Chilli belongs to the genus Capsicum which possesses enormous wealth of genetic diversity. Extent of genetic diversity determines the success level of crop improvement programme. Simple sequence repeats (SSRs) are the most widely used marker system for molecular diversity analysis especially in cultivated species. The aim of our present study was to assess the molecular genetic diversity of 20 local chilli genotypes of Bangladesh using SSR markers. Genomic DNA was extracted from young leaves and PCR reactions were performed. Eleven SSR primers were used in PCR amplification. Total 10 alleles were detected for the five polymorphic SSR loci, with a mean of 2.00 alleles per primer. Gene diversity ranged from 0.333 to 1.00 with an average of 0.567. Polymorphic Information Content (PIC) values of the SSR primers ranged from 0.255 to 0.500 with an average value of 0.371. The similarity index matrix ranged from 0.00 to 1.000. It was highest in several germplasms viz . Pop-2 vs Pop-18; Pop-3 vs Pop-5 vs Pop-19 vs Pop-20 and the lowest in the germplasm Pop-8 vs Pop-18. Dendrogram based on Nei’s genetic distance using Unweighted Pair Group Method of Arithmetic Means (UPGMA) indicated the segregation of 20 chilli genotypes into two main clusters. The SSR markers showed genetic variability in the studied pepper genotypes and they are powerful tools for estimating molecular diversity of chilli. The findings of the present study have potential applications in future breeding programme for the genetic improvement of chilli.
Chilli (Capsicum spp.) originated from tropical and humid zone of Central and Southern America and belongs to the Solanaceae family having chromosome number 2n = 2x = 24. Among the domesticated Capsicum species, pungent and non-pungent forms of Capsicum annuum L. (pepper) are most popular and have a worldwide commercial distribution [
Chilli has numerous chemicals including steam-volatile oil, fatty oils, carotenoids, vitamins, protein, fibre and mineral elements [
The chilli landraces of different district in Bangladesh are heterogeneous and a wide variability in respect of fruit morphology, pungency, bearing habit and crop duration is found throughout country. Bangladeshi chilli varieties have been developed traditionally by selection, hybridization and back crossing with locally adapted cultivars. An important source for the introduction of new traits is the existence of a genetically diverse pool of chilli germplasm available in the country but they are mostly lying unexplored. There is a strong need to collect this germplasm and their proper characterization and classification [
Molecular markers are important tool for genotype identification and studying the organization and evaluation of plant genome [
The main objective of this study is to capture the potential genetic diversity among chilli genotypes grown in Bangladesh and selection of suitable genotypes for future chilli hybridization programme. Hence, the present study was carried out for following objectives.
1) Molecular diversity analysis of different chilli genotypes.
2) Polymorphism study among chilli germplasm.
3) Dendrogram establishment in some local chilli genotypes.
The experiment was conducted in Biotechnology Laboratory, Department of Biotechnology, Sher-e-Bangla Agricultural University (SAU), Dhaka-1207 and Regional Spices Research Centre, Bangladesh Agricultural Research Institute (BARI), Joydebpur, Gazipur-1701, Bangladesh.
