Agarwood is studied as the resinous secondary metabolites produced by the natural microbial infection. The current study investigated the range of microbial infection in agarwood trees collected from various parts of India. A total of 17 isolates were collected and identified based on the morphological and molecular studies. The study revealed that the agarwood was naturally infected with Aspergillus , Lasiodiploidia , Chaetomium, Fusarium and Penicillium species. Further studies on enzyme activities involved in the pathogenesis process showed the higher cellulase, ligninolytic and laccase activities in Aspergillus isolate AR13 when compared to other isolates. The current study has offered a potential opportunity to further strengthen the research on possible development of microbial strains for artificial inoculation in agar trees to induce agarwood formation.
Agarwood is a resinous substance occurring in Aquilaria trees of Thymelaeceae family that is found in the foothills of Himalayas to the rain forests of Papua New Guinea. The tree has the unique feature of producing resin- impregnated heartwood which is fragrant and economically highly valued depending on the oleoresin content of the wood. The wood is used to manufacture some of the medicines, incense and perfumes across Asia and Europe. The agarwood is reputed to be the most expensive wood in the world and in the consumer countries it ranged from a few dollars per kg for low quality material to more than US$30,000 per kg of top quality wood [
The infected agarwood samples were collected from Dibrugarh, Hojai and Rain Forest Research Institute, Jorhat of Assam State and Sarkkapathi, Aliyar Nagar of Tamil Nadu State and Kumily, Idukki District of Kerala State in India. The wood samples were chipped into 1 cm2 and used for the isolation of fungal microorganisms. The cut chips were surface sterilized in 0.1% mercury chloride for 30 Sec and rinsed in sterile distilled water for three times and placed on PDA medium prepared in Petri dishes and incubated at room temperature (26˚C ± 2˚C) for 7 - 14 days. The fungal colonies appeared on PDA plates were sub-cultured and an axenic culture of the fungi was obtained by single hyphal tip technique and maintained in PDA slants to carry out further characterization studies.
The pure culture of individual fungi was observed for mycelial colour, texture and growth characters [
The estimation of cellulose degradation was carried out as described in Gajera et al., 2008 [
The activity of lignin modifying enzymes was detected by dye staining of lignin modifying basal medium (LBM) (KH2PO4: 1.00 g; Yeast Extract: 0.01 g; C4H12N2O6: 0.5 g; CuSO4∙5H2O: 0.001 g; MgSO4∙7H2O: 0.5 g; Fe(SO4)3: 0.001 g; CaCl2∙2H2O: 0.01 g per litre). LBM was supplemented with 1.6% w/v agar and autoclaved. To 100 ml of LBM, 1 ml of 20% aqueous glucose solution and 1 ml of 1% w/v aqueous tannic acid solution was added. After sterilization, the medium was transferred aseptically into the petri plates and used for the assessment of lignin degrading enzyme activity of the fungal isolates. Eight days old fungal culture was inoculated on LBM medium and the plates were incubated at 25˚C in darkness. The plates were examined regularly up to ten days. The lignin degrading enzyme activity was recorded based on the appearance of brown oxidation zones around the colony [
The fungal cultures were grown in Petri plates containing PDA. After eight days of inoculation, 10ml of sterile distilled water was added to each of the petri dishes and the mycelium was sufficiently wet. The mycelium from the petri dishes were transferred to conical flask and shaken well in orbital shaker at 120 RPM at 28˚C for about 4 hours. After that, it was transferred to 30 ml centrifuge tubes and centrifuged at 10,000 RPM for 10 min. The supernatant was used for the assay of laccase. There action mixture consisted of 3 ml acetate buffer, 1 ml guaiacol and 1 ml enzyme source. The blank sample was prepared using 1 ml of deionized distilled water instead of enzyme source. The mixture was incubated at 28˚C for 5 min and absorbance was read at 450 nm in UV spectrophotometer. Enzyme activity was expressed as International Units (IU), where 1 IU is defined as amount of enzyme required to oxidize 1 micromole of guaiacol per min. The laccase activity in Uml−1 is calculated from the extinction coefficient of guaiacol (6.39 M−1∙cm−1) at 450 nm by the formula:
where E∙A = Enzyme Activity (Uml−1), A = Absorbance at 450 nm, V = Total volume of reaction mixture (ml), v = enzyme volume (ml), t = Incubation time (min) and e = Extinction Coefficient (M−1∙cm−1) [
DNA was extracted from the mycelial mat of each strain grown on PDB for 7 days at 28˚C by CTAB method described by O’Donnel et al. [
The Internal Transcribed Spacers (ITS) primers ITS1 5’(TCCGTAGGTGAACCTGCGG)3’ as forward primer and ITS2 5’(GCTGCGTTCTTCATCGATGC)3’ as reverse primer were used for PCR amplification studies [
Of several isolates amplified, the PCR product from the fungal isolate AR13 was purified from reaction mixture by agarose (1.2%, w/v) gel electrophoresis in TBE buffer containing 0.5 μg of ethidium bromide per ml. A small agarose slice containing the band of interest (observed under long-wavelength [312-nm] UV light) was excised from the gel and purified by using a QIA quick gel extraction kit (Qiagen, Inc., Chatsworth, California) according to the supplier’s instructions. This purification was performed to remove primer dimers and other residues from the PCR amplification. PCR product was sequenced at Chromous Biotech Pvt. Ltd., Bangalore, India. PCR sequence was identified using the basic local alignment search tool and submitted in GenBank nucleotide data bank, National Center for Biotechnology Information, Bethesda, MD, USA (http://www.ncbi.nlm.nih.gov/) and accession number was obtained for the isolate AR13.
