Circulating tumor cells (CTCs) are a population of tumor-derived cells that detach from the primary tumor and initiate metastasis. However, the mechanisms of this process are still unknown. This phenomenon renders CTCs as a valuable resource for prognosis and diagnosis of cancer. The involvement of stemness transcription factors and markers, such as NANOG, OCT3/4, CD34, NESTIN, and SOX2, in metastasis initiation has been studied recently because their abnormally elevated expression in cancer cells may be highly important in understanding tumor initiation. This study analyzed the genetic profiles of the above genes in CTCs derived from patients with different types of cancer. Blood samples were randomly collected from 71 cancer patients with various cancer types. CTCs were isolated using enrichment protocols and RNA was extracted. RT-qPCR was performed in triplicate using ACTB as the reference gene. The statistical analysis was performed among the ΔCts of the samples using parametric and non-parametric methods. The molecular analysis revealed that the expression of each gene was different than the others. When each type of cancer was analyzed separately, the gene expression profile was not always the same. It is noteworthy that, in all cases, the gene expression of NESTIN differed from that of transcription factors. According to the above data, gene expression profiles might be used as a potential biomarker or constitute a gene signature.
Circulating tumor cells (CTCs) constitute a sub-population of cancer cells that have shed into the vasculature or lymphatics from a primary tumor. CTCs detach from the original tumor and circulate through the blood stream, subsequently spreading to other organs where they can initiate tumor metastasis in the new microenvironment. Nevertheless, the mechanisms of detachment from the tumor site and re-establishment at a different site are still unknown.
CTCs were first reported by Thomas Ashworth in 1869 [
Pardal et al., reviewing the principles of stem-cell biology to cancer, stated that “several signalling pathways that regulate normal stem-cell self-renewal cause neoplastic proliferation when dysregulated by mutations” [
The statistical analysis among all cancer types revealed that the expression of each gene was significantly different when all samples were included (p = 0.0001). In terms of the gene expression rates, higher expression was observed for OCT3/4, followed by NANOG and SOX2. CD34 was expressed at lower levels, while NESTIN exhibited the lowest gene expression (
carcinoma (SCC) in which only the gene expression of NESTIN was quite different than that of the other factors (p = 0.03). In ovarian and multiple myeloma cancer, we obtained the same expression profiles with differences among NANOG-CD34 (p = 0.013/p = 0.001), NANOG-NESTIN (p = 0.0005/p = 0.0002), OCT3/4-CD34 (p = 0.005/p = 0.0003), OCT3/4-NESTIN (p = 0.0004/p = 0.0002), CD34-NESTIN (p = 0.003/p = 0.0002), CD34-SOX2 (p = 0.02/p = 0.002), and NESTIN-SOX2 (p = 0.0006/p = 0.0002). In melanoma and glioblastoma CTCs, except for the former, there were also differences between OCT3/4 and SOX2 (p = 0.04/p = 0.01). In cases of primary tumors with an unknown origin, the analysis revealed differences in the gene expression of all markers except for NANOG-OCT3/4 (p = 0.06). When the analysis was performed in breast CTCs, according to the state of the disease, there were no significant differences.
Regarding the gene expression among the different types of cancer, NANOG’s expression was higher in ovarian, melanoma, sarcoma and multiple myeloma cancer and lower in breast, colon and prostate carcinoma. The lower expression was observed in SCC and in unknown origin of primary tumor cases. In OCT3/ 4, the higher expression was observed for sarcoma, melanoma and multiple myeloma while the gene expression in the other types was lower with no significant differences among them. Regarding CD34 gene expression, the higher expression was for sarcoma samples followed by caner of unknown origin and colon. The SCC cases had the lower expression, however with no great difference. In NESTIN, the lower expression was for SCC and increasing followed glioblastoma, multiple myeloma, prostate, breast, unknown origin of primary tumor, melanoma, colon and ovarian, while sarcoma demonstrated the higher gene expression levels. Finally, in SOX2 gene, the higher expression observed in ovarian cancer, followed in decreasing rate by myeloma and sarcoma. Breast, colon, prostate and glioblastoma samples exhibited similar gene expression levels, higher that SCC and unknown origin tumor which had the lower SOX2
gene expression.