Twenty different chilli genotypes were used as plant materials for the study and were collected from different places of Bangladesh (
Sl. No. | Genotypes | Origin | Characteristics |
---|---|---|---|
1 | Pop-1(G1) | Rangpur, Bangladesh | Large fruit size |
2 | Pop-2(G2) | Thakurgaon, Bangladesh | Small fruit size |
3 | Pop-3(G3) | Panchagarh, Bangladesh | Small fruit size |
4 | Pop-4(G4) | Panchagarh, Bangladesh | Medium fruit size |
5 | Pop-5(G5) | Bogra, Bangladesh | Large fruit size |
6 | Pop-6(G6) | Rangpur, Bangladesh | Medium fruit size |
7 | Pop-7(G7) | Bogra, Bangladesh | Large fruit size |
8 | Pop-8(G8) | Bogra, Bangladesh | Large fruit size |
9 | Pop-9(G9) | Dinajpur, Bangladesh | Small fruit size |
10 | Pop-11(G10) | Saidpur, Bangladesh | Medium fruit size |
11 | Pop-12(G11) | Saidpur, Bangladesh | Medium fruit size |
12 | Pop-13(G12) | Rangpur, Bangladesh | Large fruit size |
13 | Pop-14(G13) | Bogra, Bangladesh | Small fruit size |
14 | Pop-15(G14) | Thakurgaon, Bangladesh | Small fruit size |
15 | Pop-16(G15) | Panchagarh, Bangladesh | Small fruit size |
16 | Pop-17(G16) | Bogra, Bangladesh | Medium fruit size |
17 | Pop-18(G17) | Dinajpur, Bangladesh | Small fruit size |
18 | Pop-19(G18) | Saidpur, Bangladesh | Medium fruit size |
19 | Pop-20(G19) | Bogra, Bangladesh | Small fruit size |
20 | Pop-21(G20) | Bogra, Bangladesh | Medium fruit size |
Genomic DNA extractions from fresh young leaf at 3 - 4 leaf stage of seedling were done in SRC lab using CTAB (cetyl trimethyl ammonium bromide) buffer. CTAB extraction buffer was prepared by Doyle & Doyle [
Eleven SSR primers viz. GPMS-113, CAMS-117, CAMS-142, CAMS-153, GPMS- 161, GPMS-197, CAMS-327, CAMS-405, EPMS-418, CAMS-806 and CAMS-864 described previously were selected for PCR reaction on 20 local chilli germplasm for their ability to produce polymorphic band [
PCR products for each sample were confirmed by running it in 2% agarose gel containing 1 µl ethidium bromide in 1X TBE buffer at 90 V for 1 hour. Five microlitre (5 µl) loading dye was added to the PCR product and spinned them well. Then it was loaded in the wells. The DNA ladder (50 & 100 bp) (Promega thermal cyclers) was used in both left and right side of the gel. Under ultra-violet light on a trans-illuminator SSR bands were observed. The PCR product was saved by gel documentation system and photographed by a Gel Cam Polaroid camera.
The summary statistics including the number of alleles per locus, major allele frequency, gene diversity and Polymorphism Information Content (PIC) values were determined using POWER MARKER version 3.25 [
P I C = 1 − ∑ j = i n ( P i j ) 2
where, Pi is frequency of the jth pattern for marker i and the summation extends over n patterns.
Highly polymorphic and repeatable PCR based markers Simple Sequence Repeats (SSRs) were used here to assess the polymorphism, diversity and similarity identification within those local chilli germplasm. Results obtained from the study have been presented below under the following headings.
Eleven SSR primer pairs were screened on twenty chilli genotypes to evaluate their suitability for amplification of DNA. Among them five primer pairs CAMS-117, CAMS-153, GPMS-161, EPMS-418 and CAMS-806 showed reproducible and distinct polymorphic amplification. A total 10 alleles were detected for the five polymorphic SSR loci, with an average number of alleles/locus of 2.00 and a range between 1 to 3 alleles (
Primer code | Sequence of Primers (5'-3') | Number of Allele | DNA Fragment Size (bp) | Allele frequency | Gene Diversity | PIC Value |
---|---|---|---|---|---|---|
