At the moment , we see a great interest for application of Anti Sense Oligonucleotides (ASOs) in order to regulate the expression of genes related to certain diseases. These nucleotides obtained a number of fascinating properties by means of chemical manipulation of natural DNA and RNA under conservation of Watson-Crick base-pairing. About 35 years ago for our research in this field , we selected synthetically (short) phosphate-methylated DNA and RNA. It was concluded that there is an exclusive selection in hybridization affinity with natural DNA and RNA. These (bio)chemical and physical-chemical properties are extensively published. ASOs have found their way in public health as is clearly shown in the treatment of (progressive) neurological diseases. We focus specifically on the past, present and future of the phosphate-methylated oligonucleotides, illustrated with different research studies in chemistry and biophysics. A new field of application of modified DNAs is based on interactive improvements of sensitivity and specificity of nanowire field effect transistor gene chip by designing phosphate-methylated DNA as probe.
It is known that Anti Sense Oligonucleotides (ASOs) are synthetically prepared (short) single-stranded deoxynucleotide sequences that can block the expression of specific target genes via complementary hybridization [
The present view is focused on current and future trends of backbone modified phosphate-methylated DNA and RNA. The published (bio)chemical and physical-chemical data demonstrate a number of exclusive properties. These oligonucleotides have shown enhanced duplex stability due to the decrease in electrostatic repulsion between the complementary strands. Manipulated modifications of these oligonucleotides may also cause steric effects (substitution of methyl by ethyl etc.) destabilizing the duplex. An aspect of these modified oligonucleotides is the introduction of chirality at phosphorus resulting in a mixture of diastereoisomers with deviating properties. More different kinds of duplexes can be derived from antiparallel right-handed DNA, non-Watson-Crick base-pairing of oligonucleotides [
In that respect it is noteworthy that the molecular structure of the ammonium salt of the natural d (CPG) in the crystalline state shows a Z-DNA helix, as was demonstrated by Ramakrishnan and Viswamitra [
In
The difference in chirality of phosphorus in the triester has no influence on the weight of the population densities of the rotamers. The characteristic syn- conformation of guanine in the Z-form was confirmed with nuclear double resonance. The hybridization stability of the diastereoisomers was obtained with the 1H NMR chemical shifts vs temperature profiles of the RP and SP configurations at a concentration of 3 × 10−3 M for the protons H6 (dC) and H1’ (dG) resulting in a melting transition with sigmoidal shape for these protons at 282 and 286 K, respectively. The corresponding phosphate-methylated d (GPC) duplex shows a transition of 300 K for both configurations. With UV hyperchromicity experiments with all four diastereoisomers at a concentration of 5 × 10−6 M sigmoidal curves were obtained with the corresponding transition values.
With the knowledge of the various chemical and physical parameters, optimal specificity may be achieved leading to further development into various modified nucleotides.
We focus on the past, present and future of the phosphate-methylated oligonucleotides, illustrated with different research studies in chemistry and biophysics.
A review article about the use of ASOs for vaccine improvement based on the strategy of antigen modification has recently been published [
using ASOs for antigen manipulation started in 1990. Goudsmit’s group used phosphate-methylated ASOs complementary to the tat responsive region (TAR) of the HIV-1 isolate CBL-4 (RUT) to reduce the viral infectivity [
The research strategy in the Science paper was focused on four target regions TAR, PBS, NEF, and VIF. The selection of the different regions was based on the hairpin loop (single stranded) structures with short RNA fragments. TAR is aimed at the loop area of the transactivator responsive region (bases 15 - 34 and 9132 - 9151), which is essential for transcriptional stimulation by the tat protein. PBS is targeted adjacent to the start site of reverse transcription (bases 162 - 181). NEF and VIF overlap the start codon of the genes for the regulatory protein nef (bases 8372 - 8391), and the infectivity factor vif (bases 4619 - 4638), respectively [
A highly favored structure based on this specific geometry element is TAR with 6 bases AGGGUC in the loop recognition. This was confirmed by the X-ray crystal structure of the TAR loop in complex with tat and the super elongation complex and determined at a resolution of 3.5 Å [
Unfortunately, in the HIV-1 RNA hybridization experiments 20-nucleotide phosphate-methylated DNAs were used, instead of the (much) shorter ones, which could also be prepared non-automatically, vide infra. The common opinion at that time was that specific inhibition should be more effective with increase of the number of bases, whereas the difference in geometry between the hybridizing nucleotides was the fundamental barrier for duplex formation between phosphate-methylated DNA with B-geometry and HIV-RNA with A-geo- metry, vide supra.
