Reverse transcription quantitative PCR (RT-qPCR) is a highly sensitive technique that has become the standard for the analysis of differences in gene expression in response to experimental treatments or among genetic sources. The accuracy of the RT-qPCR results can be significantly affected by uncontrolled sources of variation that can be accounted for normalization with so-called reference genes stably expressed under various conditions. In this study we assessed the stability of 21 reference gene candidates in crowns of two alfalfa cultivars (Apica and Evolution) exposed to various environmental conditions (cold, water stress and photoperiod) and from above ground biomass of the cultivar Orca sampled at three developmental stages (vegetative, full bloom and mature pods). Candidates were selected based on their previous identification in other plant species or their stable expression in a differential hybridization of alfalfa ESTs with cDNA from non-acclimated and cold-acclimated alfalfa. Genes encoding ubiquitin protein ligase 2a (UBL-2a), actin depolymerizing factor (ADF) and retention in endoplasmic reticulum 1 protein (Rer1) were the most stable across experimental conditions. Conversely β-actin (Act), α-tubulin (Tub) and glyce-raldehyde 3-phosphate dehydrogenase (GAPDH) frequently used as “housekeeping genes” in gene expression studies showed poor stability. No more than two reference genes were required to normalize the gene expression data under each condition. Normalization of the expression of genes of interest with unstable reference genes led to observations that were conflicting with those made with validated reference genes and that were in some cases inconsistent with the current knowledge of the trait. The reference genes identified in this study are strong candidates for normalization of gene expression in cultivated alfalfa.
Cultivated alfalfa (Medicago sativa L.) is a major forage legume grown extensively worldwide [
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a highly sensitive technique which can detect small differences in transcript abundance between samples even for weakly expressed target genes. Normalization of cDNA concentrations with stably expressed genes is needed to minimize the effects of uncontrolled factors such as variation in RNA concentrations or the efficiency of reverse transcription that can affect the accurate determination of transcript variations across biological samples [
In this study we evaluated the stability of the expression of several candidate reference genes in different genetic backgrounds of cultivated alfalfa exposed to variable environmental conditions or sampled at different developmental stages. Our objective was to identify genes that are stable under a wide range of conditions and would constitute good candidates for the selection of reference genes in RT-qPCR analysis of the expression of genes potentially associated to key agronomic traits in alfalfa. We also assessed the impact of unstable reference genes for normalization of gene expression in the assessment of their relationship with physiological traits.
Plants of alfalfa (Medicago sativa spp. sativa) were sampled during their acclimation to various environmental conditions (low temperature, water deficit, photoperiod) and at different stages of their development. These plants were obtained from a series of independent experiments described below:
Plants of the cultivars Apica (ATF0) and Evolution (ETF0) and populations (ATF5 and ETF5) obtained after five cycles of recurrent selection for superior tolerance to freezing (TF) within these two cultivars [
Two separate cold acclimation assays were performed: “cold acclimation 2011” and “cold acclimation 2013”. In 2011, non-acclimated (NA) plants of populations ATF0 and ATF5 were sampled immediately before their transfer to low temperature and at the end of the cold acclimation period at −2˚C (A). In 2013, the populations ETF0 and ETF5 were added and a time course analysis of gene expression was performed by taking samples 0 h, 8 h, 1 d, 3 d, 7 d and 15 d after transfer to 2˚C and after two additional weeks of hardening below freezing at −2˚C (HF). In both experiments, crown tissues of four randomly selected pots (10 plants per pot) of each population were harvested at each sampling point.
Plants of the initial cultivars ATF0 and ETF0 and populations ATF5 and ETF4 obtained after respectively five and four cycles of recurrent selection were grown under environmentally-controlled conditions and acclimated to natural hardening conditions in an unheated greenhouse as described in Castonguay et al. [
Two additional treatments were included in the “cold acclimation 2013” experiment to test candidate reference genes under water deficit and reduced photoperiod. For that purpose, unstressed plants of ATF0 and ATF5 grown under the conditions described previously (22˚C/17˚C, 16 h photoperiod) were compared to plants 1― Exposed to a progressive water deficit by withholding water during a 10 d period until the appearance of wilting symptoms; 2―Maintained under short (8 h) photoperiod at warm temperature (22˚C/17˚C) for three days. Five replicates (10 plants∙pot−1) were available for each treatment.