Regarding the gene expression among CTCs and normal samples, it has been observed that in NANOG, OCT3/4 and CD34 the changes in gene expression are not quite different, while in NESTIN the gene expression is lower for CTCs. On the contrary, the SOX2 is overexpressed in CTCs.
CTCs have been of interest to the scientific community for the last 15 years. They have proved to be an invaluable resource for cancer prognosis because their existence has been shown in the majority of malignant tumors. Nevertheless,
Marker | Cancer Type | Breast | Colon | Prostate | Unknown Origin | Sarcoma | SCC | Multiple Myeloma | Ovarian | Melanoma | Glioblastoma |
---|---|---|---|---|---|---|---|---|---|---|---|
CK | + | + | + | + | NT | + | NT | + | NT | NT | |
CD99 | NT | NT | NT | NT | + | NT | NT | NT | NT | NT | |
CD63 | NT | NT | NT | NT | NT | NT | NT | NT | + | NT | |
CD45 | − | − | − | − | − | − | + | − | − | − |
to truly understand the nature of CTCs and their functional role in cancer development and metastasis, it is imperative to study their genetic expression profile. Similar to CSCs, CTCs express stemness and EMT markers that might implicate them in tumor initiation [
Stemness involves the ability of cell renewal and differentiation during early embryonic development and in cancer development. Transcription factors such as NANOG, OCT3/4 and SOX2 have been implicated in regulation of early embryonic stem cell development [
OCT3/4 is a transcription factor associated with pluripotency in embryonic stem cells. In particular, expression of OCT3/4 is required to maintain the pluripotent status of human embryonic stem cells by inhibiting expression of human chorionic gonadotropin, a placental marker of embryonic stem cells. Consequently, OCT3/4 is a stemness regulator in human embryonic stem cells [
Various reviews [
In addition to its role in NANOG regulation, SOX2 promotes cellular proliferation in various types of cancer, contributes to apoptosis inhibition, and enhances metastasis [
The present study demonstrated that NANOG and OCT3/4 have similar expression profiles in CTCs of the majority of the different cancer types, but it is not always the case for the expression of both NANOG and OCT3/4 and SOX2. In particular, colon, sarcoma, SCC, prostate, multiple myeloma, and ovarian cancers have similar expression of all three genes, whereas breast, melanoma, glioblastoma, and cancer of unknown origin have statistically different expression of OCT3/4 and SOX2 genes. These data suggest that the molecular mechanisms of OCT3/4 and SOX2 functions in CTCs are different in some cancer types.
As far as the gene expression levels among the different types of cancer, the OCT3/4 is overexpressed when compared with NANOG and SOX2. In addition, the gene expression level of OCT3/4 and SOX2 are correlated with these of NANOG’s, indicating their role in NANOG regulation. In ovarian cancer, where their expression is higher, there has been proved that due to the stem cells the patients can develop recurrent chemoresistant disease that is usually fatal [
NESTIN is an intermediate filament protein that is mainly found in rapidly dividing cells of developing and regenerative tissues. Expression of NESTIN has been associated with cytoplasmic trafficking in progenitor cells, but it has not been identified as a stemness marker in many types of cancer [
CD34 is a transmembrane glycoprotein that was originally identified as a marker of hematopoietic stem cells. However, recent studies have suggested that CD34 is a marker of all progenitor cells, because its expression has been shown in multiple cell types [
According to a previous study, CSCs are a subset of CTCs. CTCs have been found to express epithelial, mesenchymal or stemness markers [
Furthermore, these results confirm on gene expression level the study of Grillet et al. that in colorectal cancer the CTCs express cancer stem cell phenotype and the observation that in ovarian cacer the CTCs can be positive for stem cell markers [
Comparing the expression of stemness transcription factors with normal samples, it is noteworthy that NESTIN is under-expressed in CTCs, while SOX2 is overexpressed. For the rest markers, there is observed no significant difference. The under expression of NESTIN may be correlated with its role, which is particularly expressed in tumor of epithelial and mesenchymal origin. On the other hand, the over expression of SOX2 might indicate its contribution in metastasis. Its expression may be involved or regulate other transcription factors, which are responsible for propagating metastasis.
