Objective: To investigate the effects and mechanisms of p38 signaling pathway in pentagastrin-regulated cell proliferation of colorectal carcinoma cell line HT-29. Methods: HT-29 cell line of colorectal carcinoma was in vitro incubated and divided into the control group, pentagastrin group, proglumide group, and pentagastrin + proglumide group. MTT reduction assay was performed to detect the proliferation status of HT-29 cell line and determine the optimal dosage of pentagastrin and proglumide. Annexin V-fluorescein isothiocyanate flow cytometry was used to detect the proliferation index (PI) and apoptosis rate (AR) of HT-29 cells. Reverse transcriptase polymerase chain reaction was performed to detect the mRNA expression of the pentagastrin receptor/cholecystokinin-B receptor (CCK-BR) and p38. The protein and phosphorylation levels of p38 were estimated by western blotting. Results: RT-PCR detection showed that CCK-BR mRNA was expressed in the HT-29 cell line. Pentagatrin improved HT-29 cell proliferation in dosage of 6.25 - 100 mg/L, and the optimal dosage of pentagastrin was 25.0 mg/L. Proglumide had no significant effect on the proliferation of HT-29 cells, but significantly inhibited the proliferation of HT-29 cells stimulated by pentagastrin when the dosage of proglumide was 8.0 - 128.0 mg/L, and the optimal dosage was 32.0 mg/L. The AR in the pentagastrin group was significantly lower than that in the control group and in the pentagastrin + proglumide group. The PI in the pentagastrin group was significantly higher than that in the control group and in the pentagastrin + proglumide group. P38 phosphorylation level in the pentagastrin group was significantly lower than that in the control group, and in the pentagastrin + proglumide group. There were no significant differences in the mRNA and protein expression of p38 in the control, pentagastrin, proglumide and pentagastrin + proglumide groups. Conclusion: Pentagastrin can improve proliferation of the CRC cell line HT-29 and inhibit apoptosis via the p38 signal transduction pathway. This mechanism may be associated with suppressed p38 protein phosphorylation level due to inhibition of proglumide, a gastrin receptor antagonist.
Colorectal carcinoma (CRC) is one of the most common malignant tumors of the human digestive tract, and is the second to third leading cause of gastrointestinal cancer-related mortality worldwide [
Previous studies have shown that the occurrence of CRC is directly related to the abnormal expression of gastrin [
Pentagastrin was purchased from Shanghai Tian Yuan Biotechnology Co., Ltd. (Shanghai, China). Proglumide and the propidium iodide staining kit were purchased from Sigma (St. Louis, MO, United States). P38 rabbit polyclonal anti-human antibody, phosphorylated p38 rabbit anti-human polyclonal antibody, b-actin antibody, and the ECL chromogenic detection kit were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, United States). The human CRC cell line HT-29 was purchased from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, China. The Annexin V-EGFP/PI apoptosis detection kit was purchased from Mbchem (Shanghai, China). The reverse transcription kit, SK312 Trizol reagent, Taq DNA polymerase, DNA marker, and dNTP were purchased from Promega (Madison, WI, United States). The gastrin receptor/CCK-BR, p38 and muscle b-actin mRNA amplification primers were synthesized by Beijing Sunbiotech Co., Ltd. (Beijing, China).
Cells were subcultured when the cells reached 80% confluence in Corning 50 cm cell culture flasks (Corning, Madison, WI, United States) containing 10% fetal calf serum in RPMI-1640. Resuscitated cells with a high cell density were subjected to timely passage, generally 2 - 3 d for a new generation. Cells in the logarithmic growth phase after digestion and centrifugation with removal of digestive fluid and culture medium underwent cryopreservation in a −70˚C liquid nitrogen tank for later use. The cells were divided into four groups: control group, pentagastrin group, proglumide group, and pentagastrin + proglumide group.
