61 varieties of wheat collected in the gene fund of the Research Institute of Crop Husbandry were screened using SCAR-markers associated with the gene of resistance to brown leaf rust, Lr19. As a result of PCR analysis using SCS123 marker the 737 bp locus was detected in 48 genotypes. The expected fragment of the 688 bp was detected in 53 genotypes using the SCS253 marker. The results obtained using both markers indicate that the Lr19 gene is present on 7D chromosomes of 45 genotypes. The existence of the Lr19 gene has not been proven only for 5 from the 61 analyzed wheat genotypes.
Wheat is the most cultivated cereal crop, giving almost 30% of global grain production and providing food for more than a half the Earth’s population. In Azerbaijan, wheat is strategically important crop for covering needs of the population in food products. Therefore, it is cultivated annually in different regions of the republic at the area of over 580 thousands of hectares. The main factors limiting the yield of summer wheat in Azerbaijan are fungal, bacterial and viral diseases. One of the common and harmful diseases of cereal crops is brown leaf rust caused by basidium fungus Puccinia recondite f. sp. tritici [1-3].
Depending on the severity and duration of the infection, yield losses can reach 40% - 50% [
The study of the genetic basis of plant resistance, the search for effective genes and their introduction into the culture of bread wheat significantly prevent the spread of the epiphytotic disease and stabilize the grain yield capacity. Development and deployment of cultivars with host genetic resistance is the most ecofriendly way to reduce the losses. Using hybridological analysis, it was established that wheat resistance to leaf rust pathogen is controlled by both dominant and recessive genes during their independent, complementary, polymeric, additive and epistatic actions and interactions. Using various genetic and biochemical approaches some attempts were made to study key genes responsible for resistance to wheat leaf rust pathogen [7,8]. In wheat, these genes are called “Lr” genes from the English “Leaf rust”. A number of effective Lr-genes of resistance to brown leaf rust pathogen is decreasing year by year. This is related to the fact that virulent biotypes and strains that can break this resistance appear in the pathogen as a result of sexual hybridization and other processes. A constant search for such genes is required. This approach is relevant and significant for breeding. To date, more than 65 leaf rust resistance (Lr) genes against the fungal pathogen Puccinia triticina have been described in common hexaploid wheat, tetraploid durum wheat and diploid wild wheat species [
Lr19 localized on the 7D chromosome is one of the few widely effective genes conferring resistance against brown leaf rust in wheat [
Lr19 translocation originally produce by Sharma and Knott [
Despite the virulence for the Lr19 gene, there are reports that in the last decade it has demonstrated high efficacy in wheat cultivation areas [17,21]. High efficacy of the Lr19 gene in Asia, Australia and Europe indicates that this gene can be used in combination with other Lr genes for long-term resistance to leaf rust all over the world [22,23].
On this basis, the objective of this study was to determine the presence of the Lr19 gene in different wheat genotypes using SCAR markers.
61 bread wheat genotypes (Triticum aestivum L.) from the genefund of the Research Institute of Crop Husbandry served as a research objects. Plants were grown in field conditions. SCAR markers were used for the screening.
DNA extraction was carried out using the CTAB method with some modifications [
The precipitate was washed several times with 70% ethanol, dried in a thermostat at 56˚C for 5 minutes and dissolved in TE buffer (10 mM Tris-HCl, pH 8; 1 mM EDTA). Samples were left in a refrigerator at 4˚C for the complete dissolution of the DNA in a buffer.
After dissolution of the DNA the quantity was determined by optical density (OD) at λ = 260 using the ULTROSPEC 3300 PRO spectrophotometer (“AMERSHAM”, USA). Purity of the genomic DNA was determined by the ratio of absorptions at A260/A280. Quality of the DNA was checked on the basis of performance of the extracted DNA samples in 0.8% agarose gel stained with 10 mg/mL of ethidium bromide in 1 × TBE (Tris base, Boric acid, EDTA) buffer. The gel was developed and photographed under ultraviolet light using “Gel Documentation System UVITEK” (UK).
Polymerase chain reaction was performed by Williams et al. [
72˚C; the final elongation cycle was performed at 72˚C for 10 min, then kept at 4˚C.
The reaction products were separated by electrophoresis in a 1.2% agarose gel in the HR-2025-High Resolution (“IBI SCIENTIFIC” US) horizontal electrophoresis system with addition of ethidium bromide and documented using “Gel Documentation System UVITEK”. Dimensions of amplified fragments determined with respect to 1kb DNA marker. Statistical analysis included binary matrix compilation for each of the primers, in which “presence” (+) or “absence” (−) of fragments with equal molecular weight on the electrophoregram were noted.