Plants of the biomass-type cultivar Orca were grown in a greenhouse under the conditions described in Duceppe et al. [
Reference gene candidates tested in this study are listed in
RNA samples were extracted from crowns with buds (5-cm transition zone between shoots and roots) or stems
Gene ID | Type | Sequence homology | Genbank acc.no. | Primer Sequences (5'-3') | Size (bp) | Tm (˚C) | PCR efficiency (%) |
---|---|---|---|---|---|---|---|
Act | Ref† | β-Actin | EU664318 | TAGGTGCCGAGCGTTTCC CCGGGGAACATAGTCGTACC | 175 | 79.2 | 95.7 |
ADF | Ref† | Actin depolymerizing factor | JZ818469 | GCATCTGGTATGGCAGTCC GCACTCATCAGCAGGAAGG | 183 | 81.4 | 91.0 |
APT | Ref† | Adenine phosphoribosyltransferase | JZ818470 | GGAGCTGTTGAAGCTGGTG CACGACCCTTCAGTTCTGG | 154 | 81.8 | 96.7 |
ATPase | Ref‡ | Vacuolar H+- ATPase A subunit | JZ818471 | CTACGAACGTGCTGGGAAAG GAGGGTTGCAGATGTCACG | 124 | 80.2 | 91.4 |
CAC | Ref† | Clathrin adaptor complex | JZ818472 | AGCCGGGCCTCTTAGTATGAC CCCATCGATACGGATTATGAGC | 113 | 76.5 | 97.0 |
COP | Ref‡ | Coatamer delta subunit | JZ818473 | GGTGAGAATCAAGCCGTCTC GTTGGACCAGTGGGGAAAG | 116 | 77.8 | 95.3 |
COMT | Ref‡ | Caffeic acid 3-0-methyltransferase | JZ818474 | ATACTTCCGGTGGCTCCAG GCACCTTTGGCAAGATCCTC | 131 | 81.0 | 94.3 |
eEF-1α | Ref‡ | Eukaryotic elongation factor 1-alpha | JZ818475 | GAGCCAAAGAGACCCACAGAC TCAGTGAGAGCCTCGTGGT | 194 | 82.2 | 93.2 |
eIF-2 | Ref‡ | Eukaryotic translation initiation factor 2 | JZ818476 | GGTGCTGGGTCATCAAAGG GCTCTGGGTCCTGGACAAC | 162 | 78.5 | 94.2 |
eIF-5 | Ref† | Eukaryotic translation initiation factor 5 | JZ818477 | ATGCACTGGAGGAAGAGCAC TCCTCCGACTCTGACTCTGC | 133 | 79.5 | 97.2 |
GAPDH | Ref† | Glyceraldehyde 3-P Dehydrogenase | JZ818478 | CTGGAGAGGTGGAAGAGCTG GGTTGGGACACGGAATGAC | 127 | 82.1 | 97.8 |
ITR | Ref‡ | Inositol Transporter | JZ818479 | TGGTCTTGGTGTAGGGATGG GGAAAGGAACTGTCCACCAG | 127 | 79.6 | 98.8 |
Pro1 | Ref‡ | Profilin 1 | JZ818480 | CCTCGAATGACAGCTCCAG TCCTCGGTGTAGACGGTAGC | 181 | 80.6 | 97.5 |
Rer1 | Ref‡ | Retention in endoplasmic reticulum 1 protein | JZ818481 | GCCTTCTGATGGTGGACCT GGCCAGAAGACAGGAACATC | 165 | 78.9 | 98.0 |
18S rRNA | Ref† | 18S ribosomal RNA | JZ818482 | GGGCTCGAAGACGATCAG AGCCTTGCGACCATACTCC | 145 | 82.3 | 97.8 |
RPL4 | Ref† | Ribosomal protein L4 | JZ818483 | GGATGGCTTTGCTTGCTG CTTTCCCTGCAGCCTTGA | 114 | 80.0 | 99.7 |