HT-29 cells in the logarithmic growth phase, were digested into a single cell suspension in 10% fetal bovine serum (FBS) medium, and the cell concentration was adjusted to 5 × 104 cells/mL. The cells were seeded in 96-well culture plates (each well contained 200 mL) and cultured for 24 h. The culture medium was discarded when the cells were adherent. After washing with D-Hank’s solution, serum-free medium was added and the cells were cultured for 24 h. FBS medium (100 mL, l%) was added to each well, along with 100 mL of each drug. In the pentagastrin group, the pentagastrin concentration was 6.25, 12.5, 25.0, 50.0 or 100.0 mg/L. In the proglumide group, the proglumide concentration was 8.0, 16.0, 32.0, 64.0 or 128.0 mg/L. In the pentagastrin + proglumide group, the pentagastrin concentration was 25.0 mg/L and the proglumide concentration was 8.0, 16.0, 32.0, 64.0 or 128.0 mg/L. No drugs were added to the control group. Each treatment group consisting of six wells was cultured for 48 h. For the MTT method, MTT (5 mg/mL) was added to each well of the 96-well plate, and incubated at 37˚C for 4 h. The culture medium was then discarded and 150 mL DMSO was added to each well, and the plate was then shaken for 10 min at room temperature. OD492 was measured by ELISA, and the results of the six wells in each group are presented as mean ± SD and the experiments were repeated three times.
Cells in the logarithmic growth phase were digested with 0.25% trypsin and adjusted to a concentration of 1.7 × 105 cells/mL in 10% FBS medium in six-well plates (2 mL/well). After 24 h, FBS medium was replaced with serum-free medium, and the cells were cultured for a further 24 h to absorb the supernatant. Then, 1 mL 1% FBS medium was added to each well, along with 1 mL of the following: pentagastrin group (25.0 mg/L pentagastrin); proglumide group (32.0 mg/L proglumide); pentagastrin + proglumide group (25.0 mg/L pentagastrin + 32.0 mg/L proglumide); control group (no drugs). Each group consisted of five wells, and the cells were cultured for 48 h. After digestion with 0.25% trypsin, the cells were centrifuged at 12,000 × g at 4˚C for 10 min, and the supernatant was discarded. One milliliter of cold PBS was added, and the cell suspension was gently shaken. The supernatant was discarded after centrifugation at 12,000 × g at 4˚C for 10 min. After washing twice with cold PBS, the cells were resuspended in 200 mL binding buffer, fixed with 1 mL 70% ethanol, DNA and protein stained, and the proportion and the PI of the cell cycle were determined by flow cytometry.
After 48 h incubation with or without drugs, the cells were collected from the control, pentagastrin (25.0 mg/L), proglumide (32.0 mg/L), and proglumide (25.0 mg/L) + pentagastrin (32.0 mg/L) groups, and adjusted to a concentration of 2 × 106/mL. One milliliter of cells was taken from each group, and centrifuged at 12,000 × g at 4˚C for 10 min, and the supernatant was discarded. One milliliter of cold PBS was added to resuspend the cells, which was then shaken gently. The cell suspension was centrifuged again at 12,000 × g at 4˚C for 10 min. The supernatant was removed, the cells were washed twice with cold PBS, and then resuspended in 200 mL binding buffer. We added 10 mL Annexin V-FITC and 5 mL propidium iodide, and mixed gently in the dark at room temperature for 15 min. Then, 300 mL binding buffer was added, and cell AR was determined one hour later.
Total RNA extraction and cDNA synthesis were performed as described previously [
The protein expression and phosphorylation level of p38 were detected by Western blotting. The specific steps were carried out according to the kit instructions. The primary antibody was diluted with Tris-buffered saline and Tween to a concentration of 1:500, and treated with electrophoresis, transfer film and ECL development. Gel Image System software was used to determine the average OD. The results were expressed as the relative ratios of the target gene expression, respectively, and b-actin expression.
Name | Primer sequence | PCR conditions | Size (bp) |
---|---|---|---|
CCK-BR | 1: 5’TCTCGCGAGCTCTACTTAGGG3’ | 94˚C, 30 s | 185 |
2: 5’ACCGACGATGCACGTTGAAG3’ | 62˚C, 30 s | ||
72˚C, 30 s | |||
P38 | 1: 5’GTGCCCGAGCGTTACCAGAA3’ | 94˚C, 30 s | 266 |
2: 5’GTGCCGAGCCAGTCCAAAATC3’ | 56˚C, 30 s | ||
72˚C, 30 s | |||
Actin | 1: 5’ATGATATCGCCGCGCTCGTCGTC3’ | 94˚C, 30 s | 342 |
2: 5’CGCGGTTGGCCTTGGGGTTCAG3’ | 60˚C, 30 s | ||
72˚C, 30 s |
PCR: Polymerase chain reaction; CCK-BR: Cholecystokinin-B receptor.
