We analyzed the abnormal shoot in youth (asy) mutant to understand the phase-specific regulation of shoot development. asy showed various shoot abnormalities, including small leaves due to the precocious termination of cell division, defects in leaf blade-sheath boundary formation, and abnormal shoot apical meristem maintenance at the early vegetative stage. These defects recovered with advanced development. ASY encodes a DUF791 domain protein, which is part of the major facilitator superfamily. Despite stage-specific phenotypes, the ASY expression level was roughly constant throughout development. A paralog of ASY, ASL, exists in the rice genome and is supposed to have redundant functions. ASL expression was relatively low in early-stage embryos but increased at later stages. Thus, asy phenotypes were limited to the stage when ASL expression was suppressed. A homology search revealed that ASY is a homolog of the Chlamydomonas CrMoT2 gene, which encodes a molybdate transporter. ASY was suggested to encode a molybdate transporter based on its sequence similarity with CrMoT2 and predicted transmembrane topology. This is the first report of a CrMOT2-type molybdate transporter in higher plants.
The genetic regulatory mechanism of shoot development has been studied in many higher plants such as Arabidopsis, rice, and maize. CUP-SHAPED COTYLEDON 1 (CUC1), CUC2, and SHOOT MERISTEMLESS play important roles in differentiation of the shoot apical meristem (SAM) in Arabidopsis [1-3]. However, distinct genes related to small RNA metabolism in rice such as SHOOTLESS 1 (SHL1), SHL2, SHOOT ORGANIZATION 1 (SHO1), SHL4/SHO2, and WAVY LEAF have decisive roles in SAM formation [4,5]. The mechanism of SAM maintenance is another important aspect of shoot development. A large number and various classes of genes are involved in SAM maintenance, including CLAVATA, WUSCHEL, FAS, and FSM [6-9]. These genes function throughout the plant life cycle; however, plants show phases of development that include embryogenesis, and vegetative and reproductive phases. The vegetative phase is further divided into juvenile and adult phases. These phases indicate that plant development is regulated by phase-specific genes as well as by genes acting throughout the life cycle.
Recent advances in plant developmental biology have shown that the juvenile-adult phase change during vegetative development is an important event. Because a large number of traits differ between the juvenile and adult phases [10-12] and several genes associated with phase changes have been cloned [13-16], it is expected that juvenile or adult phase-specific regulatory mechanisms of shoot development are operating. Accordingly, another interesting aspect of plant vegetative development is the phase-specific regulation of gene expression.
In this study, we identified the abnormal shoot in youth (asy) mutant, which showed abnormal phenotypes during the early vegetative phase but near-normal later development. The asy causal gene encodes a molybdate transporter. Our findings indicate that a specific trace element plays a distinct role in plant development, including leaf morphogenesis, cell division, and shoot meristem maintenance.
We identified a single recessive mutant from M2 population of rice (Oryza sativa L., ssp. japonica cv. Taichung 65) mutagenized with N-methyl-N-nitrosourea. Since the mutant developed weak plants at the early stage and recovered almost normal stature at the late vegetative stage, we named this mutant abnormal shoot in youth (asy). Taichung 65 was used as wild type. In the experiments on early vegetative seedlings, seeds were surface sterilized and grown on MS plates that contained 4.6 g/L Murashige and Skoog plant salts mixture [
For paraffin sectioning, samples were fixed in FAA (formaldehyde: glacial acetic acid: ethanol [1:1:18]) for 24 h at 4˚C, dehydrated in a graded ethanol series, and embedded in Paraplast plus (McCormick Scientific). Microtome sections (8 μm thick) were stained with Delafield’s hematoxylin, and then observed under a light microscope.
