The addition of p-coumaric acid ( pCA) to lignin molecules is frequently found in members of the grass family. The role of this addition is not clearly understood, but is thought to potentially aid in the formation of syringyl-type lignin. This is because the incorporation is as a conjugate of pCA ester linked to sinapyl alcohol, a major component of lignin. The forage legume alfalfa ( Medicago sativa L.) does not contain appreciable levels of pCA in its more heavily lignified stem tissues. The maize p-coumaryltransferase ( pCAT) gene was used to transform alfalfa to determine its impact upon lignin composition and its potential to alter cell wall digestibility. A constitutive expression vector using the cassava vein mosaic virus (CsVMV) promoter was used to drive expression of maize pCAT in alfalfa. Expression of the pCAT transgene was detected in both leaves and stems. Though there was a range of pCAconcentration in transformed alfalfa stems (0.2 - 1.79 micrograms (μg)), this was a clear increase over bound pCA in control stems (0.15 - 0.2 mean = 0.17 micrograms (μg)). This did not lead to consistent responses concerning total lignin in the stem tissues. Leaf tissue, on the other hand, already has a relatively high level of pCA (0.85 - 1.2, mean = 0.99 micrograms (μg)) and those expressing pCAT gene showed on average a small increase, but there is a wide range of values among the transformants (0.38 - 1.55, mean = 1.06 micrograms (μg)). Lignin in leaves did not appear to be significantly impacted. However, incorporation of pCA into the wall appears to cause a shift in lignin composition. Testing the pCAT expressing stem cell walls for digestibility using a rumen in vitro system showed there was no change in the digestibility of the stem compared to empty vectors and control alfalfa stems. Although expression of pCAT gene in alfalfa changes the amount of wall bound pCA, it does not appear to change lignin levels or impact digestibility.
Phenolic compounds are ubiquitous among higher-order plants, primarily existing as lignin, a polymer composed of the monolignols p-coumaroyl, coniferyl, and sinapyl alcohols [
It has been proposed the formation of p-coumaryl-sinapyl alcohol (pCA-SA) conjugates could aid in the incorporation of sinapyl alcohol into lignin resulting in what is referred to as syringyl-rich regions of lignin [
Following up on work identifying a p-coumaroyltransferase (pCAT) in corn led to isolation and characterization of this enzyme and ultimately the identification of the putative gene for pCAT. An RNAi construct of the gene was produced and used to genetically modify corn. To test the hypothesis that pCA-SA could alter lignin composition, the gene was inserted and expressed in Medicago sativa L. Would this lead to an accumulation of pCA in Medicago cell walls and would this influence digestibility?
Alfalfa was grown in the greenhouse (under high pressure sodium lamps, 14/10 day/ night regime, 25˚C - 35˚C). Plants were harvested at the late bud to early flower stage of development, frozen in liquid nitrogen, and stored in a −80˚C freezer until analyzed. Leaves and stems were stored separately.
The maize pCATcDNA expression vector was generated using Gateway® LR Clonase™ II enzyme mix (Life Technologies) as previously described [
Leaf genomic DNA (gDNA) was isolated based on the procedure of Rancour et al. [
ID | Name | Sequence | Description |
---|---|---|---|
RH123 | ZmpCAT_Roche_Forward 1 | gaccaccccatgctcatc | For qRT-PCR |
RH124 | ZmpCAT_Roche_Reverse 1 | aactccgtcacctgcatcat | For qRT-PCR |
RH197 | NptII_Forward | gatggattgcacgcaggttctc | Screen for NptII selection marker |
RH198 | NptII_Reverse | ctcttcagcaatatcacgggtag | Screen for NptII selection marker |
MS152 | NADH-dependent Glutamate Synthase_for | cctggccgcttctatgtcacc | Forward control primer for alfalfa gDNA |
MS153 | NADH-dependent Glutamate Synthase_rev | caagccaatctccgtacggtc | Reverse control primer for alfalfa gDNA |
MS786 | MsActin2_Forward | accatcaatgatcggaatgg | For qRT-PCR |
MS787 | MsActin2_Reverse | atgatagagttgtaggtggtctcgt | For qRT-PCR |
DNA-free total RNA was isolated from 2 5 -50 mg of frozen-ground alfalfa leaf or stem tissue using the Spectrum™ Plant Total RNA kit (Sigma-Aldrich, St. Louis, MO) according to manufacturer’s protocol A supplemented with an on-column DNAse treatment. Total RNA yields and purity were calculated after spectrophotometer absorbance measurements at 260, 280 and 320 nm. First strand cDNA synthesis was performed using 1 µg total RNA and the Go Script™ Reverse Transcription System (Promega, Madison, WI) with a poly-T primer as before [
pCAT primer design for quantitative real-time PCR was performed with the Roche Universal Probe Library Assay Design Center
(www.roche-appliedscience.com/webapp/wcs/stores/servlet/CategoryDisplay?catalogId=10001&tab=Assay+Design+Center&identifier=Universal+Probe+Library&langId=-1) (site link as of Sept. 10, 2013) online software using default parameters resulting in primers RH123 and RH124. Primer sequences MS786 and MS787 for Medicago sativa actin, a gene expression control, were from Verdonk and Sullivan [
(http://www.hartfaalcentrum.nl/index.php?main=files&sub=LinRegPCR). N0 values for individual reactions run in triplicate were determined and used to calculate relative expression ratios and standard deviations for pCAT to MsActin expression for the indicated plant organ and plant line.
