American Journal of Plant Sciences, 2011, 2, 539-548
doi:10.4236/ajps.2011.24064 Published Online October 2011 (http://www.SciRP.org/journal/ajps)
539
DNA Sequence-Based Markers for Verification of
Ramet-to-Ortet Relationship in Oil Palm (Elaeis
guineensis Jacq.)
Claude Bakoumé1, Mohamad Y. Aziah2, Tangaya Praveena1, Chee Keng Teh2, Yahya Suzaini2, Musa
Hamidah3, Mohamad S. Jangi1, Mohd N. Basiran1, Hashim Khairudin2, Kulaveersingam Harikrishna1
1Sime Darby Technology Centre, Serdang, Selangor, Malaysia; 2Sime Darby R & D Centre, Banting, Selangor, Malaysia; 3Sime
Darby Biotechnology Laboratory, Port Dickson, Negeri Sembilan, Malaysia.
Received July 3rd, 2011; revised August 15th, 2011; accepted August 28th, 2011.
ABSTRACT
Since oil palm (Elaeis guineensis Jacq.) does not breed true, tissue culture-derived material is the resource of choice
for achieving oil palm homogeneity in terms of growth and yield. Currently, no genomic tagging method is available
with which one could verify the ortet (tissue donor oil palm) from which the clonal planting material (ramets) origi-
nated, particularly in cases of unsatisfactory performance. Thus, Sime Darby Plantation used 10 genomic microsatellite
markers to genotype 8 sets of 5 ramets +1 ortet and 2 single ortets. The average genetic distance (D) among oil pa lms
from the same set of ramets and ortet was 0.0000 with the exception of sets containing off-type ramets (D = [0.0834 -
0.1505]). The dendrogram showed that the ramets and their ortet of origin formed a sub-cluster, confirming their simi-
larity. The 10 microsatellite markers were valuable to Sime Darby as tools for verification of ramet-to-ortet relation-
ships and for the identification of off-types. Furthermore, the set of 10 markers revealed a high expected heterozygosity
(He = 0.634) that is a high expected heterosis effect on which yield depends.
Keywords: Tissue Culture, Ramet-to-Ortet Relationship, off-Type Ramet, Genetic Diversity, SSR Markers, Sime Darby
Plantation
1. Introduction
Despite all the efforts devoted to producing high oil-
yielding planting materials, a high level of heterogeneity
prevails among plants and contributes to leveling yield to
values which maintain the gap with the theoretical yield.
In fact, the heterogeneity is characteristic to seed-derived
planting materials of most plant species. In Malaysia, oil
yields of 14.9 t/ha have been obtained from the best indi-
vidual palms of progeny trials [1]. Unfortunately, oil
palm trunk has fibrous-like structure composed of nu-
merous vascular bundles, is cambium-less and possesses
one unique vegetative meristem, rendering the replication
of elite oil-yielding palms by cuttings or grafting impos-
sible. Furthermore, the nonexistence of fully inbred lines
is another limitation to the propagation of elite oil-
yielding oil palms [2]. Thus, clonal propagation of oil
palm via tissue culture allows a fast production of elite
palms that offer uniformity with high oil yield [3],
among other traits. Tissue culture can be a good route for
mass production of disease-tolerant planting materials
from single tolerant palms.
Cloning of oil palm consists of inducing somatic em-
bryogenesis on calli derived from young and immature
cabbage leaves. The oil yield of the best clones is esti-
mated at 21% - 25% more than that of seed-derived
planting materials [4-8]. One undesirable feature associ-
ated with clonal oil palms is the floral abnormality,
known as “mantling”, that transforms the stamens of both
male and female flowers into carpels, inducing the decay
of female inflorescences as fruits that are formed are
usually aborted [9], thus directly affecting oil production
[10]. In general, the rate of abnormality varies from one
tissue culture laboratory to another. With a view to re-
ducing the production of abnormal clones to economi-
cally viable levels, some preventative measures have
been proposed including: i) the cloning of seedlings [11],
ii) limitation of the production of clones from each em-
bryogenic callus [2] or iii) adoption of low hormone me-

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
540
dia coupled with high culling rates [12]. Despite the flo-
ral abnormality associated with oil palm tissue culture,
public interest in oil palm clones remains high. Usually,
planters acquire clonal planting materials from different
oil palm tissue culture laboratories. Thus, traceability of
clones becomes an issue in those cases where the yields
are below expectations. Concurrently, tissue culture labo-
ratories would also like to be able to detect off-types,
which cannot be identified by the naked eye.