Tub | Ref† | α-tubulin | JZ818484 | CAGCCTCCTTCAGTTGTGC CTTCTTCCATGCCCTCACC | 175 | 82.6 | 96.2 |
UBQ-2 | Ref‡ | Ubiquitin 2 | JZ818485 | GGACTCAAGGTGGCCAAAC GCCTAAGCCAGTGGGTGTCT | 197 | 82.5 | 93.0 |
UBQ-5 | Ref† | Ubiquitin-like protein 5 | JZ818486 | GAAGGTTCGCGTGAAGTGC CACCGAGAGTGATGTGATCC | 140 | 82.1 | 92.0 |
UBL-2a | Ref† | Ubiquitin protein ligase 2a | JZ818487 | CCAAACCCAAACTCACCAG AGCAGTCCAACTCTGCTCAAC | 108 | 80.5 | 95.9 |
Unknown | Ref‡ | No hit | JZ818488 | ATGAGCCTTCGTCGTTGC GGAGCCAATCTAGCTGGAAC | 169 | 79.8 | 99.0 |
ProDh | GOI | Proline dehydrogenase | JZ818489 | GGCTGCTGCAAAAGCACA GCCCTTCTCAAGAGGTATGG | 180 | 79.6 | 98.4 |
SPS | GOI | Sucrose phosphate synthase | JZ818490 | TCCCAAGCCCTCAGATACC CTGCTTCCGACTCCCTTCA | 146 | 80.6 | 96.4 |
SuSy | GOI | Sucrose synthase | JZ818491 | CCGATTGACATCCTTCTACCC GTCCTTTGACTCCTTCCTCCT | 235 | 82.6 | 93.0 |
†Setection based on literature; ‡Setection based on differential hybridization of alfalfa cDNA library.
with leaves and ground to a fine powder in an analytical mill (IKA A11, Wilmington, NC) equipped with a cutting blade and a reinforced chamber for embrittlement of tissues in liquid N2. Total RNA was extracted using a CTAB procedure as described in Dubé et al. (2013). Total RNA was quantified using the ExperionTM RNA StdSens microcapillary chip (Bio-Rad, Mississauga, ON, Canada) and its integrity based on the RNA quality indicator (RQI) calculated by the ExperionTM software was always greater than 8. First-strand cDNA was synthesized from 1 µg of total RNA and oligo(dT)18 primers using the Transcriptor First Strand cDNA synthesis Kit (Roche Applied Science, Laval, QC, Canada) following the manufacturer instructions. Any residual genomic DNA was removed by a treatment with DNaseI (Invitrogen, Burlington, ON, Canada) prior to cDNA synthesis. Two independent cDNA synthesis reactions were performed for each sample and used as technical replicates in RT-qPCR analyses.
RT-qPCR analysis of gene expression was performed according to the MIQE guidelines [
Statistical analysis of gene expression data was performed with the two-way Anova procedure of SigmaPlot® Ver. 12.0 (Systat Software, San Jose, CA). Data normality was verified using the Shapiro-Wilk statistic. Pairwise comparison of means was performed with the Tukey test and statistical significance was postulated at P > 0.05.
