantly different between control group and PA group (t = 21.112, P < 0.05); in TF shRNA transfection subgroups, the TF mRNA expression was comparable between control group and PA group (t = 0.023, P > 0.05). In subgroups of control groups, the TF mRNA expression was also significant different (F = 27.657, P < 0.01); in subgroups of PA groups, the TF mRNA expression was also significant different (F = 19.299, P < 0.01); the TF mRNA expression was the lowest after TF silencing in both control groups and PA groups (
After immunofluorescence staining, HUVECs were found to have green
Group | TF mRNA expression ( x ¯ ± s) | Total | F | P | ||
---|---|---|---|---|---|---|
Non-transfection | Scramble shRNA | TF shRNA | ||||
n | 3 | 3 | 3 | |||
Control | 0.657 ± 0.097 | 0.540 ± 0.079 | 0.220 ± 0.030 | 0.472 ± 0.206 | 27.657 | <0.01 |
PA | 1.323 ± 0.323 | 1.057 ± 0.178 | 0.207 ± 0.150 | 0.862 ± 0.542 | 19.299 | <0.01 |
Total | 0.990 ± 0.4229 | 0.798 ± 0.309 | 0.2133 ± 0.097 | 0.667 ± 0.446 | 33.630* | <0.01* |
t | 11.710 | 21.112 | 0.023 | 23.436* | ||
P | <0.05 | <0.01 | >0.05 | <0.01* | 6.555# | 0.012# |
fluorescence. In non-transfection group, strong fluorescence intensity of TF was found in HUVECs and the fluorescence was diffuse; in scramble shRNA transfection group, the TF protein expression reduced as compared to non-transfection group, and the fluorescence was sparse; in TF shRNA transfection group, the TF protein expression reduced dramatically as compared to control group, and the fluorescence was more sparse (
PA may significantly increase the morbidity and mortality of neonates and thus has been paid increasing attention to [
dysfunction related diseases in neonates is imperative. TF and tissue factor pathway inhibitor (TFPI) play crucial roles in the coagulation balance. In PA, the TF content of the placenta and myometrium is significantly higher than that in plasma, but the TFPI is a very low level [
RNAi technique is usually employed to efficiently and specifically down-regulate the expression of target gene and has been widely used in the studies on gene functions and gene therapy [
In the present study, pENTRTM/U6 was used to successfully construct pENTRTM/U6-TF-shRNA which is then transfected into HUVECs from healthy neonates and PA neonates to inhibit the protein and mRNA expression of TF. Our findings support that silencing of TF expression is promising to block or attenuate the coagulation dysfunction in PA neonates and then reduce to the incidence of coagulation disorders in these neonates. In future studies, it is necessary to test the effects of TF expression silencing in vivo. In addition, RNAi has limitations in studies on gene function and drug development, and thus it is necessary to optimize this technique.
Yin, X.J., Chen, Z., Zhou, W.Q., Tang, W. and Feng, Z.C. (2018) RNA Interference Mediated Silencing of Tissue Factor in Human Umbilical Vein Endothelial Cells. Open Journal of Obstetrics and Gynecology, 8, 477-484. https://doi.org/10.4236/ojog.2018.85054