In this article, we assess the capacity of a set of mi-
crosatellite markers to verify ramet-to-ortet identity and
detect off-type oil palm clones produced by Sime
Darby’s tissue culture laboratory. Microsatellites or sim-
ple sequence repeats (SSRs) are tandem arrays of simple
nucleotide motifs that are ubiquitous components of eu-
karyotic genomes [13]. They are highly polymorphic,
owing to variation in the number of repeats [14]. They
show co-dominant inheritance, allowing discrimination
of homo- and heterozygous states. Furthermore, they are
locus-specific (one locus per primer pair), and the poly-
morphic information content (a measure of discrimina-
tion ability) is higher than that of RFLPs [15]. SSRs have
been successful in the monitoring of the uniformity of
different embryoid lines from a single oil palm clone
[12].
2. Materials and Methods
2.1. Plant Material
A total of 48 leaf samples from oil palms representing 8
sets of 5 ramets + 1ortet were used in the study. The
word ortet refers to an oil palm whose tissues have been
collected and used for clonal propagation. A ramet is a
clonal seedling at the nursery stage. The small number of
sets tested is a result of the relatively few original
sources of commercial oil palm planting materials. Some
of the sets contained from one to three blind contami-
nants (off-type ramets in the context of ortet-to-ramet
filiation). The tissue culture laboratory added off-type
ramets to some of the sets to check the usefulness of the
SSR marker combinations in identifying off-types. Two
more single ortets whose ramets were not available were
added in the assessment of the genetic diversity expected
within clonal materials exposed to various constraints in
the field. The 10 ortets were among the highest yielding
tenera oil palms from field 91A of Ampar Tenang Estate
and field 96A of Bukit Pelandok Estate, planted in 1991
and 1996, respectively. Field 91A, located in Serdang,
had a local alluvium soil series. The mean annual rainfall
was 2215 mm over 127 rainy days, on average, from
1999 to 2008. During the same period, field 96A, with a
local alluvium soil series, averaged a yearly rainfall of
1815 mm over 110 rainy days. The oil palm ramets were
raised at Bukit Talang Estate on Jawa soil series where
2145 mm of rainfall over 124 rainy days was recorded
annually, on average, from 1998 to 2008. Details of the
ramets and ortets are presented in Table 1.
DNA extraction from 3 g of fresh leaf tissues and pu-
rification of genomic DNA samples were performed ac-
cording to Doyle and Doyle [16] with minor modifica-
tions. Chloroform:isoamyl alcohol (24:1, v/v) was used
twice for improved removal of cell wall debris, denatured
protein and polysaccharides. The DNA pellet was
washed twice with a wash buffer (76% ethanol, 10 mM
ammonium acetate). The concentration of DNA for each
sample was determined using a NanoDrop 2000 spec-
trophotometer (NanoDrop Technologies Inc., USA) us-
ing 2 μl of diluted DNA sample. One aliquot of 100 µl at
10 ng/µl DNA concentration was prepared per sample
and stored at 4˚C for SSR analysis.
2.2. Microsatellite Analysis
A set of 10 E. guineensis SSR loci isolated by the French
Centre de Coopération en Recherche Agronomique pour
le Développement (CIRAD) and fluorescently labeled
was used for the present study. The 10 SSR loci repre-
sented 7 linkage groups out of 16, hence covering 44% of
the oil palm genome. Table 2 presents the characteristics
of the SSR loci.
The PCR amplification of genomic DNA was per-
formed according to Billotte et al. [17] using 12.5 l of
final reaction volume containing 25 ng of genomic DNA,
1 × PCR buffer (10 mM Tris HCl, pH 9.0, 50 mM KCl
and 0.1% Triton® X-100), 1.5 mM MgCl2, 200 µM of
each of the 4 deoxynucleotide triphosphates (dNTPs), 0.5
Unit of Taq DNA polymerase (Promega, USA), 0.2 µM
of each primer, and sufficient deionized distilled water
(dd H2O) to bring the total volume to 12.5 µl. PCR am-
plifications were performed in a MJ Research Gradient
Cycler (MJ Research, USA). The PCR programme pro-
tocol was as follows [17]:
Step 1 Denaturation at 94˚C for 5 minutes
Step 2 Denaturation at 94˚C for 30 seconds
Step 3 Annealing at 52˚C for 1 minute
Step 4 Elongation at 72˚C for 1 minute
Steps 2 to 4 repeated 35 times, then
Step 5 Elongation at 72˚C for 8 minutes
Step 6 Storage at 4˚C for 24 hours
PCR amplicons were separated by size via electropho-
resis in an ABI System 3730 xl DNA Analyzer (Applied
Biosystems, USA). The system effectively identifies po-
lymorphic microsatellite alleles with a sizing precision of
t least 0.15 bp. The alleles were sized with reference to a

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
541
Table 1. Ortets selected from commercial oil palm plantations and their respective ramets.
