Actinopterygii express two types of chitinase (acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2)) that are active at acidic pHs and involved in digestion in the stomach. We proposed the existence of a new fish chitinase that has a non-digestive function. In this study, we used Sebastiscus marmoratus , for which characteristics and cDNA cloning of chitinase isozymes (SmChi-1, SmChi-2) in the stomach have been reported. Initially, we examined the distribution of chitinase and β-N -acetylhexosaminidase (Hex) in the body and then we tried to clone novel chitinase cDNA from the kidney. Chitinase and Hex activities were measured using p NP-(GlcNAc) n , ( n = 2, 3) and p NP-GlcNAc as substrates, respectively. Total RNA was extracted from the kidney. RT-PCR was performed to obtain chitinase cDNA fragments using reverse transcriptase with an oligo dT primer. The RACE method was used to obtain sequences of the upstream and downstream regions of cDNA. The full-length chitinase cDNA was determined using PrimeSTAR® Max DNA polymerase with proofreading activity. High chitinase activity was observed in the stomach, as previously reported. In addition, relatively high activity was observed in the liver, spleen, kidney, and heart. In contrast, Hex activity was detected in all organs. This result is consistent with the report that Hex is related to body-wide metabolism. Full-length cDNA ( SmChi -3) of the novel chitinase was obtained from the kidney, which contained 1440 bp open reading frames. The domain structure of SmChi-3 was assumed to be similar to those of SmChi-1 and SmChi-2. SmChi-1 and SmChi-2 have a serine and glycine-rich linker region, which is characteristic of AMCase. In contrast, SmChi-3 contained no apparent sequence in the linker region. Phylogenetic analysis revealed the existence of a new chitinase group, which was named fish chitinase-3 (FCase-3) and differed from AFCase-1 and AFCase-2.
Chitin, a β-1,4-linked aminopolysaccharide of N-acetyl-D-glucosamine (GlcNAc), is the second most abundant component of biomass in the world, after cellulose, and is found in the exoskeletons of arthropods, the cell walls of fungi, and the cuticles of nematodes [
Chitinolytic enzymes can be classified into the following two categories according to their degradation patterns: Endo-type chitinolytic enzymes, which degrade β-1,4-glycosidic bonds in a chitin polymer at random to produce chitin oligosaccharides (GlcNAc)n and are called chitinases (EC 3.2.1.14) [
We have conducted basic research about chitinases in several aquatic organisms. In the process of our research, we purified chitinase isozymes from fish stomachs, which are active at acidic pHs and are involved in digestion, and we investigated their properties [
In this study, we used marbled rockfish Sebastiscus marmoratus, as a model species. Our group had previously purified three chitinase isozymes, SmChiA, SmChiB, and SmChiC from the stomach of S. marmoratus. These chitinases showed the optimum pH in the acidic region (pH 2.0 - 4.5). SmChiA and SmChiB preferentially degrades the second glycosidic bond from the non-reducing end of (GlcNAc)n and SmChiC preferentially degrade the third glycosidic bond. SmChi-1 encoding SmChiA and SmChiB, and SmChi-2 encoding SmChiC were cloned. SmChi-1 and SmChi-2 were classified into AFCase-1 and AFCase-2, respectively [
The marbled rockfish S. marmoratus was purchased from a fresh fish shop of Kanagawa (n = 3; average standard length = 25 cm; average body weight = 275 g). p-Nitrophenyl Di-N-Acetyl-β-chitobioside (pNP-(GlcNAc)2) and p-Nitrophenyl Tri-N-Acetyl-β-chitobioside (pNP-(GlcNAc)3) were purchased from Seikagaku corporation (Tokyo, Japan). p-Nitrophenyl-N-Acetyl-β-D-glucosaminide (pNP-GlcNAc) was kindly supplied by Yaizu Suisankagaku Industry Co., Ltd. (Shizuoka, Japan).
All organs (0.5 g) from S. marmoratus were homogenized in 3 volumes of 20 mM phosphate buffer (pH 7.3), and the homogenate was centrifuged at 9000× g for 20 min 4˚C. Chitinase assays were conducted using the method of Ohtakara [
The effect of pH on chitinase activity was determined from the crude enzyme solutions obtained from the kidney and stomach of S. marmoratus. Chitinase activity was measured in a buffer solution with a pH between 2.0 to 8.0 by the method of distribution of chitinolytic enzymes activity, with 4 mM pNP-(GlcNAc)2 as the substrate.