CAMS-117 | For: TTGTGGAGGAAACAAGCAAA Rev: CCTCAGCCCAGGAGACATAA | 2 | 220 | 0.850 | 0.50 | 0.255 |
190 | 0.150 | |||||
CAMS-153 | For: TGCACAAATATGAATCCCAAGA Rev: AGTCAGCAAACACATCTGACAA | 1 | 200 | 0.737 | 1.00 | 0.388 |
GPMS-161 | For: GAAATCCAATAAACGAGTGAAG Rev: CCTGTGTGAACAAGTTTTCAGG | 3 | 240 | 0.200 | 0.333 | 0.489 |
200 | 0.675 | |||||
140 | 0.125 | |||||
EPMS-418 | For: ATCTTCTTCTCATTTCTCCCTTC Rev: TGCTCAGCATTAACGACGTC | 2 | 200 | 0.850 | 0.500 | 0.225 |
180 | 0.150 | |||||
CAMS-806 | For: TGTCACAAGTGTCAAGGTAGGAG Rev: CCCCAAAAATTTTCCCTCAT | 2 | 210 | 0.500 | 0.500 | 0.500 |
170 | 0.500 | |||||
Total | - | 10 | - | 2.833 | 1.857 | |
Mean | - | 2.00 | - | 0.567 | 0.371 |
0.737 for only 1 allele (
Gene diversity ranged from 0.333 to 1.00. Primer CAMS-153 showed highest
gene diversity (1.00) followed by CAMS-117, EPMS-418, CAMS-806 which was showed same gene diversity (0.500) (
The values of similarity coefficient were computed from combined data for the five primers, ranged from 0.00 to 1.000. The highest genetic identity (1.00) was observed in Pop-2 vs Pop-18; Pop-3 vs Pop-5 vs Pop-19 vs Pop-20; Pop-4 vs Pop-18 vs Pop-19; Pop-13 vs Pop-14 vs Pop-15 vs Pop-16 vs Pop-18; whereas lowest genetic identity (0.00) was observed in Pop-8 vs Pop-18. The second largest genetic identity was 0.997 and they were present in Pop-4 vs Pop-20 and Pop-13 vs Pop-20 (
Acc# | Pop-1 | Pop-2 | Pop-3 | Pop-4 | Pop-5 | Pop-6 | Pop-7 | Pop-8 | Pop-9 | Pop-11 | Pop-12 | Pop-13 | Pop-14 | Pop-15 | Pop-16 | Pop-17 | Pop-18 | Pop-19 | Pop-20 | Pop-21 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Pop-1 | *** | |||||||||||||||||||
Pop-2 | 0.721 | *** | ||||||||||||||||||
Pop-3 | 0.615 | 0.747 | *** | |||||||||||||||||
Pop-4 | 0.811 | 0.027 | 0.838 | *** | ||||||||||||||||
Pop-5 | 0.204 | 0.161 | 1.000 | 0.195 | *** | |||||||||||||||
Pop-6 | 0.811 | 0.084 | 0.838 | 0.118 | 0.077 | *** | ||||||||||||||
Pop-7 | 0.911 | 0.309 | 0.821 | 0.352 | 0.123 | 0.218 | *** | |||||||||||||
Pop-8 | 0.504 | 0.353 | 0.838 | 0.325 | 0.195 | 0.251 | 0.352 | *** | ||||||||||||
Pop-9 | 0.298 | 0.453 | 0.620 | 0.506 | 0.503 | 0.506 | 0.452 | 0.506 | *** | |||||||||||
Pop-11 | 0.151 | 0.262 | 0.485 | 0.304 | 0.455 | 0.378 | 0.559 | 0.378 | 0.271 | *** | ||||||||||
Pop-12 | 0.250 | 0.5723 | 0.572 | 0.641 | 0.718 | 0.641 | 0.741 | 0.641 | 0.271 | 0.288 | *** | |||||||||
Pop-13 | 0.197 | 0.520 | 0.520 | 0.588 | 0.665 | 0.588 | 0.688 | 0.588 | 0.218 | 0.235 | 0.053 | *** | ||||||||
Pop-14 | 0.358 | 0.430 | 0.692 | 0.483 | 0.560 | 0.483 | 0.503 | 0.665 | 0.670 | 0.535 | 0.248 | 0.328 | *** | |||||||
Pop-15 | 0.869 | 0.430 | 0.915 | 0.483 | 0.560 | 0.483 | 0.670 | 0.665 | 0.503 | 0.718 | 0.248 | 0.328 | 0.100 | *** | ||||||
Pop-16 | 0.308 | 0.380 | 0.747 | 0.433 | 0.510 | 0.433 | 0.453 | 0.615 | 0.620 | 0.485 | 0.331 | 0.433 | 0.050 | 0.161 | *** | |||||
Pop-17 | 0.358 | 0.597 | 0.915 | 0.665 | 0.742 | 0.665 | 0.670 | 0.888 | 0.871 | 0.718 | 0.381 | 0.483 | 0.100 | 0.211 | 0.161 | *** | ||||
Pop-18 | 0.911 | 1.000 | 0.715 | 1.000 | 0.983 | 0.817 | 0.841 | 0.000 | 0.705 | 0.098 | 0.964 | 1.000 | 1.000 | 1.000 | 1.000 | 0.871 | *** | |||
Pop-19 | 0.358 | 0.915 | 1.000 | 1.000 | 0.742 | 0.888 | 0.670 | 0.888 | 0.458 | 0.074 | 0.718 | 0.888 | 0.337 | 0.480 | 0.430 | 0.211 | 0.871 | *** | ||
Pop-20 | 0.334 | 0.891 | 1.000 | 0.997 | 0.718 | 0.864 | 0.559 | 0.864 | 0.252 | 0.050 | 0.799 | 0.997 | 0.381 | 0.535 | 0.405 | 0.248 | 0.846 | 0.024 | *** | |
Pop-21 | 0.728 | 0.145 | 0.062 | 0.341 | 0.195 | 0.118 | 0.219 | 0.341 | 0.219 | 0.171 | 0.834 | 0.782 | 0.608 | 0.608 | 0.809 | 0.407 | 0.219 | 0.240 | 0.296 | *** |
