In order to invade and adapt to deep-sea environments, shallow-water organisms have to acquire tolerance to high hydrostatic pressure, low water temperature, toxic methane and hydrogen sulfide, and feeding strategies not relying on photosynthetic products. Our previous study showed that the “evolutionary stepping stone hypothe-sis”, which assumes that organic falls can act as stepping-stones to connect shallow sea with deep sea, was supported in Mytilidae. However, it is not known whether other bivalves constituting chemosynthetic communities experienced the same evolutionary process or different processes from mytilid mussels. Therefore, here, we performed phylogenetic analyses by sequencing the nuclear 18S rRNA and mitochondrial COI genes of solemyid and thyasirid bivalves. In Solemyidae, the two genera Solemya and Acharax formed each clade, the latter of which was divided into three subgroups. The Solemya clade and one of the Acharax subgroups diverged in the order of shallow-sea residents, whale-bone residents, and deep-sea vent/seep residents, which supported the “evolutionary stepping stone hypothesis”. Furthermore, in Thyasiridae, the two genera Thyasira and Maorithyas formed a paraphyletic group and the other genera, Adontorhina, Axinopsis, Axinulus, Leptaxinus, and Mendicula, formed a clade. The “evolu-tionary stepping stone hypothesis” was not seemingly supported in the other lineages of Solemyidae and Thyasiridae.
In 1977, a community whose primary production is dependent on chemosynthetic bacteria was found at a hydrothermal vent along the Galapagos Rift [
Distel et al. [
Solemyidae is an ancient group of bivalves whose fossil records date back to the Ordovician [
The known fossil records of Thyasiridae date back to the Cretaceous [
In solemyid and thyasirid bivalves, symbiosis does not depend on depth and existence of organic falls, although only mytilid mussels that inhabit organic falls and deep- sea vents/seeps represent bacterial symbiosis, but not shallow-sea mytilids. Therefore, it is conceivable that solemyids and thyasirids did not require organic falls to acquire tolerance to toxic hydrogen sulfide and methane and to develop symbiosis, which suggest that they might adapt to deep-sea environments in a way(s) that is different from that by mytilid mussels. In other words, it is possible that the “evolutionary stepping stone hypothesis” cannot be supported by solemyid and thyasirid bivalves.
In the present study, we determine the nucleotide sequences of the nuclear 18S ribosomal RNA (18S rRNA) gene and the mitochondrial cytochrome c oxidase subunit I (COI) gene and deduce the phylogenetic relationships in solemyids and thyasirids to give an insight into their deep-sea adaptation.
The specimens, of which DNA sequences were determined in the present study, are listed in
Species | Abbreviation | Site (locality number in | Depth (m) | Habitat type | 18S | COI | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Solemyidae | |||||||||||||
Acharax japonica | SHI4-1 | Nabeta Bay, Shimoda City (7) | Unknown | Shallow water | LC186952 | ||||||||
Acharax japonica | SHI4-2 | Nabeta Bay, Shimoda City (7) | Unknown | Shallow water | LC186953 | ||||||||