A total of 17 fungal cultures were isolated from agarwood infected samples collected from Dibrugarh, Hojai and Rain Forest Research Institute, Jorhat of Assam, Sarkkapathi, Aliyar Nagar, Tamil Nadu and Kumily, Idukki District of Kerala, India. Of these, 3 isolates were from Dibrugarh (DIB1, DIB2, DIB3) and 4 isolates from Jorhat (RFRI4, RFRI5, RFRI6, RFRI7) of Assam, 6 isolates from Tamil Nadu (AR10, AR11, AR12, AR13, AR14, AR15) and 4 isolates from Kerala (K1, K2, K3 and K4). The colony characters such as colour of the mycelia mat, texture, mycelia growth of individual fungal isolates were observed on PDA medium. The mycelium and conidial characters of the individual fungal isolates were examined under microscope. The observations on colony characters and conidial characters were aided in tentative identification of the fungal cultures (
A significantly higher activity of cellulase was measured in Aspergillus isolate AR13 (1181.952 μmole∙L−1∙min) isolated from Aliyar Nagar of Tamil Nadu followed by Aspergillus isolate K1 (1140.608 μmole∙L−1∙min) whereas the lesser activity was observed in Chaetomium isolate K4 (449.92 μmole∙L−1∙min) (
Laccase activity of fungal isolates revealed the higher secretion of laccase enzyme by Aspergillus isolates K1 (18.116 Uml−1) and AR13 (17.125 Uml−1). These two isolates showed significantly greater activity of laccase production when compared to the other isolates of agarwood fungi (
The results of lignin degradation in LME medium supplemented with tannic acid showed brown layer as indicator of positive reaction for lignin degradation. Of seventeen isolates, Aspergillus isolates AR13 and K1 showed stronger ligninolytic activity. The isolates of Fusarium DIB2, RFRI7 showed the medium activity whereas less activity was observed in Lasiodiploidia DIB3, Chaetomium AR11 and Aspergillus K1 (
Out of 17 isolates used in the PCR studies, the isolates RFRI4 (Lasiodiploidia sp.), AR10 (Chaetomium sp.), AR11 (Chaetomium sp.), AR14 (Penicillium sp.) and AR13 and K3 (Aspergillus sp.) have amplified ITS1 and ITS2 primers. The DNA gel electrophoresis showed that the amplified products were around 560 bp. Of this, the PCR product amplified from the isolate AR13 (Aspergillus sp.) was purified and sequenced (
S. No | Isolates | Colony and growth characters on PDA | Characters after 5 days of culturing | Tentative identification of fungal isolates | Colony diameter 5 days after culturing (cm) |
---|---|---|---|---|---|
1 | DIB1 | White/fluffy, spreading peripheral part, pinkish central part | Ash colour | Fusarium sp. | 4.0 |
2 | DIB2 | White/fluffy, spreading peripheral part, pinkish central part | Colourless | Fusarium sp. | 3.5 |
3 | DIB3 | Black, fluffy with abundant aerial mycelium | Black | Lasiodiploidea sp. | 4.0 |
4 | RFRI4 | Black, fluffy with abundant aerial mycelium | Black | Lasiodiploidea sp. | 1.5 |
5 | RFRI5 | White/fluffy, spreading peripheral part, pinkish central part | Colourless | Fusarium sp. | 3.5 |
6 | RFRI6 | White/fluffy, spreading peripheral part, pinkish central part | Colourless | Fusarium sp. | 1.0 |
7 | RFRI7 | White/fluffy, spreading peripheral part, pinkish central part | Colourless | Fusarium sp. | 1.5 |
8 | AR10 | Light Yellow | Dark brown | Chaetomium sp. | 3.5 |