The present study should be performed in more samples from different kinds of cancer, since in some of them the number is not sufficient for global interpretation. However, these data are a useful indication for the majority of types.
Blood samples from 71 patients were collected in sterile 50-ml falcon tubes (4440100; Orange Scientific) containing 7 ml of 0.02 M EDTA (E0511.0250; Duchefa Biochemie B.V.) as an anticoagulant. The cancer types of the samples included breast (24), colon (6), prostate (4), sarcoma (5), ovarian (2), melanoma (2), glioblastoma (2), multiple myeloma (3), SCC (4), and cancer with an unknown origin of the primary tumor (19). The samples were collected randomly from physicians in U.S.A. and Europe. Regarding their age the average was 54.13 ± 3.77. Between them, the majority was female samples (68.9%), while the male samples were 31.4%. 65.2% of samples were received from U.S.A. and the rest 34.8% were collected from patients lived in European countries. The volume of collected blood was 20 mL. The samples were applied to a roller for 30 minutes and then sent to the laboratory for analysis. Transit of the samples to the laboratory did not exceed 72 h. The study was performed from January to June 2016. In addition, two normal samples were used as reference group for the qPCR analysis. The samples were collected from a healthy 40-year old man and a 32-year old woman.
The period between transportation and analysis did not affect the experimental analysis. To ensure this, blood samples were collected from five healthy donors and placed in five different 50 ml falcon tubes. The tubes were then stored at 4˚C, which is the temperature of transportation package. Each day, starting from 0 h, every sample from each donor, was tested by using molecular and cellular assays. In a time window of 0, 24, 48, 72 and 96 h of storage, the gene expression of many genes correlated with cell cycle, apoptosis, cytoskeleton, stemness, cytokeratins, growth factors, signaling transduction pathways etc were tested. The same procedure was performed with flow cytometry to study the protein level. Finally, the number of CTCs was measured for every sample each day. Ta data were analyzed and there was not observed any statistically significant difference among the different time periods. Concerning the above experimental data, the transit period, did not affect the analysis of the present study.
Whole blood cells were centrifuged for 20 min at 4000 rpm at 4˚C with polysucrose solution (Biocoll separating solution 1077; Biochrom). Mononuclear cells, lymphocytes, platelets, and granulocytes were collected after centrifugation and washed with phosphate-buffered saline (PBS) (P3813; Sigma). The cells were incubated in lysis buffer [154 mM NH4Cl (31107; Sigma), 10 mM KHCO3 (4854; Merck), and 0.1 mM EDTA in deionized water) for 10 min to lyse the erythrocytes. They were then centrifuged and washed with PBS. Then, the cells were incubated with magnetic beads, pancytokeratin (5c-81714; Gentaur) for breast, colon, prostate, unknown origin, SCC and ovarian types of cancer, CD99 (39-CD99-250; Gentaur) for sarcoma, CD45 (8804-6802-74; Ebioscience) for myeloma and glioblastoma, or CD63 (39-CD63-250; Gentaur) for melanoma, at 4˚C for 30 min. After incubation, the samples were placed in a magnetic field, positively or negatively selected based on the cancer type, and then washed with PBS. CD45 negative selection was performed only for glioblastoma cells. For the rest types of cancer, positive selection was carried out. The cells were isolated and cultured in 12-well plates (4430400N; Orange Scientific) with RPMI-1640 medium (R6504; Sigma). The number of cells was calculated by performing a trypan blue (0.4%) viability test with neubauer chamber. The isolated CTCs were validated with cellular and molecular-based assays. The validation included identification of the above markers with flow cytometry prior to RNA isolation and then endpoint-PCR after isolation and prior to qPCR experiments.