Acharax japonica | SHI4-5 | Nabeta Bay, Shimoda City (7) | Unknown | Shallow water | LC186954 | LC186990 | |||||||
Acharax japonica | SHI5-6B | Nabeta Bay, Shimoda City (7) | Unknown | Shallow water | LC186955 | ||||||||
Acharax johnsoni | AJK1-1 | Nankai Trough (10) | 2049 | Seep | LC186956 | LC186991 | |||||||
Acharax johnsoni | AJK1-2 | Nankai Trough (10) | 2049 | Seep | LC186957 | LC186992 | |||||||
Acharax johnsoni | AJH1-2 | Off Hatsushima, Sagami Bay (6) | 1176 | Seep | LC186958 | LC186993 | |||||||
Acharax sp. | AJH1-1 | Off Hatsushima, Sagami Bay (6) | 1176 | Seep | LC186959 | LC186994 | |||||||
Acharax sp. | HS2-1 | Off Hatsushima, Sagami Bay (6) | 1153 | Seep | LC186960 | LC186995 | |||||||
Acharax sp. | AJO1-1 | Okinoyama Bank Site, Sagami Bay (5) | Unknown | Seep | LC186961 | LC186996 | |||||||
Acharax sp. | CST1 | Chishima Trench (1) | 4970 | Seep | LC186962 | LC186997 | |||||||
Acharax sp. | AJJ1-1 | Japan Trench (2) | 5315 | Seep | LC186963 | LC186998 | |||||||
Acharax sp. | AJJ2-2 | Japan Trench (2) | 5300 | Seep | LC186964 | LC186999 | |||||||
Acharax sp. | AJJ02 | Japan Trench (2) | 5300 | Seep | LC186965 | ||||||||
Acharax sp. | JT1A | Japan Trench (2) | 5300 | Seep | LC186966 | ||||||||
Acharax sp. | JT1B | Japan Trench (2) | 5300 | Seep | LC186967 | LC187000 | |||||||
Acharax sp. | JT4 | Japan Trench (2) | 5300 | Seep | LC186968 | ||||||||
Acharax sp. | W2-1 | Off Noma Cape, Kagoshima (13) | 217 | Whale bone | LC186969 | LC187001 | |||||||
Acharax sp. | Lau1 | Hine Hina, Lau Basin (14) | 1817 | Vent | LC186970 | LC187002 | |||||||
Solemya pervernicosa | SW3-1 | Off Noma Cape, Kagoshima Bay (13) | Unknown | Whale bone | LC186971 | ||||||||
Solemya pervernicosa | SW4-1 | Off Noma Cape, Kagoshima Bay (13) | 236 | Whale bone | LC186972 | LC187003 | |||||||
Solemya pervernicosa | SW5-1 | Off Noma Cape, Kagoshima Bay (13) | 226 | Whale bone | LC186973 | LC187004 | |||||||
Solemya pusilla | SPM | Koajiro Bay, Miura City (4) | 7.1 - 8.1 | Shallow water | LC186974 | LC187005 | |||||||
Solemya tagiri | KGS1-1 | Wakamiko Caldera, Kagoshima Bay (12) | 94 - 98 | Vent | LC186975 | LC187006 | |||||||
Solemya tagiri | KGS1-2 | Wakamiko Caldera, Kagoshima Bay (12) | 94 - 98 | Vent | LC186976 | LC187007 | |||||||
Solemya tagiri | KGS2-1 | Wakamiko Caldera, Kagoshima Bay (12) | 102 | Vent | LC186977 | LC187008 | |||||||
Solemya tagiri | KGS2-3 | Wakamiko Caldera, Kagoshima Bay (12) | 102 | Vent | LC186978 | ||||||||
Solemya tagiri | KGS3-1 | Wakamiko Caldera, Kagoshima Bay (12) | 185 | Vent | LC186979 | ||||||||
Solemya tagiri | KGS4-1 | Wakamiko Caldera, Kagoshima Bay (12) | 198 | Vent | LC186980 | ||||||||
Solemya tagiri | KGS4-2 | Wakamiko Caldera, Kagoshima Bay (12) | 198 | Vent | LC186981 | ||||||||
Solemya tagiri | KGS5-1 | Off Noma Cape, Kagoshima (13) | 249 | Whale bone | LC186982 | LC187009 | |||||||
Solemya tagiri | KGS6-1 | Off Noma Cape, Kagoshima (13) | 226 | Whale bone | LC186983 | LC187010 | |||||||
Solemya sp. | SWC1 | Wakamiko Caldera, Kagoshima Bay (12) | 100 | Vent | LC186984 | ||||||||
Solemya sp. | SWC2 | Wakamiko Caldera, Kagoshima Bay (12) | 196 | Vent | LC186985 | LC187011 | |||||||