Shoot apices 7-day after germination (DAG) of wild type and asy were fixed in 4% paraformaldehyde in 0.1 M sodium phosphate buffer for 48 h at 4˚C, and then dehydrated in a graded ethanol series. The dehydrated samples in 100% ethanol were replaced with butanol and embedded in Paraplast plus (McCormick Scientific). Paraffin sections (8 μm thick) were applied to microscope slides coated with MAS (Matsunami Glass). Digoxygenin-labeled antisense RNA probes of OSH1 and Histone H4 were prepared as described [
To map the ASY1 locus, asy homozygous plants (O. sativa L. ssp. japonica) were crossed with cv. Kasalath (ssp. indica), and the F2 and F3 populations were examined for recombination between the mutation and PCR-based polymorphic markers. The ASY locus was mapped in the 58.9 to 61.4 cM region on chromosome 10 using STS and CAPS markers obtained from the rice genome database (http://rgp.dna.affrc.go.jp/E/publicdata/caps/index.html). By finding recombination break points among 420 asy plants, the ASY locus was limited within a 100-kb region, including 20 candidate genes annotated in the RAP-DB database, and covered by three overlapping BAC clones. A single nucleotide substitution was identified in a gene (RAP Os ID; Os10g0519600 and MSU Os ID; LOC_ Os10g37520) in asy mutant. Accession numbers for ASY and ASL proteins are AB807476 and AB807477, respectively.
The 6.8-kb ASY genomic DNA including 3-kb upstream and 1-kb downstream was used for complementation test. This fragment was introduced into Agrobacterium tumefaciens strain EHA101 and transformed into asy homozygous plants by the Agrobacterium mediated transformation method [
For construction of fluorescence fusion protein, the coding region of ASY was amplified with primers that included appropriate restriction sites. It was translationally fused to 5’ terminus of the sGFP gene driven by 35S promoter of the cauliflower mosaic virus (p35S::ASYsGFP). Then it was introduced into onion epidermal cells using a particle bombardment with gold particles according to the manufacturer’s instructions (PDS-1000/He; Bio-Rad, Hercules, CA, USA). The cells were observed using a fluorescence microscope (BZ-8000; Keyence Co.).
Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. For RT-PCR, 1 μg of RNA after DNase I digestion was reverse transcribed with the SuperScript III First Strand Synthesis System and oligo (dT) primer according to the manufacturer’s instructions (Invitrogen). Resulting cDNA was used for RT-PCR with gene specific primers; ASYReTiF: TTCAAGGTTGCAGCCAAAGC and ASYReTiR: AAGCAGGAGTCCACAGGAAA (for amplification of ASY cDNA), ASLReTiF: GGAGCACAACAAGAGAGGTT and ASLReTiR: CGGCAACGACCTTTCGAAAT (for amplification of ASL cDNA). The primers for an internal control, UBIQUITIN, were prepared as described [
For real-time PCR, 500 ng of RNA after DNase I digestion was reverse transcribed with High Capacity RNAto-cDNA Master Mix (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed with SYBR Green Master mix (Applied Biosystems) following the manufacturer’s instructions. Amplification was monitored in real time by Step One Plus real-time RT-PCR system (Applied Biosystems). The primers for ASY and ASL were the same as those for RT-PCR. The primers for ACT1 were ACT1F: TCCATCTTGGCATCTCTCAG and ACT1R: GTACCCCCATCAGGCATCTG. The expression levels of ASY and ASL were normalized to that of an internal control, ACT1.
Mature dry seeds of wild type and asy mutant were cut into embryo and endosperm. Mature dry seeds, endosperms, and embryos were digested with concentrated HNO3 at 110˚C. After complete digestion, the concentrations of molybdenum in the samples were determined by inductively coupled plasma mass spectrometry (ICP-MS) (model SPQ9700; SII, Chiba, Japan). Measurements were done for four (whole seed) or three (embryo and endosperm) independent samples.
asy plants showed a dwarf phenotype at 7 days after germination (DAG) (
Other morphological aberrations were also detected in the leaves. The asy second leaf frequently lacked a ligule, which forms at the boundary between the leaf sheath and blade (Figures 1(d) and (e)). Moreover, the bulliform cells were enlarged and increased in number in the asy leaf blade (Figures 1(f) and (g)). In addition, the asy leaf blade tissues were partly transformed into those of the leaf sheath (
The leaf abnormalities and seedling lethality we observed suggested abnormalities in the asy SAM. Longitudinal sections of SAMs revealed that although the width of the asy SAM was comparable to that of wild type, the height was smaller than that in wild type (Figures 2(a)-(d)). We also found a SAM in which many cells were vacuolated in an extreme dwarf asy plant (
Because the first three leaves are formed in rice during seed development, we examined asy embryos at 10 days after pollination (DAP). Although all organs were formed in the embryos, morphological abnormalities were observed in the scutellum, coleoptile, and shoot apex (Fig-
ures 2(j) and (k)). Vacuolization was detected in cells of the scutellum, coleoptile, and first leaf primordium. These results show that ASY acted as early as the embryonic stage.