Still the question remains how to place this research on the synthesis of the longer phosphate-methylated DNA in time. For that crucial part we refer to the hexamer phosphate-methylated pyrimidines d (TO=POCH3TO=POCH3TO=POCH3TO=POCH3TO=POCH3T) and d (CO=POCH3CO=POCH3CO=POCH3CO=POCH3CO=POCH3C)), and specifically their formation of parallel duplexes via T-T and C-C base pairs [
It seems to us that these results clearly show that formation of parallel DNA duplexes is not simply a matter of shielding of the phosphate-phosphate electrostatic repulsion alone. Apparently the way of accommodation of the methyl groups for both possible configurations on phosphorus together with elimination of phosphate-phosphate repulsions between both strands are decisive with respect to the formation of a parallel DNA duplex.
Based on solution-phase chemistry, the phosphate-methylated dinucleotides d (TO=POCH3T), d (CO=POCH3C), and d (TO=POCH3C) were prepared with both SP and RP configurations. All accept the SP configuration for parallel accommodation and d (TO=POCH3T) also for the RP configuration [
Even under natural conditions (peptide induced) similar observations for the parallel pyrimidine-pyrimidine bases were made [
Exclusive behavior has been established for d (CO=POCH3G) and d (GO=POCH3C). A left-handed Z-DNA and a right-handed B-DNA, respectively, are formed irrespective of the SP and RP configuration, vide supra. For the phosphate-methy- lated RNA dimer r (CO=POCH3U) only the SP configuration forms a parallel duplex [
This data clearly shows that introduction of a methyl group as phosphate- methylated in DNA and RNA introduces conformational transitions in the backbone, which results, as clearly demonstrated, in a left-handed DNA structure through base adaptation of C and G in an anti- and syn-orientation, respectively.
In most cases the 9-fluorenylmethoxycarbonyl (Fmoc) group was used as the protecting group for the bases [
The choice of the interacting phosphate-methylated dCn with natural dGk, and phosphate-methylated dAn with dTk is based on the results obtained for the parallel duplexes of the phosphate-methylated hexamers dC6 and dT6. The reversed combination for phosphate-methylated dTn with natural dAk is not possible. For
that case we must add an extra number of phosphate-methylated dCs at the beginning or at the end of the strand in question, as demonstrated with the phosphate-methylated dodecamer d (C6T6) present in the single-strand form, vide supra.
From earlier publications it is demonstrated that phosphate-methylated DNA hybridizes more strongly with natural DNA in comparison with phosphate-ethy- lated DNA and methyl phosphonate DNA [
In fact this approach is related to the ability of enzymes to disclose genetic information in the interior of double-stranded DNA. At a first glance it is the enzyme with its positively charged residues, such as lysine and arginine, interacting with the negatively charged phosphate groups that promotes duplex stability. As we mentioned before, the inter-strand repulsion decreases whereas the intra-strand repulsion in one strand is still present resulting in conformational difference between both strands favoring DNA destabilization. Apparently, involvement of one-side interacting enzymes does not result in a cooperative mechanism. So there is a fundamental difference in conformational transmission between covalent and ionic bonding of the natural DNA.