Set number Ortet Ramets Plantation or nursery locationSet numberOrtet Ramets Plantation or nursery location
1 GBL 7 (ort8) Bukit Pelandok 5 GBL 34C (ort6) Ampar Tenang
R8-1
R8-2*
R8-3
R8-4
R8-5
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
R6-4
R6-5
R6-7
R6-9
R6-10
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
2 GBL 8 (ort2) Bukit Pelandok 6 GBL 35C (ort7) Ampar Tenang
R2-1
R2-2
R2-3
R2-4
R2-5
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
R7-1
R7-2
R7-3
R7-4
R7-5
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
3 GBL 13 (ort4) Bukit Pelandok 7 GBL 37C (ort11) Ampar Tenang
R4-1
R4-4
R4-7
R4-8
R4-10
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
R11-1*
R11-2
R11-3
R11-4
R11-5
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
4 GBL 18 (ort1) Bukit Pelandok 8 GBL39C (ort13) Ampar Tenang
S1-3
S1-4
S1-6
S1-7
S1-9
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
R13-1*
R13-2*
R13-3*
R13-8
R13-10
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Bukit Talang
Single GBL 10 (ort9) na Single GBL398C (ort14)na
Serial numbers of ortets are given in parentheses; ort1: ortet number 1; R8-1: ramet 1 from ortet 8; *: off-type; na: not available.
Table 2. Repeats, primer sequences and expected allele sizes of the 10 SSR markers.
Microsatellite loci Motif Primer sequences (5’-3’) Linkage groupReference allele size (bp) Annealing temperature (˚C)
mEgCIR0037 (GA)17 CCAGTCTGCTAACCATCCTATAC3 175 52
mEgCIR0195 (GA)21 CCCACCACCCCTAGCTTCTC 6 255 52
mEgCIR0254 (TA)4(GA)18 CCTTTTGTGCTTTCTTC 7 156 52
mEgCIR0257 (GA)17 GCAGCTAGTCACCTGAAC 1 286 52
mEgCIR0408 (CCG)5 TTGCGGCCCATCGTAATC 2 193 58
mEgCIR0425 (CCG)9 AGCAAGAGCAAGAGCAGAACT 3 232 58
mEgCIR0783 (GA)15 GAATGTGGCTGTAAATGCTGAGTG6 296 58
mEgCIR0790 (GA)19 TTGGTGGTCCTTTTGAATATC 12 215 52
mEgCIR0802 (GA)12 CTCCTTTGGCGTATCCTTTA 1 217 52
mEgCIR0825 (GA)21 AGTGAGGTATGGTTGATTAGGA10 200 52
GS500, a formamide containing red DNA size standard
(Applied Biosystems, USA). Alleles were generated in
the form of electropherogram, where the X-axis scaled
the allele sizes in bp and Y-axis the peak intensities.
Electropherogram profiles were collected using Data
Collection software version 2.0 and the alleles were sized
and genotyped using GeneMapper version 4.0 software
(Applied Biosystems, USA). Decimal values were
rounded to the nearest unit.
2.3. Data Analysis
The genotype data were used to study the similarity of
the ramets to the ortets and also the identity of one ramet
to another, based on estimates of genetic distance [18]. A
cluster analysis was performed using the unweighted pair
group method with arithmetic (UPGMA) clustering
method [19] for a better visualization of the grouping of
ortets and derived ramets. Genotypic data from the 10
ortets were used to estimate i) the number of alleles per

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
542
locus (Ao), ii) the observed heterozygosity (Ho) [20],
which is the amount of heterozygosity observed at a sin-
gle locus or an average over several loci, and iii) the ex-
pected heterozygosity (He) [21], which is an appropriate
measure of genetic variability in inbred populations with
very few heterozygotes and several homozygote types.