Solemya sp. | AC1-1 | Off Ashizuri Cape (11) | 575 | Seep | LC186986 | LC187012 | |||||||
Solemya sp. | AC1-2 | Off Ashizuri Cape (11) | 575 | Seep | LC186987 | LC187013 | |||||||
Solemya sp. | W6-1 | Off Noma Cape, Kagoshima Bay (13) | 227 | Whale bone | LC186988 | LC187014 | |||||||
Solemya sp. | W12-1 | Off Noma Cape, Kagoshima Bay (13) | 252 | Whale bone | LC186989 | LC187015 | |||||||
Thyasiridae | ||||||
---|---|---|---|---|---|---|
Axinopsis rubiginosa | RA-K1 | Off Kawarago, Hitachi City (3) | 350 | Fine sand | LC187016 | LC187041 |
Maorithyas hadalis | TH-JT1 | Japan Trench (2) | 7333 | Seep | LC187017 | LC187042 |
Thyasira kaireiae | PK3 | Japan Trench (2) | 5345 | Seep | LC187018 | LC187043 |
Thyasira kaireiae | PK6 | Japan Trench (2) | 5345 | Seep | LC187019 | LC187044 |
Thyasira kaireiae | PK7 | Japan Trench (2) | 5345 | Seep | LC187020 | LC187045 |
Thyasira sp. | INT-1 | Off Inatori (8) | ca. 400 | Mud | LC187021 | |
Thyasira sp. | INT-2 | Off Inatori (8) | ca. 200 | Mud | LC187022 | LC187046 |
Thyasira sp. | IO1 | Off Hatsushima, Sagami Bay (6) | 1158 | Vent | LC187023 | LC187047 |
Thyasira sp. | TH1 | Off Hatsushima, Sagami Bay (6) | 1158 | Seep | LC187024 | |
Thyasira sp. | TH2 | Off Hatsushima, Sagami Bay (6) | 927 | Seep | LC187025 | |
Thyasira sp. | TH3 | Off Hatsushima, Sagami Bay (6) | 927 | Seep | LC187026 | |
Thyasira sp. | TH4 | Off Hatsushima, Sagami Bay (6) | 927 | Seep | LC187027 | LC187048 |
Thyasira sp. | TH5 | Off Hatsushima, Sagami Bay (6) | 855 | Seep | LC187028 | LC187049 |
Thyasira sp. | TH6 | Off Hatsushima, Sagami Bay (6) | 855 | Seep | LC187029 | LC187050 |
Thyasira sp. | TH7 | Off Hatsushima, Sagami Bay (6) | 855 | Seep | LC187030 | LC187051 |
Thyasira sp. | TH8 | Off Hatsushima, Sagami Bay (6) | 855 | Seep | LC187031 | LC187052 |
Thyasira sp. | TH11 | Off Hatsushima, Sagami Bay (6) | 1173 | Seep | LC187032 | LC187053 |
Thyasira sp. | TH12 | Off Hatsushima, Sagami Bay (6) | 1173 | Seep | LC187033 | LC187054 |
Thyasira sp. | TH19 | Off Hatsushima, Sagami Bay (6) | 927 | Seep | LC187034 | LC187055 |
Thyasira sp. | TH21 | Off Hatsushima, Sagami Bay (6) | 1170 | Seep | LC187035 | LC187056 |
Thyasira sp. | TH32 | Joetsu Knoll, Toyama Trough (9) | 986 | Seep | LC187057 | |
Thyasira sp. | TH33 | Off Hatsushima, Sagami Bay (6) | 855 | Seep | LC187058 | |
Thyasira sp. | TH34 | Off Hatsushima, Sagami Bay (6) | 856 | Seep | LC187036 | LC187059 |
Thyasira sp. | TH35 | Off Hatsushima, Sagami Bay (6) | 927 | Seep | LC187037 | LC187060 |
Thyasira sp. | TH37 | Off Hatsushima, Sagami Bay (6) | 927 | Seep | LC187038 | LC187061 |
Thyasira sp. | TT1 | Joetsu Knoll, Toyama Trough (9) | 986 | Seep | LC187039 | LC187062 |
Thyasira sp. | TN1 | Off Noma Cape, Kagoshima Bay (13) | 226 | Whale bone | LC187040 | LC187063 |
rubiginosa from off Kawarago, solemyid bivalves from off Ashizuri Cape, and Thyasira sp. from off Inatori were collected by dredging. All samples were frozen and preserved at −80˚C or in 100% ethanol and deposited at JAMSTEC. The specimens, of which DNA sequences were quoted from the DNA Data Bank of Japan (DDBJ), are listed in
Total DNA was prepared from the soft tissue using a DNeasy® Tissue Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol.