DNA samples from wheat (Triticum aestivum L.) from genefund of Research Institute of Crop Husbandry were screened using two SCAR molecular markers bound to a known Lr19 gene of resistance to brown leaf rust. SCAR markers are polymorphic and amplified unique bands linked to the Lr19 gene [
This marker must lead to the amplification of fragments of 688 bp in size. As a result of PCR test with this primer the locus of the 688 bp region was detected only in 48 genotypes. This is approximately 79% of all investigated genotypes.
Fragment linked to the SCS123F/R marker was not synthesized in the following genotypes—Pirshahin-1, Pactole, 8th WWEERYT (32 №), 3 RBWYT (521 №), 3 RBWYT (536 №), 11th IWWYT-R (9816 №), S5, 16th FAWWON-IR (90), 16th FAWWON-IR (47), S1, Nurlu- 99 Kyrmyzygyul-1, 12th FAWWON № 97 (130/21).
The second SCAR marker linked to the studied Lr19 gene of resistance to brown leaf rust was SCS253 F/R (5’ GCTGGTTCCACAAAGCAAA 3’/5’ GGCTGGTTCCTTAGATAGGTG 3’). Amplification products with the use of this marker are detected in the 737 bp region. As can be seen from
tigated genotypes. Fragments specific for the SCS 253F/R SCAR marker were not amplified in the following genotypes—3 RBWYT (521 №), Zirve-80, Gyrmyzy gul-1, S1, Azamatli-95, Tale-38, Ruzi-84 and 12th FAW-
WON № 97 (130/21).
Comparative analysis of PCR profiles obtained with the use of both SCAR markers demonstrates (
The results obtained with different markers did not match in 18% of genotypes. After using the SCS123F/R marker, nine genotypes (Pirshahin-1, Pactole, 8th WW-
*Note: [+]—the presence of the expected locus, [-]—the absence of this locus.
EERYT (32 №), 3 RBWYT (536 №), 11th IWWYT-R (9816 №), S5, 16th FAWWON-IR (90), 16th FAWWONIR (47), Nurlu-99) did not match, i.e. fragments in the 688 bp region specific for the SCS123F/R marker were not synthesized in these genotypes, on the contrary, the 737 bp fragments, linked with the SCS253F/R marker, were amplified. And this kind of mismatch was detected in three genotypes (Zirve-80, Azamatli-95, Ruzi-84) with the use of the SCS253F/R marker, in other words, amplification products specific for the SCS253F/R marker were absent in these genotypes, on the contrary, synthesis of PCR profiles specific for the SCS123F/R marker has successfully been performed.
The absence of marker components with the Lr19 gene in these samples may be due to an incomplete linkage of the marker and the gene [
Attention is drawn to the fact that resistance and high sensitivity to brown leaf rust are observed among the genotypes in which amplification products have not been revealed, thus indicating the absence of the Lr19 gene.
Gyrmyzy gul-1 wheat genotype in field conditions also demonstrates high susceptibility to the brown rust pathogen and is completely affected by the Puccinia recondite f. sp. tritici fungus. The genotypes called 3 RBWYT (521 №), S1 and Tale-38 in field conditions are estimated as moderately resistant to this disease. It is interesting that the 12th FAWWON № 97 (130/21) genotype actually demonstrates high resistance to this harmful disease, despite the absence of the Lr19 gene. Apparently, the resistance of this genotype may be caused by other Lr-genes.
The wheat cultivars are of different types and become susceptible to different types of rust because it has narrow genetic bases for resistance. The evolution rates of pathogens are very fast and rapid. So, it is necessary to find out new and better sources for resistance. The genetic resistance is important to control many phytopathogenic epidemics. The wheat production has been dependent on the use and development of rust resistance genotypes having well characterized and diverse genes. It is also concluded that, in wheat certain and different combinations of genes give long lasting and better resistance for rust diseases than given by any individual genes [16,27].
This work requires the continuation of the study. However, the material studied by us is a valuable source for wheat breeding for leaf rust resistance. Understanding the genetic regulation of resistance allows avoiding the possible use of the same donor gene in selection and developing the programs of rational use of high-effective genes of resistance. The obtained results can be used in breeding and genetic programs on creation of forms resistant to leaf rust pathogen populations in Azerbaijan. Thus, information about the existence of effective Lrgenes in adapted varieties that can be used as donors for resistance, and usage of these distinct genes or by pyramiding of different resistance genes in the genotype can significantly improve the efficiency of breeding of resistant varieties [