The data analysis was carried out by PowerMarker pro-
gramme [22].
3. Results
3.1. Allele Detection and Genetic Distances
Alleles were generated in a form of peak intensities on
the electropherogram. Homozygote individuals showed a
unique peak while heterozygote showed two peaks (Fig-
ure 1). The number of alleles per locus varied from 2 at
the SSR marker mEgCIR048 to 6 at mEgCIR257 (mean
= 4.2). The ramet R11-1 revealed unique alleles at SSR
markers mEgCIR0037, mEgCIR0257, mEgCIR0790, and
mEgCIR0802, and unique genotypes at SSR markers
mEgCIR0254, mEgCIR0425, mEgCIR0790, and mEg-
CIR0802.
The average genetic distance among oil palms from or-
tet-ramet sets was 0.0000 for 5 out of 8 sets used. The ge-
netic distance within sets varied from 0.1672 in the set No.
7 to 0.6500 in the set No. 1 in sets containing off-type
ramets. The genetic distance between the ramets R13-1,
R13-2 and R13-3, off-types from set No. 8, was zero. They
may have originated from the same ortet. Similarly,
the genetic distance between the ramet R8-2, an off-type
in the set no.1, and the ortet and ramets from the set No.
3 was zero (Table 3). The lowest value (0.2000) of ge-
netic distance among ortets was observed between ortet 1
and ortet 4, the highest (0.8500) between ortet 1 and ortet
11, and the mean was average (0.5308). The mean values
of the genetic distance between an ortet and its ramets
varied from 0.0834 to 0.1505 in the other three sets,
which contained off-type ramets (Table 4).
The UPGMA clustering of ortets and ramets based on
genetic distance [18] (Figure 2) showed 10 sub-cluster
branches, 8 of which grouped ramets with their ortet of
provenance while the other two sub-clusters were formed
by the off-type ramets: one by R11-1 (sub-cluster II) ini-
tially attributed to the set 7, which individualized earlier
in the dendogram, and the second, the sub-cluster III
grouping three off-types initially attributed to set 8 from
which it separated later to form two different sub-clusters.
The off-type ramet R8-2, which originally derived from
ortet 8, joined sub-cluster VII (set 3 from ortet 4).
3.2. Genetic Diversity among Ortets
All the 10 microsatellite markers used in this study
yielded amplification products. A total of 37 alleles were
detected among the 10 ortets. The mean number of al-
leles (Ao) within ortets was found to be 3.7, varying from
two for microsatellite loci mEgCIR095 and mEg-
CIR0408 to 6 for locus mEgCIR0783 (Table 5). Based
Figure 1. Electropherogram showing two peaks (or two alleles) for a heterozygote oil palm and one peak (one allele) for a
homozygote at the microsatellite marker mEgCIR0405.

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)543
Table 3. Nei & Takezaki’s
[
18
]
g
enetic distances amon
g
ortets and ramets.

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
544
Values of genetic distance between an off-type and other members of these same putative set are shaded.

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
545
Table 4. Average genetic distance within ortet-ramets sets.
Set No. Ortet Number of
ramets
Number of
off-type rametsDA
1 GBL 7 (ort8) 5 1 0.1259
2 GBL 8 (ort2) 5 0 0.0000
3 GBL 13 (ort4) 5 0 0.0000
4 GBL 18 (ort1) 5 0 0.0000
5 GBL 34C (ort6) 5 0 0.0000
6 GBL 35C (ort7) 5 0 0.0000
7 GBL 37C (ort11) 5 1 0.0834
8 GBL 39C (ort13) 5 3 0.1505
Ort1: ortet number 1, DA: Nei & Takezaki’s [18] genetic distance.
Table 5. Genetic variability parameters within ortets.
SSR loci Ao H
o H e
mEgCIR0037 5.0 0.900 0.690
mEgCIR0195 2.0 0.200 0.480
mEgCIR0254 4.0 0.900 0.715
mEgCIR0257 3.0 0.700 0.595
mEgCIR0408 2.0 0.200 0.500
mEgCIR0425 3.0 0.700 0.620
mEgCIR0783 6.0 0.800 0.765
mEgCIR0790 5.0 0.700 0.765
mEgCIR0802 3.0 0.600 0.645
mEgCIR0825 4.0 0.600 0.565
Mean 3.7 0.630 0.634
on the dinucleotide composition there were two classes
of microsatellites, including perfect and compound mi-
crosatellites. No clear relation was observable between
the two classes and the number of alleles per locus in the
study. The observed heterozygosity (Ho) varied from
0.200 for SSR markers mEgCIR0195 and mEgCIR0408
to 0.900 for SSR marker mEgCIR0037 (mean = 0.630).