Phosphate-methylated DNA as 8- and 18-mer has been prepared in a study of the regiospecific inhibition of DNA duplication. The procedure for relatively long fragments was based on the following reaction sequence:
natural DNA (solid-phase) → base-protection → phosphate-methylation → base-deprotection
The base-protection was carried out with the Fmoc group [
The E. coli pab B gene, coding for para-aminobenzoate synthetase, inserted in the M13mp18 phage was used as template for a phosphate-methylated 18- and 8-mer (concentration 3 × 10−6 M), complementary to a pair of selected template regions. The relative synthesis activity along the template strands shows a sharp decrease precisely at the selected region (s) downstream of natura d (AGTAATCACAGCGGGAGA), complementary to the 14 - 31 region: -TCTCCCGCTGTGATTACT-, used as the primer for the sequencing reaction. The corresponding phosphate-methylated DNA was unable to act as a primer for Klenow DNA polymerase I. Thus, the Klenow fragment fails to recognize the modified DNA as primer. An arbitrary selected phosphate-methylated d (CTGCTAGAGATTTTCCACAC) has, as to be expected, no impact on the progress of the synthesis. The activity as measured for the 18- and 8-mer at room temperature and 0˚C respectively, is shown in
In order to quantify the effect of the inhibition, the density of each band of the sequencing pattern was measured optically. The stop of any synthesis activity after the inhibition region is the result of the absence of a natural primer. For the progress of the duplication after the inhibited regions, the phosphate-methy- lated DNA should be coupled with a natural fragment complementary with the
nucleotide sequence of the template. This aspect that obtained not much attention in the anti-sense dynamics, may have its repercussions for other neutral backbone-modified DNA’s as e.g., methylphosphonates. In that respect it is of interest to take notice of investigations of Song et al., based on structural/sequence motifs in interruption processes of duplication [
We also took under consideration processes in relation to the understanding and development of simple DNA and RNA models based on medical treatment, as has been recently suggested in a statement in Science under Public Health: The goal is to steer clear of expensive, complex strategies that require stem cell transplantation, and instead develop affordable, easily administered therapies that would replace or edit genes in the body [
In the mid-eighties we started with DNA-based treatments using short well- characterized phosphate-methylated trimers as d (AO=POCH3AO=POCH3A). With UV hyperchromicity we found a Tm-value of 314 K for the duplex of the phosphate-methylated trimer with poly (dT) and 293 K for the natural trimer with poly (dT). In a preliminary experiment we studied the reduction of rat fibroblast cells and the inhibition of human ovarium malign cells. With fibroblast cells with 10−5 M trimer the DNA synthesis is markedly retarded with 80% inhibition (monitored by 3H-thymidine uptake). For the inhibition of the ovarium cells the inhibition was 15% - 20% with 15 × 10−5 M trimer. In the case of E. coli with different cell types complete inhibition was obtained with 10−4 M. Generally, elongation of the nucleotide will surely enhance selectivity. At that time we had no specific information about the base-sequence of the target DNA. These preliminary experiments are briefly described [
Today these ASOs are of importance for the fight against progressive neurological diseases. We will give special attention to the spinal muscular altrophy (SMA), because correspondence with our model systems. SMA refers to several different motor neuron diseases. It is most commonly associated with mutations in the survival motor neuron 1 (SMN1) gene. These mutations are the most frequent genetic cause of death in children. Humans possess a second SMN gene, SMN2. SMN2 and SMN1 are related by an inverted gene duplication. SMN2 contains a C-to-T mutation in exon 7 that redirects alternative splicing to exclude exon 7 and leads to an unstable mature protein that cannot substitute for mutant SMN1. The ASOs are composed of phosphorothioate and 2ʹ-O-metho- xyethyl that binds to SMN pre-mRNA to direct alternative splicing and increase inclusion of exon 7 in SMN2. This results in an increase of SMN protein active. For the complete description of these processes: see Corey [
In contrast with the natural phosphodiester linkages the phosphorothioate modification demonstrates a high degree of metabolic stability and an improved cellular uptake. Corresponding observations have been mentioned for phosphate-methylated DNA and RNA, vide supra. The latter system shows an additional property based on the absence of phosphate-phosphate repulsion in their duplex formation with its complementary strand, vide supra. An illustration of both modified RNAs is given in
From
From earlier data on nucleoside phosphorothioate anions the structural formulas show a double bond between phosphorus and sulfur and a single bond between phosphorus and oxygen with a negative charge localized on oxygen. However, a review of physical data on these compounds resulted in a P-S bond with a single bond and negative charge localized on sulfur, while the P-O bond order for exocyclic and nonbridging oxygens is greater than 1. These conclusions were based on bond lengths obtained from X-ray crystallographic data and
the magnitudes of the effects of magnetic resonance chemical shifts of phosphorus with labeled oxygens.
In more advanced MO calculations on e.g. thiobenzophenone it could be calculated that the pronounced electron density on sulfur is the consequence of the relatively small one-center electronic repulsion integral compared with oxygen. With spectroscopic measurements it could be shown that protonation on sulfur resulted in a reduction of the electron donating tendency of SH in comparison with protonation on oxygen resulting in a more pronounced effective charge delocalization of the SH-carbenium ion than for the OH-carbe- nium ion.