One-way ANOVA with a post hoc Tukey test was performed using GraphPad Prism software (version 5.0f). An alpha value of 0.05 was used for all analysis.
An abbreviated method of cell wall extraction [
Acetyl bromide lignin determination was performed according to [
Cell wall ester-and ether-linked phenolic moieties were determined using the sequential analysis as described [
Alfalfa isolated cell walls were analyzed using the gel-state 2D NMR spectral analysis technique of Hoon and Ralph [
Alfalfa stem digestibility was measured using the gas pressure method described by Weimer et al. [
Gas production data were fit using PROC NLIN in SAS v9.2 to the first-order kinetic model
Equation 1:
where V = cumulative mL of gas (g of digestible organic matter)−1;
A= asymptotic mL maximal gas production (g of digestible organic matter)−1;
k= first-order rate constant; and
For all incubations, the model fit yielded a value for L that approximated zero (≤10−8), and the model equation reduced to Equation 2:
After completion of each 96 hour digestion samples were analyzed for total VFA production by HPLC [
To address the functional role of pCA in plant cell walls, we chose to stably express the maize p-coumaroyl-CoA: hydroxycinnamyl alcohol transferase in alfalfa (Medicago sativa), an agronomically important crop plant that lacks lignin-associated endogenous ester-linked pCA. In principle, this experimental system can be viewed as a gain-of- function model system. pCAT transgene expression was mediated by the cassava vein mosaic virus (CsVMV) transcription promoter [
To assess the efficacy of our expression construct, the levels of pCAT gene expression were determined using real time PCR. Organ-and plant line-specific first-strand c- DNAs were generated and used as inputs. Expression of the pCAT transgene was evaluated relative to endogenous Medicago sativa actin (MsActin) expression. Using LinRegPCR software [
Relative expression of the pCAT transgene was detected in both leaves (
and stems, where as 190-2-H1, 190-5-A6, and 190-1-D5 had low levels of expression. The line 190-5-B7 exhibited a unique expression pattern where pCAT expression was detected in stems but not in leaves. The cause of this alteration was not further investigated. In summary, we were able to generate numerous transgenic alfalfa lines with broad ranging expression levels of the maize pCAT gene.
Alfalfa plant stems and leaves were analyzed separately for major cell wall components. Of particular interest was the impact upon pCA and lignin within cell walls of leaf and stem tissues. Within the stem cell wall fraction pCA was detectable at a background level of approximately 0.2 g·kg−1 CW. Variable levels of corn pCAT gene expression resulted in a wide variation in pCA incorporation into stem CW. Additional pCA incorporation above background varied from zero to nine times the background resulting in a significant increase in the ester linked pCA in stems compared to control
plants (
Alfalfa leaf material on the other hand already contains relatively higher levels of pCA compared to the stems. It is not clear whether this pCA is ester linked to lignin or carbohydrates. Analysis of whole cell wall material by NMR [
This may not be too surprising because lignin levels are typically lower in leaf tissues compared to stems especially when considering the leaf tissue minus the midrib. Therefore the metabolic processes producing the monolignols will be less active than in the stems, i.e., limiting the supply of sinapyl alcohol, the preferred acceptor for the pCAT [
be through a similar mechanism as the transferase genes and expressed enzymes seen in grasses.
Lignin concentrations in the alfalfa stems and leaves were variable both in the empty vector controls and the gene expression lines (
In the stem tissue there did not appear to be any appreciable change in lignin composition (
The gene is being expressed in the leaf tissues (
leaves with a limited formation of monolignols sinapyl alcohol may become limiting. This assumes the conjugate is not ending up in lignin at least in large quantities.