Total RNA was extracted from the kidney of S. marmoratus using ISOGEN II (Nippon Gene, Tokyo, Japan), according to the manufacturer’s instructions. Total RNA concentrations and purity were measured using the NanoVue spectrophotometer (GE Healthcare, Little Chalfont, UK). The first strand of cDNA was synthesized using 1.0 μg total RNA and oligo dT primers (
Primer name | Sequence (5'-3') | Length | Usage | Annealing temperature (˚C) |
---|---|---|---|---|
Oligo dT | CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTTTTT | 40 mer | cDNA synthesis | |
Chi3 F1 (F) | TGYTAYTTYACNAAYTGG | 19 mer | Conserved region PCR | 50.0 |
Chi3 F2 (F) | GAYATHGAYTGGGARTAYCC | 19 mer | ||
Chi3 R (R) | TTCCARTARTTCATNGCRTARTC | 23 mer | ||
3'RACE (R) | CTGTGAATGCGACTACGAT | 19 mer | 3' RACE PCR | 50.0 |
Chi3 3' F1 (F) | AAGAGGAAGTCCTCTGGAGG | 20 mer | ||
Chi3 3' F2 (F) | GCTGAGGGAACAGCAACTGG | 20 mer | ||
Chi3 5' R1 (R) | GCAGCGGAGACCATTAATC | 19 mer | 5' RACE PCR | 50.0 |
Chi3 5' R2 (R) | CCAGTTGCTGTTCCCTCA | 18 mer | ||
Chi3 5' F1 (F) | AGGAACCATTGATGCTGGTT | 20 mer | ||
Chi3 5' F2 (F) | TGGCAAAGTACCTGGACTT | 19 mer | ||
Chi3 5' F3 (F) | CGTGATGACGTATGACTTTCATG | 23 mer | ||
Chi3 5' P | GTGATGTCCTGTCACGCT | 18 mer | ||
Chi3 full F (F) | GACATGACAAGAGACCATCCAA | 22 mer | Full length amplification | 55.0 |
Chi3 full R (R) | ACAGAGCATTTCAAACAGAGGG | 22 mer | ||
β-actin (F) | GATCATGTTCGAGACCTTCAACAC | 24 mer | Organ expression | 50.0 |
β-actin (R) | TCCAATCCAGACAGAGTATTTAGC | 24 mer | ||
SmChi-1 (F) | ACTAGCGTGATCAAGTTCC | 19 mer | ||
SmChi-1 (R) | ACAGCTCCAATCGCGGA | 17 mer | ||
SmChi-2 (F) | CTCAGTCATTTAATTCCTGA | 20 mer | ||
SmChi-2 (R) | CCTGGCCAAGCTTGGGAAT | 19 mer | ||
SmChi-3 (F) | CAGTCTTCTGTCAACCTAC | 19 mer | ||
SmChi-3 (R) | GGTACTTTGCCATCTCTGC | 19 mer |
The full-length amplification products of SmChi-3 carried out A-tailing, and were subcloned into pGEM-T Easy vector. Inserts were sequenced using the Big Dye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems, Waltham, USA).
Phylogenetic analysis of chitinase from several organisms was carried out using the ClustalW2 program (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory, Hinxton, England) and the tree view program. A bacterial chitinase (GenBank: X03657) was used as the outgroup.
Total RNA was prepared for all organs from S. marmoratus. First-strand cDNA was synthesized using each total RNA (0.5 µg) and an oligo dT primer, amplified using RT-PCR on the synthesized cDNA (1.0 µg). SmChi-1, SmChi-2, and SmChi-3, 250 bp gene fragments, were amplified using the first-strand cDNA as the template and the primer pairs SmChi-1 (F) and SmChi-1 (R) for SmChi-1, SmChi-2 (F) and SmChi-2 (R) for SmChi-2, and SmChi-3 (F) and SmChi-3 (R) for SmChi-3 (
Measurement of activity of chitinolytic enzymes in organs of S. marmoratus (
findings suggested a possibility that chitinases in fish have physiological roles in several, non-digestive organs, as well as having a role in the digestion of ingested chitinous substances in the stomach. In addition, while the ratio of the degradation ability for pNP-(GlcNAc)2 to that for pNP-(GlcNAc)3 in the stomach was approximately 1:1.5, the ratio in the kidney was 1:12.5, which considerably differed from that in the stomach. This finding suggested the presence of chitinases in the kidney that degrade pNP-(GlcNAc)3 better than pNP-(GlcNAc)2, such as SmChiC in the stomach of S. marmoratus [
Chitinase activity of crude enzymes obtained from the stomach and kidney of S. marmoratus was measured at each pH using pNP-(GlcNAc)2 as a substrate (
slightly more neutral than the optimum pH of the stomach chitinase and this finding suggested that the chitinase activity detected in the kidney was attributable to the effect of a new chitinase that was different from the stomach chitinase. Chitinases have been obtained from fish organs other than those of the digestive system; for example, previous studies have reported the activity of chitinase in the blood serum of Salmo gairdneni [
As a result of amplification of internal sequences of a gene of a new chitinase obtained from the kidney of S. marmoratus, 350 bp gene fragments were obtained. Analysis of base sequences of the gene fragments, conducted by the National Center for Biotechnology Information Basic Local Alignment Search Tool (NCBI Blast), showed 94% homology with fChi3 of Paralichthys olivaceus. After this analysis, unknown regions of the upstream and downstream regions of the chitinase obtained from the kidneys of S. marmoratus were amplified using the RACE method. As a result, initiation codons and termination codons were found in the upstream regions and the downstream regions, respectively. Full-length genes of the chitinase obtained from the kidney of S. marmoratus were amplified using a sense primer and an antisense primer (designed with upstream and downstream untranslated regions (UTRs) in mind, respectively) and an enzyme with proofreading activity. As a result, a 1618 bp full-length gene of the chitinase obtained from the kidney of S. marmoratus (SmChi-3) was obtained. This gene contained a 1440 bp open reading frame (ORF) encoding 480 amino acids (
