In the present study, we illustrate the strategy and protocol required to generate rice transgenics over-expressing the 21-nt form of Osa-miR820. The miR exists in two size variants of 21-nt and 24-nt so the natural precursor cannot be employed for the purpose of miR over-expression as the cellular machinery can process both size variants thereby masking the role of PTGS regulation. Hence, we adopted the artificial miR technology to specifically over-express the 21-nt species in the transgenics. During the course of experiments it was observed that the amiR constructs probably interfered with the regeneration of the transformed callus, necessitating protocol modifications. The results indicate the successful over-expression of the 21-nt miR species. These plants can serve as a useful source for the functional dissection of the role played by the 21-nt Osa-miR820 species. They will also be valuable in highlighting the importance for the existence of a dual mode of miR mediated target regulation.
Understanding the genetic framework of plants is an essential prerequisite for developing durable crop cultivars. This is highly recommended to meet the challenges of changing climatic conditions and for achieving the increasing demand for food and other products. Plant transformation is an important tool to understand the fundamental aspects of various genes and their functional roles in plants. This information can then be utilized to generate better crop varieties or can be translated for any other commercial purposes. The Agrobacterium mediated transformation is the method of choice in most cases due to certain inherent advantages such as its high transformation efficiency, low copy T-DNA integration and ability to transfer large DNA segments with minimal transgene rearrangement [
Rice is one of the most important cereal crops, feeding more than half of the world population. Despite being an essential part of the rural economy in Asia, rice is a sensitive crop as its yield is affected by abiotic stresses such as salinity, high temperature, drought, submergence or biotic stresses exerted by its various pathogens and pests. Rice transformation is a challenging task as it is comparatively less amenable to genetic manipulation, especially the indica cultivars [
The microRNAs (miRs) represent a class of 21- to 24-nt endogenously transcribed small RNAs, which do not code for proteins. They are transcribed as long primary miR (pri-miR) transcripts by RNA polymerase II [
One such study described the identification of a rice specific miR, Osa-miR820 from undifferentiated embryogenic callus tissues [
In the present study, we illustrate the strategy and protocol required to generate rice transgenics over-express- ing the 21-nt form of Osa-miR820. These plants can serve as a useful source for the functional dissection of the role played by the 21-nt Osa-miR820 species. They will also be valuable in highlighting the importance for the existence of a dual mode of miR mediated target regulation. The natural precursor cannot be employed for the purpose of miR over-expression as it can be processed by the cellular machinery to produce both size variants, thereby masking the role of PTGS (Post Transcriptional Gene Regulation) regulation. Hence, we adopted the artificial miR technology to specifically over-express the 21-nt species in the transgenics. During the course of experiments it was observed that the amiR constructs probably interfered with the regeneration of the transformed callus, necessitating protocol modifications.
Seeds of Pusa Basmati 1 (PB1) rice were used in this study. Mature dehusked seeds were surface sterilized by treating with 70% ethanol for 1 min followed by 10% sodium hypochlorite with a drop of Tween-20 for 30 minutes with constant slow agitation. The seeds are thoroughly washed repeatedly with sterile distilled water and then blot dry for subsequent use. For agroinfiltration assay, Nicotiana tabacum L. cv. Xanthi leaves from a young plant were selected.
The conserved stem-loop backbone of Osa-miR528 in the amiR vector, pNW55, was used to generate the artificial pre-miR820. The primers (
Cloning of amiR820 into Agrobacterium tumefaciens binary vector, pCAMBIA1300 was accomplished in three steps. In the first step the amplified PCR product of 286 bp was cloned into plant expression vector pRT101, using EcoRI and BamHI sites for directional cloning, under CaMV-35S promoter. The positive colonies were subsequently confirmed by double digestion with EcoRI/BamHI. The whole cassette was excised out from pRT101-amiR820 by restriction digestion with HindIII and transformed into pCAMBIA1300 binary vector using the same restriction enzyme. The recombinant pCAMBIA1300-amiR820 was confirmed by PCR and restriction digestion. The plasmid was transformed into Agrobacterium tumefaciens strain EHA105 and LBA4404 and positive colonies were screened and selected for rice transformation.