We selected some of the stem tissues that showed changes in pCA content to test with an in vitro rumen fluid digestion assay. Total digestibility was measured as cumulative amount of gas produced over the 96 hours (
Plant tissue | Vector | S | G | H |
---|---|---|---|---|
Leaf | Empty | 0.52 | 1 | 6.37 |
Leaf | pCAT | 0.37 | 1 | 4.82 |
Stem | Empty | 1.01 | 1 | 0.37 |
Stem | pCAT | 1.02 | 1 | 0.35 |
Sample | A | A (S.E.) | k h−1 | kh−1 S.E. |
---|---|---|---|---|
mL gas g−1 | mL gas g−1 | |||
188-C1 | 212.5 | 4.77 | 0.1412 | 0.0104 |
190-1-C9 | 208.0 | 4.52 | 0.1363 | 0.0095 |
190-1-E1 | 317.2 | 11.52 | 0.1010 | 0.0099 |
190-2-A1 | 209.1 | 7.49 | 0.1262 | 0.0139 |
190-2-B7 | 186.9 | 5.64 | 0.1162 | 0.0103 |
190-2-B16 | 251.3 | 10.73 | 0.1151 | 0.0143 |
190-2-E2 | 276.0 | 10.19 | 0.1269 | 0.0145 |
190-2-E6 | 298.8 | 8.07 | 0.1088 | 0.0083 |
190-3-B7 | 251.7 | 6.57 | 0.1158 | 0.0089 |
190-3-B8 | 186.2 | 4.21 | 0.1388 | 0.0102 |
190-3-F1 | 283.2 | 13.37 | 0.1021 | 0.0131 |
190-3-H1 | 297.8 | 11.22 | 0.1115 | 0.0120 |
190-3-H7 | 254.8 | 10.86 | 0.1019 | 0.0118 |
190-4-B2 | 326.3 | 10.96 | 0.1055 | 0.0098 |
190-4-C5 | 287.4 | 11.40 | 0.1128 | 0.0129 |
190-5-C3 | 344.4 | 14.05 | 0.1035 | 0.0116 |
190-6-H1 | 312.1 | 12.78 | 0.1061 | 0.0121 |
191-1-G1 | 284.8 | 6.48 | 0.1345 | 0.0112 |
191-2-D9 | 287.8 | 11.47 | 0.1164 | 0.0136 |
191-3-C3 | 308.5 | 12.53 | 0.1119 | 0.0130 |
191-4-A12 | 242.2 | 10.81 | 0.1313 | 0.0184 |
volatile fatty acid (VFA) production and total alkyl groups in the VFA (a measure of energy content) at the 96 h fermentation end point (
Results averaged over four different replicate runs indicated there was no difference in any of these fermentation metrics between those expressing pCAT, and empty vectors as alfalfa control samples. This may indicate that pCA incorporation into the cell wall has no impact upon cell wall organization. Alternatively the changes induced within the plants by the addition of pCA conjugates were not sufficient to cause changes in cell wall structure and function, e.g., digestibility or that pCA-sinapyl alcohol conjugates do not influence total cell wall digestibility.
Modification of alfalfa by insertion of the maize pCAT gene resulted in increased amounts of p-coumarates in the cell walls. The pCAT gene expression levels were simi-
Sample | Total VFA | Total Alkyl carbona |
---|---|---|
Net mmoles g−1 alfalfa | Net mmoles g−1 alfalfa | |
188-C1 | 7.010 | 10.094 |
190-1-C9 | 5.772 | 8.245 |
190-1-E1 | 7.646 | 11.675 |
190-2-A1 | 5.395 | 7.354 |
190-2-B7 | 5.376 | 7.532 |
190-2-B16 | 5.664 | 8.299 |
190-2-E2 | 7.321 | 11.063 |
190-2-E6 | 5.995 | 8.654 |
190-3-B7 | 6.219 | 8.964 |
190-3-B8 | 7.067 | 10.380 |
190-3-F1 | 6.119 | 8.812 |
190-3-H1 | 6.073 | 9.131 |
190-3-H7 | 6.861 | 10.011 |
190-4-B2 | 9.326 | 14.351 |
190-4-C5 | 8.588 | 13.134 |
190-5-C3 | 8.747 | 13.558 |
190-6-H1 | 6.318 | 9.442 |
191-1-G1 | 7.068 | 10.823 |
191-2-D9 | 6.549 | 9.943 |
191-3-C3 | 6.819 | 10.394 |
191-4-A12 | 5.670 | 8.146 |
aTotal alkyl, a measure of energy content of the VFA products, is the sum of methyl and methylene groups in carboxylic acids. Mmol total alkyl was calculated from mmol of individual VFA as Acetate + (2 × Propionate) + (3 × [Butyrate + Isobutyrate]) + (4 × [Valerate + Isovalerate + 2 − Methylbutyrate]) [
lar between leaves and stems resulting in similar levels of p-coumartes. However, the leaves before transformation contain relatively high levels of pCA compared to stems. Actual increases in pCA were much more pronounced in the stem cell walls with increases as high as 8 to 9 times higher than the empty vector controls. Accumulation of pCA over empty vector controls in leaves was restricted to 20% to 60% increase in those plants that increased in pCA levels. The large changes in cell wall pCA in stems did not lead to changes in lignin accumulation or a detectable shift in composition. This change in stem pCA did not result in a change in cell wall digestibility. It is possible that even though there were changes in stem associated pCA, it was not sufficient to disrupt the normal lignification process and alter digestibility.
Marita, J.M., Rancour, D., Hatfield, R. and Weimer, P. (2016) Impact of Expressing p-Coumaryl Transferase in Medicago sativa L. on Cell Wall Che- mistry and Digestibility. American Journal of Plant Sciences, 7, 2553-2569. http://dx.doi.org/10.4236/ajps.2016.717221