Cyanobacteria from habitats within Gujarat have been poorly studied with regard to their diversity. In the present investigation eight morphologically distinct cyanobacterial isolates were obtained and characterized from the fresh water and marine habitats. Identification was performed based on morphological features and on 16S rDNA sequences analysis. A phylogenetic tree based on 16S rDNA sequence of cyanobacterial isolates was prepared. Phylogenetic analysis clustered the eight morphologically distinct isolates into two distinct groups thus highlighting the importance of both morphological and genetic methods in studying cyanobacterial diversity.
Cyanobacteria were the first prokaryotic organisms believed to have evolved on earth approximately 3.8 billion years ago. They constitute one of the major gram negative bacterial phyla and occupy the diverse range of habitats inhabiting most of the Earth’s environment. They display considerable morphological diversity ranging from unicellular to colonial and filamentous forms. Cyanobacteria are capable of photo-autotrophic growth; perform oxygenic photosynthesis similar to those of eukaryotic algae and plants. They also have the unique ability to fix atmospheric nitrogen [
Cyanobacteria can be classified on the basis of morphology, cellular differentiation, biochemical, physiological and genetic criteria. The taxonomy of cyanobacteria until now has been based mainly on their morphology and according to it they are classified into five orders: Chroococcales (I), Pleurocapsales (II), Oscillatoriales (III), Nostocales (IV) and Stigonematales (V). However, the morphology and other phenotypic characteristics of cyanobacteria can be dramatically influenced by environmental factors and stage of development [
DNA base composition is important genetic character used to study the taxonomy of cyanobacteria. Analysis of the DNA base composition (Mol % G + C) is one of the few molecular characters that have been determined for almost 200 cyanobacterial strains. Comparative analysis of 16S ribosomal RNA sequence has been used for identification and construction of cyanobacterial phylogeny [
Gujarat state of India is rich in both fresh water and marine ecosystems. In the present study we have isolated eight cyanobacterial strains from freshwater and marine ecosystems and tried to explore their diversity using morphology and 16S rRNA sequence analysis.
Water samples were collected from five different regions of the Gujarat state namely Rajkot, Bhuj, Positara, Gadhada, Okha, Mithapur, which include both fresh and marine habitats and were stored in a growth chamber at 25˚C with under 8 hours/16 hours dark/light photoperiod. For morphological studies, the strains were cultivated in BG11 medium [
Pure cultures of cyanobacteria were obtained by three techniques viz. enrichment, serial dilution and direct streak plate method. In the serial dilution method, the inoculum was prepared by mixing the samples with sterilized BG11 medium and then serial dilutions were made in test tubes containing same medium. The tubes were incubated at 25˚C under 8 hours/16 hours dark/light photoperiod. After growth the culture was streaked on BG11 agar plates to obtain unialgal cultures. In the streak plate method, the crude samples were directly streaked on BG11 agar plates. The plates were incubated at 25˚C under 8 hours/16 hours dark/light photoperiod. Through successive streaking or transferring from one agar plate to another, unialgal cultures were obtained. Unialgal stocks were maintained in 100 ml liquid medium as well as on agar slants and stored at 25˚C under low light intensity.
Axenic culture of cyanobacteria was obtained by treating the cells with standard antibiotic solution (Streptomycin, Nalidixic acid, Ampicillin and Cycloheximide). 400 µL of sterile BG11 medium was added along with 400 µL of sterile antibiotic solution in both solid and liquid media to give a final antibiotic concentration of 50 µg/ml. The culture was then incubated at room temperature under darkness. The morphology of cells and filaments was studied using an Olympus 45× light microscope with a digital camera.
Purelink Plant DNA extraction kit (Invitrogen, USA) was used to obtain high quality genomic DNA samples from cyanobacterial isolates, according to the manufacturer’s protocol. Electrophoresis was done in 0.8% agarose gel at 5 V/cm for 30 min. Quantity of the genomic DNA was estimated spectrophotometrically by measuring absorbance at 280 nm while the quality was determined by taking ratio of absorbance at 260 and 280 nm in a UV 1800 Shimadzu UV Vis Spectrophometer.