Statistical evaluation was performed using the Student-Newman-Keul Q test, and the data are shown as mean ± standard deviation (mean ± SD); all data were analyzed using SPSS 13.0 software. P < 0.05 was considered statistically significant.
The MTT assay showed that pentagastrin stimulated the proliferation of HT-29 cells and inhibited apoptosis in a dose-dependent manner (6.25 - 100 mg/L), and the optimal dose was 25 mg/L (P < 0.05). As the pentagastrin concentration continued to increase, OD did not increase. Proglumide had no obvious effect on HT-29 cell proliferation at a dose range of 8.0 - 128.0 mg/L (P > 0.05). However, proglumide markedly inhibited pentagastrin- induced proliferation of CRC cells when pentagastrin was at the optimal dose of 25 mg/L. When the proglumide concentration was 32.00 mg/L or greater, the active cell number in the pentagastrin + proglumide group tended to be constant and the optimal dose of proglumide was 32 mg/L (P < 0.05) (
The results showed that the PI in the pentagastrin group was significantly higher than that in the other experimental groups, while the AR was significantly decreased (P < 0.01). In the pentagastrin group, the PI was 37.5% ± 5.2%, which was significantly higher than that in the control (27.7% ± 5.0%) and pentagastrin + proglumide (27.3% ± 5.8%) groups (P < 0.05). In the proglumide group, the PI was 27.4% ± 2.7%, which did not differ significantly from the control group (P > 0.05). In the pentagastrin group, the AR was 1.9% ± 0.4%, which was significantly lower than that in the control (2.5% ± 0.4%) (P < 0.05) and pentagastrin + proglumide (2.4% ± 0.3%) (P < 0.05) groups. In the proglumide group, the AR was 2.8% ± 0.5%, which did not differ significantly from the control group (P > 0.05).
RT-PCR showed that CCK-BR mRNA was expressed in HT-29 cells. The amplification products of CCK-BR, p38 and b-actin mRNA were 185, 266 and 342 bp, respectively. There was no obvious change in the expression of p38 mRNA in the control, pentagastrin, proglumide and pentagastrin + proglumide groups (P > 0.05) (
Groups | n | Pentagastrin | Proglumide | ||
---|---|---|---|---|---|
Concentration (mg/L) | OD value | Concentration (mg/L) | OD value | ||
Control group | 6 | 0 | 0.44 ± 0.00 | 0 | 0.44 ± 0.02 |
Experimental group | 6 | 6.25 | 0.48 ± 0.03a | 8 | 0.43 ± 0.03 |
6 | 12.5 | 0.52 ± 0.03a | 16 | 0.44 ± 0.04 | |
6 | 25 | 0.57 ± 0.04a | 32 | 0.43 ± 0.03 | |
6 | 50 | 0.58 ± 0.04a | 64 | 0.45 ± 0.02 | |
6 | 100 | 0.57 ± 0.04a | 128 | 0.45 ± 0.04 |
aP < 0.05 vs control group. OD: optical density.
Groups | n | Pentagastrin + proglumide | ||
---|---|---|---|---|
Pentagastrin (mg/L) | Proglumide (mg/L) | OD value | ||
Control group | 6 | 25 | 0 | 0.58 ± 0.02 |
Experimental group | 6 | 25 | 8 | 0.54 ± 0.03a |
6 | 25 | 16 | 0.51 ± 0.04a | |
6 | 25 | 32 | 0.47 ± 0.04a | |
6 | 25 | 64 | 0.47 ± 0.03a | |
6 | 25 | 128 | 0.46 ± 0.03a |
aP < 0.05 vs control group. OD: optical density.