Total RNA from cell cultures was extracted using a MagCore Total RNA Cultured Cells Kit (MRC-02; RBC Bioscience). The samples were evaluated spectrophotometrically. Then, 1 µg of each RNA sample was used as a template for cDNA synthesis using a PrimeScript RT Reagent Kit (RR037A; Takara). Real-time qPCR was then performed using KAPA SYBR Fast Master Mix (2×) Universal (KK4618; KAPA Biosystems). Specific primers for each marker and the reference gene (ACTB) were designed using Gene Expression 1.1 software. Primer sequences were evaluated by BLAST searching to exclude those that would amplify undesired genes (
Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) | Length (bp) | Annealing Temp (˚C) |
---|---|---|---|---|
ACTB | GCCCTGGACTTCGAGCAAGAGA | CAGGAAGGAAGGCTGGAAGAGTG | 144 | 84 |
NANOG | CGTGTGAAGATGAGTGAAACTG | GGATGGGCATCATGGAAA | 138 | 79 |
OCT3/4 | AGGAAGCTGACAACAATG | ACTCGGTTCTCGATACTG | 97 | 79 |
CD34 | CCCATGCTGGAGGTGACATCTC | CCAGGGAGCCGAATGTGTAAAG | 130 | 82 |
NESTIN | GAGACACCTGTGCCAGCCTTTCTTA | CTGGGCTCTGATCTCTGCATCTACAG | 132 | 83 |
SOX2 | CTCGCCCACCTACAGCAT | GCTGGCCTCGGACTTGAC | 91 | 84 |
qPCR results were tested for normality according to the Kolmogorov-Smirnov test. The Kruskal-Wallis test and one-way analysis of variance were performed on the qPCR data depending on their distribution. A significant p-value was defined as less than 0.05. Statistical analysis was performed with PAST version 2.10 [
This study is not a clinical trial and does not include intervention in patients. All procedures were conducted according to the standards of Safety, Bioethics and Validation. The study was reviewed and approved by Bioethical Committee of the Research Genetic Cancer Centre Group. Each patient provided informed consent in writing for the use of their sample in the present study. The patients retained the right to withdraw their sample until the date when the sample was received at the laboratory and tested.
We demonstrated that CTCs exhibit stemness characteristics and express specific transcription factors. Their expression is different and might be used to delineate either biomarkers or prognostic indicators. The higher expression of some genes may lead to the identification of potential drug targets. The genetic profiles among different types of cancer could also be used as a predictive reference in therapy. However, all the above aspects need to be tested in more samples including other types of cancer.
Apostolou, P., Papadimitriou, M. and Papasotiriou, I. (2017) Stemness Gene Profiles of Circulating Tumor Cells. Journal of Cancer Therapy, 8, 155-167. https://doi.org/10.4236/jct.2017.82013
CTCs: Circulating tumor cells
CSCs: Cancer stem cells
CK: Cytokeratin
EMT: Epithelial-to-mesenchymal transition
qPCR: Quantitative polymerase chain reaction
PCR: Polymerase chain reaction
RT-qPCR: Reverse transcription polymerase chain reaction
SCC: Squamous cell carcinoma
Submit or recommend next manuscript to SCIRP and we will provide best service for you:
Accepting pre-submission inquiries through Email, Facebook, LinkedIn, Twitter, etc.
A wide selection of journals (inclusive of 9 subjects, more than 200 journals)
Providing 24-hour high-quality service
User-friendly online submission system
Fair and swift peer-review system
Efficient typesetting and proofreading procedure
Display of the result of downloads and visits, as well as the number of cited articles
Maximum dissemination of your research work
Submit your manuscript at: http://papersubmission.scirp.org/
Or contact jct@scirp.org