Agrobacterium-strain containing the binary plasmid construct, pCAMBIA1300-amiR820, was checked for its functional performance in Nicotiana tabacum L. cv. Xanthi leaves. The agroinfiltration was achieved through pressure infiltration, as described previously [
Primer Name | Sequence (5’-3’) |
---|---|
GFwd | CCGGAATTCCGGCAGCAGCAGCCACAGCAAA |
GRev | CGCGGATCCGCGGCTGCTGATGCTGATGCCAT |
Mir sense strand | AGTCGGCCTCGTGGATGGACCAGCAGGAGATTCAGTTTGA |
Mir antisense strand | TGCTGGTCCATCCACGAGGCCGACTGCTGCTGCTACAGCC |
Mir*sense | CTCTGGTGCATGCACGAGGCCGATTCCTGCTGCTAGGCTG |
Mir*antisense | AATCGGCCTCGTGCATGCACCAGAGAGAGGCAAAAGTGAA |
G4368 | CTGCAAGGCGATTAAGTTGGGTAACG |
G4369 | GCGGATAACAAT TTCACACAGGAAACAG |
pRTFwd | CAGGTCAACATGGTGGAGCA |
pRTRev | GTCACTGGATTTTGGTTTTAGG |
SLP820 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGGTC |
820-Fwd | TCGGCCTCGTGGATGG |
820-Rev | GTGCAGGGTCCGAGGT |
Hyg-Fwd | TTCAGCTTCGATGTAGGAGG |
Hyg-Rev | AGAAGAAGATGTTGGCGACC |
18S_Fwd | CTACGTCCCTGCCCTTTGTACA |
18S_Rev | ACACTTCACCGGACCATTCAA |
fugation and re-suspended in MMA medium (MS salts, 10 mM MES, pH 5.6, 200 µM acetosyringone). The cells were incubated for at least 1 h at 28˚C and subsequently, diluted in MES buffer to get a OD600 of about 0.3 - 0.4. The homogenous culture mixture was infiltrated in the young leaves with the help of needleless syringe by generating a vacuum with the help of finger on the dorsal side of the leaf and mouth of the syringe on the ventral side. After 3, 5, 7 and 10 days post infiltration (dpi) the infiltrated zone was analyzed for miR820 expression.
Total RNA was extracted from infiltrated leaves using the modified Guanidium isothiocyanate extraction method [
Genomic DNA was extracted from young leaves of putative transgenic and wild type plants using the CTAB based extraction method [
20 µg of genomic DNA from PCR-positive rice lines was digested with KpnI, run on 0.8% agarose gel and blotted on HybondN+ membranes (Amersham Pharmacia). Non-radioactive DIG-labelled 445 bp of hygromycin gene was used as a probe and the experiment was performed as per manufacturer’s guide (Roche, Life Sciences, USA). Hybridization was performed at 62˚C for 12 hours and after washing it was imaged on an X-ray film using standard procedures.
Surface-sterilized seeds of rice cultivar Pusa Basmati 1 (PB1) were dried on autoclaved Whatman paper and incubated on callus induction media (CIM) in dark at 25˚C - 28˚C. The CIM favoured the development of the scutellar region into a highly regenerative calli within a period of 3 weeks. The calli were excised and sub-cul- tured onto fresh CIM in dark for 7 days.
For co-infection, the sub-cultured calli were immersed in the Agrobacterium suspension for 35 minutes with continuous slow shaking. After infection, calli were blot dried on sterile filter papers and then were incubated on filter paper moistened with co-cultivation medium (CCM) at 26˚C - 28˚C for two days, in dark. After co-culti- vation, the calli were washed with autoclaved distilled water twice for 30 min each containing both carbenicillin and cefotaxime (250 mg/ml each). In order to dilute the toxic effect of antibiotics, final wash was given by N6 liquid media (without any sugar) for 5 - 7 minutes and then it was kept on resting media (RM) for 7-10 days so that it regains the proliferating capacity.
Thereafter, the calli were washed and dried on sterile filter papers and cultured on callus selection medium (CSM) in dark for selecting transgenic calli. After first round of selection for 20 days, brownish or black colored calli were discarded and white calli were transferred to fresh CSM medium for second selection cycle for 15 days. This step allowed the proliferation of micro calli and when micro calli started growing on the mother calli, each micro callus was gently separated from the mother calli and transferred to fresh CSM medium for the third selection for 15 days. Healthy calli were selected for regeneration.
After the third selection, healthy calli were transferred to the specific regeneration medium (RM1-4) and incubated in dark in culture room for 7 days. After which they were transferred to fresh regeneration medium and incubated at 26˚C - 28˚C under light. After 1 - 2 weeks, green buds were seen arising from the calli. The green buds developed into shoots and were transferred to rooting medium (RoM) in presence of hygromycin (50 mg/l) under light for 20 days. The whole plants were transferred to vermiculite pots before being transferred to the soil pots and grown in the green house.