Group | n | p38 | ||
---|---|---|---|---|
mRNA | Protein | p-p38 | ||
Control group | 5 | 0.57 ± 0.04 | 0.88 ± 0.04 | 0.75 ± 0.06 |
Pentagastrin group | 5 | 0.58 ± 0.04 | 0.83 ± 0.06 | 0.64 ± 0.05a |
Proglumide group | 5 | 0.56 ± 0.05 | 0.84 ± 0.05 | 0.76 ± 0.06c |
Pentagastrin + proglumide group | 5 | 0.58 ± 0.05 | 0.87 ± 0.05 | 0.81 ± 0.05c |
aP < 0.05 vs control group; cP < 0.05 vs pentagastrin group.
Following incubation of HT-29 cells with the drugs for 72 h, p38 phosphorylation level in the pentagastrin group was 0.64% ± 0.05%, which was significantly lower than that in the control group (0.75% ± 0.06%) (P < 0.05), and the pentagastrin + proglumide group (0.81% ± 0.05%) (P < 0.05). There were no significant differences in the protein expression of p38 among the control (0.88% ± 0.04%), pentagastrin (0.83% ± 0.06%), proglumide (0.84% ± 0.05%) and pentagastrin + proglumide groups (0.87% ± 0.05%) (P > 0.05). There was no significant difference in the protein phosphorylation level of p38 between the proglumide (32 mg/L) and control groups (P > 0.05) (
Gastrin was discovered as early as 1905 in the extracts of gastric antral mucosa and is associated with gastric acid secretion. In 1964, it was isolated and identified by Gregory and Tracy who determined its chemical structure and confirmed it as a gastrointestinal hormone [
The results of the present study show that the concentration gradient of gastrin within a certain dose range promoted HT-29 cell proliferation and inhibited apoptosis. As the concentration increased from 25 mg/L, proliferation did not continue to increase, which was consistent with the receptor saturation theory. It was clear that the number of gastrin receptors and their affinity determined the strength of the effects on CRC cells. We also found that gastrin promoted the proliferation of HT-29 cells and inhibited apoptosis by accelerating the S and G2 phases of the cell cycle. The gastrin-promoted CRC cell proliferation and inhibition of apoptosis were inhibited by the gastrin receptor antagonist proglumide. In addition, our study also showed that there was no significant impact on the CRC cell cycle when only proglumide was added. When pentagastrin was combined with proglumide, PI decreased and AR increased, although these did not differ significantly from the control group. Proglumide markedly inhibited pentagastrin-induced proliferation of large intestinal cancer cells in a dose-de- pendent manner within a certain range, and the optimal dose was 32 mg/L, which is also in line with the receptor saturation theory. Gastrin can promote cell proliferation in human CRC and inhibit apoptosis [
In recent years, gene chip technology has been used to detect CRC-related gene expression. Studies have shown that many CRC-related genes are closely associated with the activation and inhibition of signal transduction pathways in many internal and external networks, and are directly involved in cell proliferation, differentiation and apoptosis [
In summary, gastrin promotes the proliferation of human CRC HT-29 cells and inhibits apoptosis, but these effects are inhibited by the gastrin receptor antagonist proglumide. The p38-MAPK signaling transduction pathway is involved in gastrin-regulated proliferation and apoptosis of CRC cells. However, which target genes are involved in this mechanism under the downstream signaling transduction pathway requires in-depth study. In addition, we expect to identify a new treatment strategy for gastrin-dependent CRC if we can competitively inhibit the gastrin receptors or increase the p38 phosphorylation levels of the p38-MAPK signaling pathway.
This study was supported by the Natural Science Foundation of Anhui Province (1408085MH148) and Talent Introduction Science Fund of Yijishan Hospital (YR201406), and Natural Science Fund of Wannan Medical College (WK2012zf02).
Jiading Mao,Pei Wu,Jian Wu,Liang Tao,Ping Wu,Guang Yang,Wenwen Guo,Jun Wang, (2016) Role of p38 Signaling Pathway in Pentagastrin-Regulated Cell Proliferation of Colorectal Carcinoma Cell Line HT-29. Journal of Cancer Therapy,07,378-387. doi: 10.4236/jct.2016.76041