Phenotypic abnormalities such as small leaves and an aberrant SAM suggest that related gene expression is disturbed in asy. First, we examined cell division activity by in situ hybridization probed with histone H4. At 4 DAG, when the fourth leaf primordium was being formed, a large number of histone H4 signals were uniformly observed in second (P3 stage), third (P2), and fourth (P1) leaf primordia in wild type (
To examine SAM activity, we performed in situ hybridization probed with the OSH1 gene, which is expressed in indeterminate cells of the SAM. At 7 DAG, some asy SAMs showed a narrower OSH1 expression domain (Figures 3(c) and (d)), while other asy SAMs failed to express OSH1 (
asy homozygous plants were crossed with ssp. indica cv. Kasalath to identify the ASY gene using a map-based cloning method. The ASY locus was roughly mapped at 58.9 - 61.4 cM on chromosome 10 (
ASY is comprised of eight exons and seven introns,
and encodes a protein composed of 456 amino acid residues (
BLAST searches against the rice protein database using the ASY amino acid sequence revealed that a paralogous DUF791 family gene exists in the rice genome, Os03g0114800, which had 93.2% identity with ASY. We named this paralog ASY-like (ASL) (Figures 4(d) and 5(a)).
A phylogenetic tree constructed from the DUF791 domain of ASY showed that DUF791 family proteins were divided into two clades. ASY group proteins, in which ASY and ASL are included, are well conserved not only in plants but also in algae (
trast, the other group of proteins is found only in plants and has little significant conservation to ASY group proteins. For example, rice Os08g0113800, one of the three DUF791 domain-containing proteins in rice, has 23.2 and 22.8% identity with ASY and ASL, respectively.
The ASY group includes CrMOT2, which has been recently identified to be a molybdate transporter in Chlamydomonas [
ASY was deduced to localize to the membrane based on its amino acid sequence. Therefore, we examined the subcellular localization of ASY using onion epidermal cells transformed with 35S::ASY-GFP. GFP signals were detected mainly in the plasma membrane (Figures 6(a) and (b)), suggesting that ASY acts as a transporter.
ASY expression in different organs was examined by RT-PCR. ASY was expressed in all organs examined (
examined by real-time PCR. ASY was expressed rather constantly during seed development, whereas it was low until 10 DAP but largely increased at 14 DAP (
No rice mutants have been reported to show early development-specific phenotypes and recovery at later stages. Thus, asy is a unique mutant in that ASY plays important roles only during early development. Phenotypic defects in asy were observed in various traits of embryo and juvenile phase seedlings, including abnormal embryo formation, precocious termination of cell division in leaves associated with small leaves, aberrant leaf morphogenesis, and defective SAM maintenance. These abnormalities eventually caused seedling death. Interestingly, these stage-specific phenotypes were not caused by stage-specific ASY expression. A highly homologous gene, ASL, exists in the rice genome. ASL transcripts showed a similar expression profile to that of ASY. Notably, ASY expression was relatively higher than that of ASL in 7 DAP seed when the rice embryo developed second and third leaf primordia. Thus, the different expression levels of these genes during early embryogenesis might be responsible for the asy mutant defects. Although functional redundancy between ASY and ASL has not been confirmed, the high level of expression of ASL at the late stage explains the temporal specificity of asy phenotypes. A lossof-function ASL mutant is not available. To clarify the relationship between ASY and ASL, identification of the asl mutant and its detailed functional analysis are needed in the future.
ASY is a homolog of Chlamydomonas CrMoT2, which encodes a molybdate transporter, and is also found in humans [
No significant differences were detected in the seed and embryo Mo contents between wild type and asy, although severe defects were observed in asy embryos. Because the Km value of Chlamydomonas CrMOT2 for molybdate is higher than that of Arabidopsis MOT1 and CrMOT1 [24,26], ASY may have a different function from the MOT1-type molybdate transporter. It is possible that ASY creates a local concentration gradient of Mo, which is required for organ development. It is also conceivable that a significant difference in Mo content can be detected when early stage seeds at 7 DAP are examined, because ASL is predominant at later stages. Questions about Mo uptake activity, Mo affinity, and the detailed subcellular localization of ASY in planta should be addressed in future studies.
This work is supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (202480 01 to YN and 23012006 to JI).