The expected heterozygosity (He) ranged from 0.480 for
SSR marker mEgCIR0195 to 0.765 for SSR markers
mEgCIR 0783 and mEgCIR0790 (mean = 0.634). The
values of heterozygosity obtained are not related to the
number of alleles at the microsatellite locus. Few alleles
at a locus lead to high value heterozygosity because or-
tets were heterozygote for the loci used.
4. Discussion
4.1. Ramet-to-Ortet Genetic Relationship
The high polymorphism of the microsatellite markers
used (i.e. their capacity of revealing even a single nu-
cleotide difference among DNA sequences from closely
related genotypes) allowed the detection of differences
within ortet-ramet sets. The visualization of the geno-
typic data showed that the ramet R11-1 from set No. 7
was distinct from the ortet and ramets of its putative set
as well as from the rest of the ortets and ramets studied.
In fact, this ramet got showed unique alleles and unique
genotype at certain microsatellite loci, indicating that it
was not only an off-type but also not derived from the
tissue culture. The ramets R8-2 from set No. 1 and R13-1,
R13-2, R13-3 from set No. 8 differed from those of the
rest of the members of their respective sets, showing that
they were intruders. Cochard [23] also identified ille-
gitimate genetic configurations among oil palms as a first
step of his study of the legitimacy of oil palm breeding
populations through a visual comparison of genotypic
data from a microsatellite analysis.
The genetic distance is a measure of the amount of
genetic and is useful for grouping of populations or indi-
viduals [24]. In the present study, the genetic distance
among ortets and ramets should be understood as the
degree to which the various alleles do not occur equally
in the oil palms studied. The statistic of Nei and Takezaki
[18], also known as Nei and Takezaki’s genetic distance
(DA), varies from 0 to 1 with 0 meaning total similarity
and 1 total divergence. Thus, for the sets 2, 3, 4, 5, and 6
where the within DA was zero, the ramets derived from
tissues collected from their respective ortets. The ramet
R8-2, which showed total similarity (DA = 0) to ortet and
ramets of the set No. 3, probably derived from the culture
of tissues collected from the ortet ort4. The ramets R13-1,
R13-2, and R13-3 did not derive from the ortet ort13.
Nevertheless, the genetic distance among the three
ramets was zero, suggesting that they derived from the
same ortet, one not represented in this study.
For a further understanding of the relations between
ortets and ramets, the cluster analysis yielded a dendo-
gram according to Nei and Takezaki [18]. In this den-
drogram the ramet R8-2, initially included in set no. 1, is
seen to be finally joined to the sub-cluster of its ortet of
provenance (ortet ort1). It is most likely that the ramets
R13-1, R13-2, and R13-3, whose sub-cluster is on the
same branch as the sub-cluster of its putative set 3,
probably derived from an ortet closely related to the ortet
ort13. The dendogram confirmed the uniqueness of ramet
R11-1. It has no relationship with any of the ortets used
in this study. Cochard [23] also found some incoherence
as regards the legitimacy of materials from breeding pro-
gramme via use of the software Structure which also al-
lows visualization of the relationships among oil palms
used as genitors and their putative ascendances.
According to Corley [25], the number of markers
eeded for identification purposes might be fewer than n

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
546
Figure 2. UPGMA clusteri ng of ortets and ramets based on genetic distance over 10 SSR loci. R2-4: 4 th ramet derive d from
ortet number 2, ort2: orte t number 2, S1: ortet number 1, S1-3: 3rd ramet derive d fr om ortet number 1.
five due to their high polymorphism at the locus level.