In order to the get the sequence of 16S rDNA from cyanobacterial isolates, the 16s rRNA gene was amplified using two sets of oligonucleotide primers in separate PCR reactions [
Set | Primer sequence | Length of PCR amplicon |
---|---|---|
1 | CYA106F-5’CGGACGGGTGAGTAACGCGTGA3’ CYA781R-5’GACTACTGGGGTATCTAATCCCATT3’ | 675 |
2 | CYA106F-5’CGGACGGGTGAGTAACGCGTGA3’ CYAN1281R-5’GCAATTACTAGCGATTCCTCC3’ | 1175 |
PCR were performed by GeneAmp PCR system 9700. The PCR reaction mixture (20 μL total volume) consisted of 100 ng genomic DNA, 1.5 mM MgCl2, 10 mM of each dNTP, 1xTaq buffer, 10 μM of each primer and 1 unit of Taq polymerase. Samples were subjected to the following thermal profile: 3 min of denaturing at 94˚C and 30 cycles of three steps: 30 sec of denaturing at 94˚C, 30 sec of annealing at 58˚C, and 1 min of elongation at 72˚C followed by final extension of 10 minutes at 72˚C. A digital gel image of the gel was obtained in Gel Doc XR system (Bio-Rad) using QUANTITY ONE® 1-D V 4.6.7 analysis software.
After purification [PCR purification kit (Genei, Bangalore)] the PCR amplicons were directly sequenced at 1st BASE DNA sequencing Services, Malaysia. The sequence obtained using both set of primers were checked for overlaps and a final sequence of 1175 base pair was obtained. The sequences obtained were submitted to NCBI (KC140132 - KC140134 and KC248207 - KC248211).
DNA sequence data was analyzed by BLAST. Multiple sequence alignments were generated using the CLUSTALW program [
On microscopic observation of samples we distinguished eight different cyanobacterial morphotypes.
The 16S rRNA gene was amplified using hot start PCR with two set of primers, CYA106F and CYA781R; CYA106F and CYA1281R. A PCR product of 675 bp was obtained using the first set and an amplification product 1175 bp was obtained using the second set of primer (
A phylogenetic tree based on 16S rRNA sequences was constructed using MEGA 5.10 software (
isolates grouped into two clusters, the first cluster, supported by 100% bootstrap value, included isolates Cyano- bacterium sp. POKH1, Cyanobacterium sp. PSGH, Cyanobacterium sp. PBJ1, and Cyanobacterium sp. PBJ2 while the other cluster which was not supported by a sufficient bootstrap value included Cyanobacterium sp. PRJT, Cyanobacterium sp. POKH2, Cyanobacterium sp. PPST and Cyanobacterium sp. MTP.
Pure cultures of cyanobacteria are essential for studying various aspects of their biology. Gujarat state of India has one of the largest coastlines but still there are very few reports on isolation, characterization and diversity of cyanobacteria from these habitats. Since isolation and culturing of all forms of cyanobacteria are difficult, we are able to isolate only eight morphologically distinct cyanobacterial isolates from water samples collected from different regions of Gujarat. The general inability of cyanobacterial species to grow as unialgal culture has been noted in the literature and has been attributed to the fact that laboratory environment is quite different compared to natural habitats [
Our work is a preliminary report on isolation, characterization and diversity of cyanobacterial isolates from Gujarat state of India.
The experiments comply with the current laws of the countries in which the experiments were performed. The authors declare no conflict of interest.
Author wishes to acknowledge Sarvoday Kelavani Samaj, Rajkot and UGC for financial assistance under scheme of college teachers for Minor Research Project to Mr. N. J. Faldu [(F. No. 47-1316/10 (WRO)]. The authors also grateful to Mrs. Sheetal Tank, Librarian, AITS and K.D. Ladva, Head, Department of Chemistry for their kind support and guidance.