Species | Abbreviation | Site | Depth (m) | Habitat type | 18S | COI |
---|---|---|---|---|---|---|
Solemyidae | ||||||
Acharax sp. | A1-Makran | Makran | 2200 | Unknown | AJ563759 | |
Acharax sp. | A1-Java | Java | 2940 | Unknown | AJ563756 | |
Acharax sp. | A2-Java | Java | 2940 | Unknown | AJ563757 | |
Acharax sp. | A5-Aleutian | Aleutian Trench | 4810 | Unknown | AJ563760 | |
Acharax sp. | A3-Costa Rica | Costa Rica | 763 | Unknown | AJ563763 | |
Acharax sp. | A1-Oregon | Oregon | 780 | Unknown | AJ563751 | |
Acharax sp. | A2-Oregon | Oregon | 910 | Unknown | AJ563753 | |
Acharax sp. | A8-Oregon | Oregon | 780 | Unknown | AJ563752 | |
Acharax sp. | A10-Oregon | Oregon | 910 | Unknown | AJ563754 | |
Acharax sp. | A13-Oregon | Oregon | 910 | Unknown | AJ563755 | |
Acharax sp. | A1-Peru | Peru | ca.3500 | Unknown | AJ563762 | |
Solemya elarraichensis | Solemya elarraichensis | Unknown | Unknown | Unknown | KC984719 | |
Solemya reidi | Solemya reidi | Santa Monica Bay, sewage outfall | Unknown | Shallow water | AF117737 | |
Solemya velesiana | Solemya velesiana | Unknown | Unknown | Shallow water | KC984744 | |
Solemya velum | Solemya velum | Unknown | Unknown | Shallow water | AF120524 | |
Solemya velum | Solemya velum | Unknown | Unknown | Shallow water | KC984745 | |
Thyasiridae | ||||||
Adontorhina cyclia | Adontorhina cyclia | San Diego, California, USA | Unknown | Shallow water | AM392455 | |
Axinulus eumyaria | Axinulus eumyaria | Fanafjord, Norway | Unknown | Shallow water | AM706494 | |
Axinulus sp. | Axinulus sp. | Scotia Ridge, Antarctica | 285 | Unknown | AM392441 | |
Leptaxinus indusarium | Leptaxinus indusarium | Arabian Sea, Pakistan | 775 | Mud | AM392454 | |
Mendicula ferruginosa | Mendicula ferruginosa | Northern North Sea | 125 | Shallow water | AM392456 | |
Mendicula ferruginosa | Mendicula ferruginosa | Flesland, Norway | Unknown | Shallow water | AM706496 | |
Thyasira cf subovata | Thyasira cf subovata | Scotia Ridge, Antarctica | 3894 | Vent | AM392451 | |
Thyasira equalis | Thyasira equalis | Gullmarsfjorden, Sweden | 100 | Shallow water | AM392453 | |
Thyasira equalis | Thyasira equalis | Korsfjord, Norway | Unknown | Shallow water | AM706521 | |
Thyasira flexuosa | Thyasira flexuosa | Plymouth, UK | Unknown | Shallow water | AJ581870 | |
Thyasira gouldi | Thyasira gouldi | Firth of Forth, UK | Unknown | Shallow water | AJ581871 | |
Thyasira granulosa | Thyasira granulosa | Fanafjord, Norway | Unknown | Unknown | AM706503 | |
Thyasira methanophila | Thyasira methanophila | Concepcion, Chile | 780 | Seep | AM392447 | |
Thyasira obsoleta | Thyasira obsoleta | Korsfjord, Norway | Unknown | Unknown | AM706505 | |
Thyasira perplicata | Thyasira perplicata | Angola | 1950 | Seep | AM392448 | |
Thyasira polygona | Thyasira polygona | Northern North Sea | 125 | Shallow water | AM392449 | |
Thyasira sarsi | Thyasira sarsi | Northern North Sea | 139 | Shallow water | AM392450 | |
Thyasira sarsi | Thyasira sarsi | Korsfjord, Norway | Unknown | Shallow water | AM706508 | |
Thyasira sp. | Thyasira sp. Fiji | Fiji Back Arc Basin | 1977 | Vent | AM392452 | |
Nuculidae | ||||||
Acila castrensis | Acila castrensis | Unknown | Unknown | Unknown | KC429319 | KC429087 |