The CIM, CCM, CSM and RoM media compositions used are detailed below. These were adapted from Sahoo, et al. 2011 [
CIM: MS salts with Vitamin B5 + 30 g/l sucrose + 0.3 g casein hydrolysate + 2.0 mg/l 2,4-D + 0.5 g proline + 0.3% phytagel, pH 5.8;
CCM: Liquid N6 media + 3 mg/ml 2,4-D + 100 µM acetosyringone, pH 5.2;
RM: CIM with no antibiotic selection;
CSM: CIM + 250 cefotaxime + 50 mg/l hygromycin;
RM1: MS salts with Vitamin B5 + 500 mg proline + 0.3 g casein hydrolysate + 30 g/l sorbitol + 1.0 mg/l BAP + 2.0 mg/l Kinetin + 0.5 mg/l NAA, pH 5.8;
RoM: MS salts with Vitamin B5 + 30 g sucrose + 3g/l phytagel, pH 5.8.
Artificial miRs (amiRs) are exclusively engineered pre-miR molecules which can produce the desired mature miR sequences when expressed in vivo. The amiRs have been widely used in directed gene silencing technology to specifically suppress the expression of target mRNAs in wide variety of plants [
To confirm whether the amiR820 construct was processing the correct 21-nt mature miR an in planta assay was performed by agroinfiltrating the pCAMBIA1300-amiR820 construct in tobacco leaves (
Agrobacterium mediated transformation of callus is the preferred method for stable transformation of genes in rice [
Both EHA105 and LBA4404 Agrobacterium-strains were used for evaluating the transformation efficiency, but a greater number of positive transformants were obtained with LBA4404 as compared to EHA105. It was ob-
served that EHA105 being a super virulent strain [
Co-cultivation of Agrobacteria with the callus helps for better penetration of the adhered bacterium inside the totipotent cells. Phenolic compounds such as acetosyringone are known to induce greater Agrobacterium infection into the callus [
Regeneration of callus into “green mass” which has the capacity to develop into shootlets and plantlets is another criticial step in rice plant transformation. It is significant to point here that though several excellent protocols are available for regeneration from rice callus, but the frequency of regenerants varies drastically. This indicates that regeneration frequency is dependent on multiple factors such as genotype, type of explants, concentration of growth regulators and presence of osmolytes. The nature of construct that is used for transformation also influences regeneration potential of the callus [
A careful analysis of the targets of Osa-miR820 using psRNA target finder identified a putative NAC domain protein 77 as a potential target [
The modified protocol supported the development of green callus in 7 days for the pCAMBIA1300-amiR820 constructs as compared to 4 - 5 days for the wild type and pCAMBIA1300 vector constructs. The subsequent shoot formation was delayed by around 3 days for the pCAMBIA1300-amiR820 constructs. This method supported a 27% transformation efficiency of amiR820 which was less than in case of control (>50%), but it is far better than that reported for other constructs in various rice cultivars ranging from 9% to 12% [
The putative transgenic lines were screened for transgene integration by genomic PCR using specific primers. A fragment of 286 bp was amplified in all transgenic events except for in wild type. pCAMBIA1300-amiR820 plasmid was used as a positive control (
To analyse the extent of over-expression of mature miR820 in putative transgenic lines, endpoint stem-loop
Sahoo et al., 2011 | Kant et al., 2007 | Cambia Protocol | Mohanty et al., 1999 | Modified Method | |
---|---|---|---|---|---|
Media | MS 4.4 g | MS 4.4 g | N 64 g | MS 4.4 g | MS 4.4 g |
Proline | - | 560 mg | 500 mg | - | 500 mg |
Casein hydrolysate | 300 mg | 300 mg | 1 gm | 300 mg | |
Sugar | Maltose 30 g | Maltose 30 g | Sucrose 30 mg | Sucrose 30 mg | Sorbitol 30 g |
Matrix | 0.8% Agar | 1% Agarose | 0.6% Phytagel | 0.4% Phytagel | 1% Agarose |
NAA (mg/l) | 0.5 | 0.5 | 0.5 | 0.5 | |
Kinetin (mg/l) | - | 2 | - | - | 2 |
BAP (mg/l) | 3 | - | 3 | 1 | 1 |
Glutamine | - | - | .5 | - | - |
Fe2EDTA | - | - | 10 ml (100´) | - | - |
RT PCR was done to capture expression profiles of miR820 in these lines. As shown in
In the present work, we report a successful transformation of rice with artificial miR construct to over-express the 21-nt species of Osa-miR820. It was observed that the construct interfered with the regeneration potential of the callus warranting hormonal modifications in the protocol. These transgenics will be subjected to further analysis to unravel the functional role and requirement of the 21-nt Osa-miR820 species in regulating the plant biology.
The authors would like to thank Prof. Detlef Weigel for providing the pNW55 construct. NS acknowledges the fellowship received from CSIR, India. The research was supported by financial grants received from the Department of Biotechnology, Government of India.
NehaSharma,SandeepPanchal,NeetiSanan-Mishra, (2015) Protocol for Artificial MicroRNA Mediated Over-Expression of miR820 in Indica Rice. American Journal of Plant Sciences,06,1951-1961. doi: 10.4236/ajps.2015.612196