Conserved eukaryotic signaling proteins participate in development and disease in plant pathogenic fungi. Mutants in CGA1, a heterotrimeric G protein Ga subunit gene of the maize pathogen Cochliobolus heterostrophus, are defective in several developmental pathways. Conidia from CGA1 mutants germinate as abnormal, straight-growing germ tubes that form few appressoria, and the mutants are female-sterile. The CGA1, Gα subunit, is also thought to act as a down regulator of hydrophobin expression and secretion in this fungus and in related Ascomycete species. Although cga1 mutants can cause normal lesions on plants there are host physiology conditions under which full virulence requires signal transduction through CGA1-mediated pathways. A Gα activated mutant, cga1Q204L was created to help establish the role of CGA1 in growth and development, and in mediating hydrophobin secretion and expression. The activated Gα allele was transformed into a cga1 mutant strain. The transgenic lines showed phenotypes resembling the null mutant in development, sporulation and hydrophobicity, indicating a possible role for CGA1 as a stabilizer of these traits.
Mutants in genes encoding conserved eukaryotic signal transducing proteins have been very helpful in efforts to understand the environmental mediated control of development and the sensory pathways needed to detect the host and establish invasive growth. Several such mutants have been constructed for the maize pathogen Cochliobolus heterostrophus, agent of Southern corn leaf blight [1-4]. In Ascomycetes for which sufficient sequence information is available, there are three Gα encoding genes, one Gβ and one Gγ gene. Deletion of the MAP kinase gene CHK1 [
Although, Gene disruption studies are an efficient way to identify the role of signaling components such as the G-protein subunits and the MAPK cascade, a constant activation of desired genes became, in recent years, a powerful genetic tool to accomplish the information resulting from the disruption experiment and to identify new functions. Site specific mutagenesis (such as Q204-L, G42-R and R178-C) designed to constitutively activate Gα signaling was reported in C. parasitica [
Wild type C. heterostrophus strain was C4 (MAT1-2; Tox1 + ATCC 48331; abbreviated in figures as WT C4). Mutant, previously developed [
A specific sequence change in the pCGA1-Bar plasmid (
Vector preparation. A plasmid (pCGA1-Bar, 6338 bp,
Enzyme restriction reaction. ApaI, BstxI and HindIII were used in order to confirm the construction of the plasmid and the presence of the CGA1 insert. First examination was done by addition of 1 μl ApaI to 2 μl reaction buffer #4 (New England Biolabs) 0.5 μl BSA, 2 μl DNA (pCGA1-Bar plasmid) and 14.5 μl DDW, and incubation at 25˚C for 1 hour. Alternatively, 1 μl BstxI, was added to 2 μl reaction buffer #3 (NEB), 2 μl DNA (pCGA1-Bar plasmid) and 15 μl DDW, and the reaction was incubated at 55˚C for 1 hour. Third examination was done by adding 1μl HindIII to 2 μl reaction buffer #2 (NEB), 2 μl DNA (pCGA1-Bar plasmid) and 15 μl DDW, and incubation at 37˚C for 1 hour (
Site directed mutagenesis. Site mutagenesis was conducted with “QuikChange® site-directed Mutagenesis Kit” (Qiagen) according to the manufacturers protocol. Two complimentary oligonucleotides were synthesized to contain the Q204L mutation. Primers: Q204L forward
5’ GATGTCGGTGGTCTGCGATCAGAGC 3’ and Q-204L Reverse 5’ GCTCTGATCGCAGACCACCG ACATC 3’ (
Cloning and amplification. The transformation was conducted using XL-1 Blue MRF’ (Stratagene) super competent E. coli cells, suspended in 5 μl LB + Amp: 3 μl DNA, were added to 40 μl XL-1 suspended cells. Heat shock treatment was admitted by incubating cells on ice for 30 minutes, and then transferring them to 42˚C heated bath for 45 seconds. Cells were transferred to regeneration broth containing LB and incubated at 37˚C, for 45 min, then plated on color screening plates and incubated at 37˚C overnight.