Lucinidae | ||||||
Myrtea spinifera | Myrtea spinifera | Banyuls, France | Unknown | Unknown | AJ581861 | |
Myrtea spinifera | Myrtea spinifera | Unknown | Unknown | Unknown | AY070139 |
To amplify the partial fragments of the 18S ribosomal RNA (18S rRNA) and cytochrome c oxidase subunit I (COI) genes, PCR was performed in reaction solutions containing template DNA and KOD Dash (Toyobo Co., Ltd., Osaka, Japan) under the following condition: 1) 30 cycles of denaturation at 94˚C for 30 s, annealing at 45˚C for 5 s, and extension at 74˚C for 10 s. The primers used in the present study are described in
Specimen | Gene | Primer | Sequence | Orientation | Reference |
---|---|---|---|---|---|
C | 18S rRNA | 1F | TACCTGGTTGATCCTGCCAGTAG | Forward | [ |
C | 18S rRNA | 3R | AGGCTCCCTCTCCGGAATCGAAAC | Reverse | [ |
C | 18S rRNA | 3F | GTTCGATTCCGGAGAGGGA | Forward | [ |
C | 18S rRNA | 5R | CTTGGCAAATGCTTTCGC | Reverse | [ |
C | 18S rRNA | 5F | GCGAAAGCATTTGCCAAGAA | Forward | [ |
C | 18S rRNA | 9R | GATCCTTCCGCAGGTTCACCTAC | Reverse | [ |
C | 18S rRNA | 18Sbi | GAGTCTCGTTCGTTATCGGA | Reverse | [ |
C | 18S rRNA | 1Fn | CGCGAATGGCTCATTAAATC | Forward | This study |
C | 18S rRNA | 9Rn | GTACAAAGGGCAGGGACGTA | Reverse | This study |
S | 18S rRNA | Sol1S | TTACCTGGTTGATCCTGCCAGTAG | Forward | This study |
S | 18S rRNA | Sol1A | ATTCCAATTACGGGGCCTCGAAC | Reverse | This study |
S | 18S rRNA | Sol2S | CTGCCCTATCAACTGTCGATGGTAG | Forward | This study |
S | 18S rRNA | Sol2A | GAACTACGACGGTATCTGATCGTC | Reverse | This study |
S | 18S rRNA | Sol3S | CGGTGTTAGAGGTGAAATTCTTGG | Forward | This study |
S | 18S rRNA | Sol3A | CGACTTTTACTTCCTCTAAGCGATC | Reverse | This study |
T | 18S rRNA | Th1F | GATCCTGCCAGTAGTCATATGC | Forward | This study |
T | 18S rRNA | Th1R | AGACTTGCCCTCCAATGGATC | Reverse | This study |
T | 18S rRNA | Th2F | GTCTGCCCTATCAACTTTCGATGG | Forward | This study |
T | 18S rRNA | Th2R | GGCATCGTTTATGGTCAGAACTACG | Reverse | This study |
T | 18S rRNA | Th3F | GCATTCGTATTGCGGTGTTAGAGG | Forward | This study |
T | 18S rRNA | Th3R | CGACTTTTACTCCCTCTAGTCC | Reverse | This study |
C | COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Forward | [ |
C | COI | HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | Reverse | [ |
S | COI | ACS1 | GGGCTTTGTTAGGGGATGAT | Forward | This study |
S | COI | ACA1 | TCCGGTTAAAACAGGTAAGGA | Reverse | This study |
S | COI | ACS2 | TTTAAGATTATTAATTCGGGCTGAAC | Forward | This study |
S | COI | ACA2 | CCGGTTAAAACAGGTAAGGATAATAA | Reverse | This study |
S | COI | So1F | TTGGTCAACCTGGAGCATT | Forward | This study |
S | COI | So1R | AATTGCTCCGGCTAAAACT | Reverse | This study |
S | COI | So2F | GCTATTTGAGCCGGAATAGTAGG | Forward | This study |
S | COI | So2R | CTGCGGGATCGAAGAATGATGTA | Reverse | This study |
S | COI | So3R | TAGAATAGGATCTCCACCTCCTG | Reverse | This study |
T | COI | CA1 | GGTATACGGGGTAACCC | Reverse | This study |
T | COI | CS2 | CGCTTAGAACTTAGCCAGCC | Forward | This study |
T | COI | CA2 | ATAGGATCCCCCCCTCCAC | Reverse | This study |
T | COI | CS3 | ATTTACTGGGTTAGCTGGGAC | Forward | This study |
T | COI | CA3 | CACGAGGATCAAAAAACCTAC | Reverse | This study |
C, for Solemyidae and Thyasiridae; S, for Solemyidae; T, for Thyasiridae.