Recently in Science under Insights and Perspectives, promising clinical results have been documented and described: With a growing number of ASO therapeutics being tested in clinical trials, this exciting technology holds the potential to change the therapeutic landscape for many neurological and non-neurological conditions (including cancer, and cardiovascular, infectious, and pulmonary diseases) in the near future [
It should be emphasized that various physical-chemical aspects are of importance and specifically the molecular conformations of the interacting modified nucleotides.
The recent results obtained in the eastern part of the world opens a unique facility to compare with the (synthetic) work discussed before.
In fact today the partially and fully phosphate-methylated DNAs can be prepared in various length under solid-phase conditions, as has been recently published [
NH2-C6-CO=POCH3AO=POCH3CO=POCH3AO=POCH3CO=POCH3TO=POCH3CO=POCH3TO=POCH3GO=POCH3TO=POCH3CO=POCH3AO=POCH3AO=POCH3CO=POCH3CO=POCH3 TO=POCH3AO=POCH3C
NH2-C6-CO=POCH3A-CO=POCH3A-CO=POCH3T-CO=POCH3T-GO=POCH3T-C-A-A-C-C-T-A-C
NH2-C6-CO=POCH3A-C-AO=POCH3C-T-CO=POCH3T-G-TO=POCH3C-A-A-C-C-T-A-C
The corresponding modified RNA systems with an additional modification at the 2'-position (ribose sugar) are of great importance for increased selectivity in the context of treatments based on ASOs. Recently, a new RNA virus was detected known as the Coronavirus (COVID-19). It is an acute respiratory tract infection [
It is well known that the PCR technique is used for the detection and quantification of nucleic acids.
In order to improve specificity and sensitivity, various types of nucleotide-derivative modifications have been introduced, such as peptide nucleic acid (PNA), locked nucleic acid (LNA), and more recently site-specific phosphate- methylated DNA as primer and probe by Lee et al. [
An interesting new field is the use of interactive improvements of sensitivity and specificity of nanowire field effect transistor gene chip by designing neutralized DNA, phosphate-methylated DNA, as probe in a whole range of experiments with phosphate-methylated DNAs [
This study was focused on specific trends of the preparation and application of Anti Sens Oligonucleotides (ASOs) in different fields of bio- and medical chemistry. We restricted our scope to a study started 35 years ago on phosphate-me- thylated DNA and RNA. These oligonucleotides have shown enhanced duplex stability due to the decrease in electrostatic repulsion between the complementary strands. With different physical and biochemical methods it could be concluded that there is an exclusive selection in hybridization affinity with natural DNA and RNA. These (bio)chemical and physical-chemical properties are extensively published. ASOs have also found their way in public health, as is clearly shown in the treatments of various diseases as (progressive) neurological disorders. These ASOs are composed of phosphorothioate and 2'-O-methoxyethyl. In our opinion the phosphate-methylated RNA (see
A fundamental aspect in this approach of hybridization is the possibility for inducing a cooperative behavior of the complementary natural strand by the phosphate-methylated DNA. This aspect has been clearly demonstrated in
In fact today, the partially and fully phosphate-methylated DNAs can be prepared in various length as has been recently published [
An interesting approach has been (recently) published by Paul et al. concerning a new route for preparing phosphate-methylated DNAs [
From recent publications, it is to be expected that phosphate-methylated DNA obtains new perspectives in the field of genetic diagnosis and medical treatments. Generally, nanoelectronics is an important step forward in biology and medicine.
Finally, it is of particular interest to mention the influence of synthetic biology in this field especially focused on the synthesis of the phosphate-methylated DNAs (RNAs). Recently the encoded synthesis of a genetic polymer with an uncharged backbone was published as alkyl phosphonate nucleic acids [
However, in methyl phosphonates it appears that the presence of a P-C bond disturbs the helix conformation for stereoelectronic reasons. This leads to a weaker hybridization with DNA and RNA for n > 4: see
The author declares no conflicts of interest regarding the publication of this paper.
Buck, H.M. (2020) Phosphate-Methylated Oligonucleotides Past, Present and Future. Journal of Biophysical Chemistry, 11, 27-42. https://doi.org/10.4236/jbpc.2020.113003