9 | AR11 | White cottony with black center | Dark brown | Chaetomium sp. | 2.0 |
10 | AR12 | Black, fluffy with abundant aerial mycelium | Black | Lasiodiploidea sp. | 4.0 |
11 | AR13 | Large & thick black head Colonies | Yellow | Aspergillus sp. | Colonies |
12 | AR14 | Blue-green or ash/flaky colonies | Orange to red, wrinkled | Penicillium sp. | Colonies |
13 | AR15 | White cottony with black center | Dark brown | Chaetomium sp. | 6.0 |
14 | K1 | Large & thick black head Colonies | Yellow | Aspergillus sp. | Colonies |
15 | K2 | Black, fluffy with abundant aerial mycelium | Black | Lasiodiploidea sp. | 5.0 |
16 | K3 | Large & thick black head colonies | Yellow | Aspergillus sp. | Colonies |
17 | K4 | Black, fluffy with abundant aerial mycelium | Black | Lasiodiploidea sp. | 3.5 |
Fungal isolates | Cellulase activity1 | Laccase activity2 | Ligninolytic activity | |||
---|---|---|---|---|---|---|
OD at 540 nm | μmole/L∙min | OD at 450 nm | μmole/L∙min | |||
Fusarium DIB1 | 0.115 | 556.92 | 0.244** | 15.59 | ++ | |
Fusarium DIB2 | 0.117 | 569.08 | 0.255** | 16.29 | ++ | |
Lasiodiploidea DIB3 | 0.162 | 785.53 | 0.204 | 13.00 | + | |
Lasiodiploidea RFRI4 | 0.136 | 659.07 | 0.245** | 15.65 | ++ | |
Fusarium RFRI5 | 0.094 | 457.21 | 0.236 | 15.08 | ++ | |
Fusarium RFRI6 | 0.145 | 702.84 | 0.218 | 13.89 | + | |
Fusarium RFRI7 | 0.189* | 919.29 | 0.262** | 16.71 | ++ | |
Chaetomium AR10 | 0.138 | 668.80 | 0.249** | 15.87 | ++ | |
Chaetomium AR11 | 0.136 | 659.07 | 0.219 | 13.96 | + | |
Lasiodiploidea AR12 | 0.204** | 989.82 | 0.194 | 12.39 | + | |
Aspergillus AR13 | 0.243** | 1181.95 | 0.268** | 17.12 | +++ | |
Penicillium AR14 | 0.163 | 790.40 | 0.225 | 14.34 | ++ | |
Chaetomium AR15 | 0.111 | 539.90 | 0.238 | 15.20 | ++ | |
Aspergillus K1 | 0.235** | 1140.60 | 0.284** | 18.11 | +++ | |
Lasiodiploidea K2 | 0.190** | 921.72 | 0.197 | 12.55 | + | |
Aspergillus K3 | 0.151 | 734.46 | 0.230 | 14.66 | ++ | |
Lasiodiploidea K4 | 0.093 | 449.92 | 0.220 | 14.02 | ++ | |
+++: Strong activity | ||||||
SEd | 0.017 | 0.004 | ++: Medium activity | |||
CD (0.05) | 0.036 | 0.007 | +: Low activity | |||
CD (0.01) | 0.050 | 0.010 | ||||
1Note: slope value = 7296. 2Note: Extinction coefficient for Guiacol 6.39. **Enzyme activity is significantly different from the other fungal microbes.
The current study identified the colonization of agarwood by Aspergillus, Penicillium, Fusarium, Lasiodiploidia and Chaetomium fungi. Previous studies have also showed that fungal species such as Aspergillus sp., Botryodiplodia sp. (Lasiodiplodia sp.), Diplodia sp., Fusarium bulbiferum, F. laterium, F. oxysporum, Penicillium sp., Pythium sp. and Trichoderma sp., could infect Aquilaria spp. [
From the current study, it is believed that the formation of agarwood could be a result of plant defense mechanism towards fungal attacks by producing resinous compounds as secondary metabolite [
Interestingly, two of our isolates from our collection i.e. Aspergillus and Lasiodiplodia were also reported as endophytic fungi in Mitra and Gogoi [
Muthuraj Sangareswari@Nagajothi,Kalappan Thangamuthu Parthiban,Subramani Umesh Kanna,Loganathan Karthiba,Duraisamy Saravanakumar, (2016) Fungal Microbes Associated with Agarwood Formation. American Journal of Plant Sciences,07,1445-1452. doi: 10.4236/ajps.2016.710138