performed under the following modified conditions: 2) initial denaturation at 94˚C for 2 min, 5 cycles of denaturation at 94˚C for 30 s, annealing at 48˚C for 1.5 min, and extension at 72˚C for 1 min, followed by 35 cycles of denaturation at 93˚C for 30 s, annealing at 51˚C for 1.5 min, and extension at 72˚C for 1 min, and final extension at 72˚C for 7 min. Alternatively, 3) first PCR was performed under the 1) or 2) condition, and the second PCR was performed under the 1) or 2) condition using primers different from those used in the first PCR. Only for two thyasirid bivalves from off Inatori (INT-1 and INT-2), the first PCR was performed with 1F and 9R primers for 18S rRNA and with LCO1490 and HCO2198 primers for COI under the following condition: initial denaturation at 94˚C for3 min, 35 cycles of denaturation at 95˚C for 45 s, annealing at 55˚C for 3 min, and extension at 72˚C for 1.5 min, and final extension at 72˚C for 7 min; the second PCR was performed with Th1F and Th1R, Th2F and Th2R, and 5F and 9Rn primers for 18S rRNA and with CS2 and CA2 primers for COI under the 2) condition. PCR products were purified using a QIAquick® PCR purification Kit (Qiagen GmbH, Hilden, Germany).
Direct sequencing of the double-stranded PCR product was performed using an ABI PRISM BigDye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems Inc., CA, USA) and the primers used for PCR on Model 377 and 377XL DNA sequencers (Applied Biosystems Inc., CA, USA) according to the manufacturer’s directions. Alternatively, direct sequencing was performed using a GenomeLab™DTCSQuick Start Kit on a CEQ™ 2000XL DNA Analysis System (Beckman Coulter Inc., CA, USA) according to the manufacturer’s directions. DNA sequences were aligned with DNASIS (Hitachi Software Engineering) and MEGA 6.0 [
We constructed three trees based on only 18S rRNA sequences, only COI sequences, and concatenated 18S rRNA + COI sequences for Solemyidae and Thyasiridae, respectively. Trees were constructed by the neighbor-joining (NJ) and maximum parsimony (MP) methods using MEGA 6.0 [
In the NJ tree based on 18S rRNA sequences (1300 bp, 253 variable sites, and 119 informative sites), Acharax formed a paraphyletic group composed of three clades, Acharax 1, Acharax 2, and Acharax 3. Moreover, Solemya formed a clade (
by only deep-sea specimens. Acharax sp. Lau 1 was included in Acharax 1 of the 18S rRNA tree (
In NJ trees based on 18S rRNA (793 bp, 231 variable sites, and 118 informative sites), COI (317 bp, 200 variable sites, and 145 informative sites), and concatenated 18S rRNA + COI (1110 bp, 400 variable sites, and 237 informative sites) sequences, Thyasira formed a paraphyletic group (Figures 5-7). The genera, Thyasira and Maorithyas, included specimens that have two demibranchs and symbiotic bacteria. The other genera, Adontorhina, Axinopsis, Axinulus, Leptaxinus, and Mendicula, formed a clade including specimens that have one demibranch and no symbiotic bacteria. Thyasirid bivalves did not diverge in the order of shallow-sea residents, whale-bone residents, and deep-sea vent/ seep residents. Thyasira kaireiae in the Japan Trench and Thyasira sp. off Hatsushima formed a clade as shown by Cluster A in
trees. Similarly to the above Solemyidae, the 18S rRNA tree included more data from DDBJ. In Thyasiridae, the three trees, 18S rRNA, COI, and 18S rRNA + COI, were generally consistent, although the phylogenetic position of Thyasira sarsi in the 18S rRNA tree was different from that in the COI and 18S rRNA + COI trees.
Miyazaki et al. [
As in the mytilid mussels, splitting in the order of shallow-sea residents, whale-bone residents, and deep-sea vent/seep residents was shown in the Cluster X of the COI tree (
Acharax sp. Lau 1 and Solemya sp. SWC2 presented markedly divergent phylogenetic positions between the 18S rRNA and COI trees, although we used the same specimen in each taxon for sequencing. The present study cannot explain the discrepancies of their phylogenetic positions between the trees.
Thyasira bivalves did not diverge in the order of shallow-sea residents, whale-bone
residents, and deep-sea vent/seep residents (Figures 5-7) and it suggested that the “evolutionary stepping stone hypothesis” was not supported in this group. However, to evaluate the “evolutionary stepping stone hypothesis” in Thyasiridae, more whale-bone thyasirids have to be investigated, because we used only one whale-bone specimen.