Legend: 1: Pop-1; 2: Pop-2; 3: Pop-3; 4: Pop-4; 5: Pop-5; 6: Pop-6; 7: Pop-7; 8: Pop-8; 9: Pop-9; 10: Pop-11; 11: Pop-12; 12: Pop-13; 13: Pop-14; 14: Pop-15, 15: Pop-16; 16: Pop-17; 17: Pop-18; 18: Pop-19; 19: Pop-20 and 20: Pop-21.
genetic identity indicates the presence of variability among 20 germplasm of chilli. Genetic distance among 20 chilli genotypes ranged from 0.024 to 0.911. The highest genetic distance (0.911) was observed in Pop-1 vs Pop-7 vs Pop-18 genotype pairs, whereas lowest genetic distance (0.024) was estimated in Pop-19 vs Pop-20 (
All the 20 chilli germplasm has been grouped into two main clusters. The first cluster further divided into two sub clusters. The sub clusters contains four genotypes (Pop-1, Pop-3, Pop-8 and Pop-18) (
SSR markers are considered more reliable because of their ability to produce highly consistent profiles [
The average number of alleles per locus provides complementary information of polymorphism and more adequate to co-dominant markers [
The PIC values provide an estimate of discriminating power of a marker by taking into account not only the number of alleles at a locus but also relative frequencies of these alleles. Lower PIC values might be result of closely related genotypes and vice versa. Senior et al. [
The gene diversity (GD) was 0.154, indicating a considerable amount of polymorphism within this collection. The difference between the highest and lowest genetic identity indicates the presence of variability among 20 germplasm of chilli. Genetic distance among 20 chilli genotypes ranged from 0.024 to 0.911. The highest genetic distance between them indicated that genetically they are diverged. Genotypes pair with higher genetic distance is more dissimilar than a pair with a lower value. This study indicated that the genotypes those showed the highest genetic variation can be used as parental source for breeding line to improve chilli varieties.
In this study, dendrogram revealed that the genotypes that derived of genetically similar type clustered together. Again, cluster analysis of the band patterns separated the varieties into three groups corresponding to varietal types. Morphological trait-based clustering showed some degree of similarity to dendrogram topologies based on the SSR index. This may be explained by that mostly SSR markers measures genetic variation mainly in non-coding sequences which possibly do not have a major impact on the morphology of genotype [
SSR markers showed genetic variability in the studied chilli genotypes and they are powerful tools for estimating genetic similarities and diversity. The genetic relationships presented among the genotypes are helpful for future breeding programs through selection of genetically diverse parents. The present work was the preliminary study to characterize and detect genetic variation of chilli varieties of Bangladesh and had some limitations in term of limited number of individuals and varieties as well as number of primers used. The results indicated that the present study might be used as a guideline for developing mapping population, marker assisted selection (MAS) and crop improvement of chilli varieties and consequently enables a genetic conservation plan in Bangladesh.
Authors are thankful to Sher-e-Bangla Agricultural University, Dhaka and NST fellowship program for providing financial assistance for research.
Sharmin, A., Hoque, M.E., Haque, M.M. and Khatun, F. (2018) Molecular Diversity Analysis of Some Chilli (Capsicum spp.) Genotypes Using SSR Markers. American Journal of Plant Sciences, 9, 368-379. https://doi.org/10.4236/ajps.2018.93029