Reverse transcription quantitative PCR (RT-qPCR) is a highly sensitive technique that has become the standard for gene expression analysis [
We evaluated twenty one (21) candidates as potential reference genes for normalization of transcript levels in RT-qPCR analysis of gene expression in plants of alfalfa exposed to low temperature (
The stability of the 21 candidate reference genes expressed as the geNorm mean pairwise variation (M) of a gene in comparison to the other genes was first tested with samples from plants acclimated to low temperature under controlled conditions in 2011 (
The 12 candidate genes below the 0.5 M threshold in
Data in
in accordance with previous reports of its poor performance as a reference gene in other species [
A combination of reference genes is required to ensure the accuracy of RT-qPCR analysis of gene expression [
RT-qPCR determinations of relative levels of expression of sucrose synthase (SuSy), sucrose phosphate synthase (SPS) and proline dehydrogenase (ProDh) known to be involved in the cold acclimation process highlight the importance of using validated reference genes (
Data set | geNorm pairwise variation V value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
V2/3 | V3/4 | V4/5 | V5/6 | V6/7 | V7/8 | V8/9 | V9/10 | V10/11 | V11/12 | |
Cold acclimation (2011) | 0.104 | 0.089 | 0.065 | 0.056 | 0.051 | 0.049 | 0.049 | 0.052 | 0.044 | 0.041 |
Cold acclimation (2013) | 0.076 | 0.066 | 0.062 | 0.061 | 0.058 | 0.050 | 0.049 | 0.057 | 0.056 | 0.076 |
Time course of cold acclimation | 0.120 | 0.083 | 0.065 | 0.059 | 0.049 | 0.053 | 0.047 | 0.046 | 0.050 | 0.086 |
Apica | 0.096 | 0.073 | 0.060 | 0.059 | 0.053 | 0.051 | 0.049 | 0.046 | 0.046 | 0.091 |
Evolution | 0.106 | 0.077 | 0.074 | 0.060 | 0.052 | 0.051 | 0.044 | 0.045 | 0.050 | 0.079 |
Acclimation to natural conditions | 0.098 | 0.075 | 0.060 | 0.052 | 0.049 | 0.047 | 0.057 | 0.062 | 0.061 | 0.052 |
Photoperiod | 0.108 | 0.084 | 0.070 | 0.063 | 0.054 | 0.052 | 0.060 | 0.063 | 0.068 | 0.061 |
Water stress | 0.080 | 0.067 | 0.065 | 0.050 | 0.044 | 0.061 | 0.054 | 0.063 | 0.059 | 0.062 |
Development | 0.067 | 0.093 | 0.068 | 0.061 | 0.052 | 0.053 | 0.047 | 0.040 | 0.049 | 0.088 |
Normalization with less stable Act and Tub genes led to strikingly different conclusions including a lack of a low temperature effect on SuSy expression, a much higher increase in SPS gene expression and unexpected cold inducibility of ProDh. Such discrepancies are the results of biased adjustment to the data set when low temperature-repressed Act and Tub (
Comparative geNormPlus analysis of a repertoire of candidate reference genes identified a set of candidates with high potential as reference for normalization in RT-qPCR analysis of gene expression in alfalfa. Genes encoding ubiquitin protein ligase 2a (UBL-2a), actin depolymerizing factor (ADF), retention in the endoplasmic reticulum protein 1 (Rer1) and eukaryotic elongation factor 1-alpha (eEF-1α) were found to be good references to normalize the expression of genes potentially related to key traits in alfalfa populations. Standardization of transcript levels in samples from a wide range of experimental conditions was systematically achieved with a combination of no more than two reference genes. When RT-qPCR data were normalized with stably expressed genes, observations on the expression of genes functionally related to cold acclimation in alfalfa was consistent with current knowledge of the physiology of that trait. Normalization with unstable genes led to markedly different conclusions with regard to the expression of these genes under these treatments. The candidate reference genes identified in our study will foster the acquisition of accurate RT-qPCR results in functional analyses of gene expression in alfalfa.
The authors would like to thank Dr. Serge Laberge for providing access to the EST library from cold acclimated alfalfa. We would also like to thank Mr. Réjean Desgagné and Mr. David Gagné for their contribution to the development of the EST collection and database. The participation of Dr. Marie-Pier Dubé to this project was supported by a NSERC visiting fellowship in Canadian federal government laboratories. This project was supported by a competitive grant of Agriculture and Agri-Food Canada.