The paraphyletic group composed of Thyasira and Maorithyas included specimens which have two demibranchs and symbiotic bacteria, whereas the clade composed of other genera, Adontorhina, Axinopsis, Axinulus, Leptaxinus, and Mendicula, included specimens which have one demibranch and no symbiotic bacteria. Taking the tree topologies, we assume parsimoniously that the ancestor of Thyasiridae has two demibranchs and symbiotic bacteria, and that the latter genera derived from the former genera. Two demibranchs may be advantageous for symbiosis by increasing the gill surface area where chemoautotrophic bacteria dwell and absorb hydrogen sulfide.
Our phylogenetic analysis showed that T. kaireiae in the Japan Trench (5345 m depth) and Thyasira sp. off Hatsushima (855 - 1173 m depth) were very closely related with each other and might be the same species. If that is the case, this species can be only bivalves that inhabit deep sea with a range of over 4000 m depth.
Thyasira sarsi also indicated a discrepancy in phylogenetic positions between the 18S rRNA and COI trees. Thyasira sp. Fiji was closely related to M. hadalis in the 18S rRNA tree (
The “evolutionary stepping stone hypothesis” was supported by two lineages of Solemyidae. However, we could not draw explicit conclusions whether this hypothesis was refuted in the other lineages of Solemyidae and Thyasiridae owing to the lack of whale- bone specimens, especially in Thyasiridae. If the “evolutionary stepping stone hypothesis” is not supported, a new hypothesis is needed to explain their invasion and settlement in deep sea. Therefore, we propose the “Antarctica-origin hypothesis”. In this hypothesis, we assume that benthoses on the narrow continental shelf of the Antarctica are ejected from there and sunk into deep sea by expansion of the ice shelf, and survivors in the deep-sea environments expand their habitats from the Antarctic to worldwide deep sea. Shallow-sea residents around the Antarctica have been tolerable to low water temperature and all Solemyidae and some shallow-water Thyasiridae have already acquired symbiosis. Thus, symbiotic Solemyidae and Thyasiridae around the Antarctica need to acquire only tolerance to high hydrostatic pressure to invade deep- sea environments. The expansion of deep-sea organisms from the Antarctic deep sea to worldwide deep sea is supported by some studies. Held [
To dissolve the strategies of the organisms for invasion and adaptation to deep sea, we analyzed the nuclear 18S rRNA and mitochondrial COI genes of thyasirid and solemyid bivalves, which constitute chemosynthetic communities. In the most reliable 18S rRNA + COI tree of Solemyidae, Solemya formed a clade. Acharax formed a clade composed of three subgroups, two of which consisted of only deep-sea taxa. In the most reliable 18S rRNA + COI tree of Thyasiridae, Axinopsis and Mendicula (and probably Adontorhina, Axinulus, and Leptaxinus) formed a clade, whereas Thyasira and Maorithyas formed a paraphyletic group to the clade. The “evolutionary stepping stone hypothesis” was supported by the Solemya clade and one of the Acharax subgroups of Solemyidae, but seemingly was not in the other lineages of Solemyidae and Thyasiridae. Nevertheless, we have to be careful in drawing a conclusion (refutation against the hypothesis), because whale-bone specimens were not enough, especially in Thyasiridae. In the present study, we represented an outline in evolutionary relationships in the two families. However, the reliabilities of the trees were partly not high, the topologies were sometimes inconsistent between trees constructed by different methods, and some taxa presented highly divergent phylogenetic positions between the trees. These warrants further molecular phylogenetic analyses using more specimens, especially those obtained from organic falls, and using other genes to elucidate phylogenetic relationships and evolutionary history in Solemyidae and Thyasiridae. In addition, morphological investigations such as counting the number of ctenidial demibranchs, which could not be done in this study because of tininess and damages of thyasirid specimens, are necessary to know adaptive changes in the evolutionary process.
The authors would like to express their thanks to the operation teams of the submersibles and the officers and crew of the support vessels for their help in collecting the samples. The present study was supported in part by a grant from the Ministry of Education, Culture, Sports, Science and Technology of Japan (No. 25440204).
Fukasawa, Y., Matsumoto, H., Beppu, S., Fujiwara, Y., Kawato, M. and Miyazaki, J.-I. (2017) Molecular Phylogenetic Analysis of Chemosymbiotic Solemyidae and Thyasiridae. Open Journal of Marine Science, 7, 124-141. http://dx.doi.org/10.4236/ojms.2017.71010