Transformed E. coli colonies selection and verification. Since transformed colonies have selection markers for pBluescript, blue colonies were used as a template for PCR reactions using Bio-X-Act (stratagene) polymerase, with the CGA1 primers: Cga1-f: 5’ GAGTCGCTCGAGCTCCCGC 3’ and the Cga1-r: 5’ GCATAGTATCCGTGGCGCAGG 3’ (
Fungal transformation. Transformation to the WT and the cga1 strains was performed as described previously (Turgeon et al., Molecular and Cellular Biology, 7(9), 1987). Each strain was transformed with linear DNA excised from the plasmid using different restriction enzymes: ApaI, BstxI, or HindIII (DNA kept in 50 µl STC buffer). After first overnight incubation period, an agar over layer, containing bialaphos antibiotics to a final concentration of 100 µg/ml, was added. Plates were incubated for an additional 3 - 8 days at 30˚C in the light, until colonies appeared. Bialaphos resistant colonies were isolated and their DNA was extracted using a “Miniprep” Kit (Qiagen) according to the manufacturers’ protocol. The purified DNA was used for PCR with the primers Cga1-f and Cga1-r or with the primers pairs: Cga1-f/Cga1 B4xho (5’ CCGTTGTTGCCTCCATTAGC 3’) and CGA1-r or Bar-r 5’ GGTACCGGCAGGCTGAAGTC 3’ and Bar-s 5’ CGGCCGTCTGCACCATCG 3’ (Figures 1(a), 2). The sequence of the PCR products was determined (
cga1Q204L construction and verification. In order to construct a constitutively activated CGA1 mutant we used site-directed mutagenesis (Q204L mutation) to change glutamine to leucine at position 204. A plasmid carrying the CGA1 gene followed by the Bar resistance cassette (pCGA1-Bar,
The plasmid was then transformed into two strains of C. heterostrophus, WT and cga1. The mutated colonies were grown on selective media (CM-Bar) for several transfers. DNA extracted from both strains, cga1 and the WT, was obtained by PCR amplification. Mutant in the background of cga1 was verified by amplifying the transformed sequence using the forward Cga1 B4xho primer, and the Cga1-r reverse primer (
Since the new cga1Q204L mutant has two copies of the cga1 gene (the activated one and the original disrupted one) a PCR with the primers Cga1-f and Cga1-r will result in a mixture product of both genes. In other words a mixture of adenine (A) and thymine (T) is expected. Several isolated mutants (WT and cga1 in the background) showed resistance to bialaphos antibiotics, and proved by PCR to have the bar expression cassette together with the CGA1 gene (as shown for the QL18a mutant strain,
The WT strain transformation with the same linear plasmid led to at least one bar resistance mutant named QL10. This mutant proved by PCR to carry the bar expression cassette and the additional CGA1Q204L gene but the resultant products that were sent for sequencing didn’t contain the mixture of adenine (a) and thymine (t) as expected (
cga1Q204L phenotype characterization. The cga1Q204L mutation strain (QL18a) was characterized by appearance of white aerial hyphae (
Former examination showed that cga1 strains have a significant sensitivity to Sorbitol (1M) osmotic stress in comparison to the WT strains [
stress response. Although this expectation, the constantly activated cga1 mutant showed the same sensitivity to Sorbitol (1M) osmotic stress as CGA1 disruption strains (data not shown).
In most published works employing activated Gα alleles, it has not been shown, biochemically, that the transgene encodes a protein lacking GTPase activity, or that it activates downstream effectors such as adenylate cyclase (an example is [
Comparative analysis of the phenotypic traits exhibited by fungal strains containing null or activated Gα alleles has been used by a number of laboratories to identify putative signaling-related functions [7-10]. Free Gβg may cause a signal in both the Gα null and activated mutant strains and the phenotypic traits of both strains are affected mainly by the manipulated Gα gene. Indeed in some instances phenotypes of the Gα null and activated mutant strains were different. In N. crassa [
In this work we constructed an activated cga1 allele, Q204L. Although the success of the mutagenesis was proved by PCR and sequencing, this mutant presents similar phenotypes to the null cga1 mutant. These phenotypes include colony growth rate on CM or on CM containing 1.5 M sorbitol (hyper osmotic stress), sporulation, hyphae straight growth, aerial hyphae growth and hydrophobicity. The results were presented here indicating a possible role for CGA1 as a stabilizer of these traits.
I am grateful to Dr. Benjamin A. Horwitz (TechnionIsrael Institute of Technology, Israel) for his guidance and much helpful advice. I thank Oren Schaedel for his technical assistance and Dr. Sophie Lev for many helpful suggestions.