Molecular weight of SmChi-3 was estimated at 51 kDa based on its deduced amino acid sequence (SmChi-3) using the Compute pI/Mw tool of the Expert Protein Analysis System (ExPASy, Lausanne, Switzerland). This value is most similar to that of SmChi-1 (AB686658; 49 kDa), SmChi-2 (AB686659; 52 kDa), and chitotriosidase (51 kDa) obtained from a mammal (Rattus norvegicus), which were estimated using the same method. This value was considerably lower than the value of 75 kDa for the chitinase obtained from blood serum of O. niloticus [
sequences of genes, corresponding to Chi-3, of four varieties of fish and their predicted domain structures for comparison. SmChi-1, SmChi-2, and SmChi-3 consisted of N-terminal signal peptides, a catalytic domain, a chitinase insertion domain, a linker region, and a chitin binding domain, and the catalytic domain contained a sequence peculiar to the active site of GH family 18 chitinase, DXXDXDXE [
Phylogenetic analysis of SmChi-3 was conducted on the basis of homology of deduced amino acid sequences of family 18 chitinases of other vertebrates and of
chitinase from Serratia marcescens, which was used as an outgroup (
H. otakii, AMCase of Larimichthys crocea, AMCase-like of Neolamprologus brichardi, chitotriosidase-1-like of Oryzias latipes, fChi3 of P. olivaceus, chitotriosidase-1-like of Stegastes partitus, AMCase-like of Takifugu rubripes, Chi3 of T. orientalis, chitotriosidase-1-like of Labrus bergylta (muscle) (XP_020510835), with AMCase of O. niloticus (blood) (XP_019205294), and chitotriosidase-1-like of Lates calcarifer (brain, kidney) (XP_018529975). One of the functions of chitinases in fish organs other than the stomach is said to be defense-related [
Expression of SmChi-1, SmChi-2, SmChi-3, and β-actin, which is used as a housekeeping gene, in organs of S. marmoratus were analyzed by a semi-quantitative RT-PCR method and the result is shown in
In the body of S. marmoratus, relatively high chitinase activity was observed not only in the stomach, but also in the liver, spleen, kidney, and heart. Hex activity, on the other hand, was detected widely throughout the body; especially high Hex activity was observed in the spleen, kidney, and heart. Optimum pH for a chitinase contained in the crude enzyme of the stomach of S. marmoratus was
measured using pNP-(GlcNAc)2 as a substrate and was determined to be at pH 2.5. Its optimal pH was similar to that of previously reported fish stomach chitinases. On the other hand, the ratio of the degradation ability for pNP-(GlcNAc)2 to that for pNP-(GlcNAc)3 of a chitinase contained in the kidney and its optimum pH was different from those of previously reported chitinases obtained from the stomach of S. marmoratus and the blood plasma of O. niloticus. Molecular weight estimated from a deduced amino acid sequence of the new chitinase gene SmChi-3 (ORF, 1440 bp) obtained from the kidney of S. marmoratus in this study was 51 kDa, which was most similar to the molecular weight of chitotriosidase obtained from R. norvegicus (50 kDa), but was remarkably lower than a chitinase obtained from the blood plasma of O. niloticus (75 kDa). These findings suggested that SmChi-3 was a new chitinase that was distinct from stomach chitinases and blood plasma chitinases. Although SmChi-3 had a domain structure analogous to that previously reported for SmChi-1 and SmChi-2, SmChi-3 did not have SG repeated sequences in the linker region as observed in SmChi-1 and SmChi-2. Phylogenetic analysis revealed that SmChi-3 formed a peculiar cluster Fish Chitinase-3 (FCase-3), which is different from clusters of previously reported chitinases obtained from ray-finned fish (AFCase-1 and AFCase-2). Furthermore, because Chi-3 of T. orientalis and that of pilchard branch off in this phylogenetic analysis, the FCase-3 cluster may be divided further. Expression analysis of SmChi-1, SmChi-2, and SmChi-3 in organs made by a semi-quantitative RT-PCR method showed that expression of SmChi-3 in the liver and kidney, where SmChi-1 and SmChi-2 were not expressed. Furthermore, the results of chitinase activity measurement in the body of S. marmoratus and expression analysis of each gene suggested a possibility that chitinase activity in the kidney and liver was attributable to SmChi-3, but chitinase activity in the spleen was attributable to another chitinase different from SmChi-1, SmChi-2, and SmChi-3.
This work was supported in part by College of Bioresource science, Nihon University Grant (2017).
Watanabe, M., Kakizaki, H., Tsukamoto, T., Fujiwara, M., Fukushima, H., Ueda, M. and Matsumiya, M. (2018) Distribution of Chitinolytic Enzyme in the Organs and Molecular Cloning of a Novel Chitinase Gene from the Kidney of Marbled Rockfish Sebastiscus marmoratus. Advances in Bioscience and Biotechnology, 9, 36-51. https://doi.org/10.4236/abb.2018.91004