Rajinder et al. [12] obtained satisfactory separation of six
ortet-ramet sets using five SSR loci. Limitation of the
number of SSR markers to be used for clonal identifica-
tion and detection of off-types to 5 is justified given the
tedious nature of the procedure for the development of
SSR markers in general and particularly for oil palm. The
procedure involves the building of microsatellite-en-
riched genomic libraries, following a hybridization-based
capture methodology using labeled microsatellite oligo-
probes and sequencing of microsatellite-containing se-
quences [26]. Another concern is with the related high
cost of SSR marker development. Nowadays, with the
availability of the oil palm genome sequence, microsatel-
lite motives are identified through bioinformatics data
mining and primers designed accordingly, easing the
development of SSR markers and reducing its cost. Fur-
thermore, microsatellites are amenable to high-through-
put from DNA extraction to the scoring of amplicons so
that large numbers of markers can be analysed with large
numbers of samples. Comparing genotypes at 10 SSR
loci representing 7 linkage groups (or chromosomes) out
of 16 would be more comprehensive because they cover
almost half of the oil palm genome.The set of SSR
markers used demonstrated a strong capacity for identi-
fying off-type ramets, so it can contribute to the certifica-
tion of the purity of commercial clonal planting materials.
In fact, culture mixtures inevitably happen, given the

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)547
large number of cultures handled in the tissue culture
laboratory [12]. Thus, the success of the 10 SSR loci
used in showing ramet-to-ortet relationships and clear
identification of off-type ramets confirms the main ex-
pectation of the study.
4.2. Genetic Variability within Ortets’ Clonal
Progenies
Clonal progenies are duplicates of an ortet. Thus, the
genetic variability within ortets well reflects the genetic
variability among their clonal progenies. The average
number of alleles (Ao) per locus is one of the genetic di-
versity measures commonly used. The Ao found among
the 10 ortets studied is relatively high. In a previous as-
sessment of the number of alleles per locus over 21 ac-
cessions of oil palms from 7 African countries and one
Deli dura using 21 microsatellite loci, the Ao was equal
to 5.3 [17]. Bakoume et al. [27], using 16 SSR markers,
obtained 13.1 alleles per locus over 494 oil palms repre-
senting 45 native oil palm populations from 10 African
countries, three breeding populations and one semi-wild
collection material. A lower value of Ao found in the 10
ortets, all of tenera oil palm type, could have been ex-
pected. In fact, both the dura and the pisifera, parents of
the hybrid (tenera), have a narrow basic allelic diversity.
Dura populations (female parents) trace their descent to
only four original palms introduced in 1848 in Bogor,
Indonesia [28]. Pisifera populations (pollen donors) are
derived from only two palms, notably SP540T “Djongo”,
the best selected in the Palmeraie de la Rive at Eala,
Democratic Republic of Congo. Furthermore, selection
carried out over years in both the dura and pisifera
populations has led to inbreeding and elimination of cer-
tain alleles. However, it should be noted that the rela-
tively low Ao value detected in the present study could
also be related to the small number of ortets available.
Despite the low mean number of alleles per locus, the
values of observed (Ho) and expected (He) heterozygosi-
ties were 0.630 and 0.634, respectively. The He value
was 0.68 within 21 accessions of oil palm belonging to 7
African countries using 21 SSR markers [17] and, using
16 SSR markers, 0.644 within 49 natural oil palms
populations from Africa, breeding populations, and semi-
wild material [27]. Despite the low mean number of al-
leles per locus, the value of He found in this study could
be considered high. This value is congruent with breed-
ers’ objective of getting as high heterogosity as possible
in tenera hydrids released to oil palm growers. A high
value of He implies high heterosis on which oil palm
yield depends.
The high He value found among ortets should be ex-
pected among their clonal progenies. The high genetic
diversity found in oil palm can explain its plasticity as
regards its adaptation to various environments and to its
actual large distribution area [29]. Some of the heterotic
allelic combinations existing in the ortets may improve
the synthesis of more flavonoids, which are compounds
that stop or kill pathogens in oil palm [30]. Hence,
blending of different oil palm clones during planting in
the field may contribute to controlling environmental
constraints, including diseases, which are real threats to
oil palm plantations, regardless of the continent on which
they are found.
5. Conclusions
The set of 10 microsatellite markers used in the study
successfully traced the ramet-to-ortet relationship and
identified off-type ramets. They should be routinely used
to verify ramet-to-ortet identity and detect off-type oil
palm clones produced by Sime Darby’s tissue culture
laboratory. The 10 microsatellite markers also revealed a
high level of genetic diversity among ortets, which
should be expected among their clonal progenies.
6. Acknowledgements
The authors would like to express their deepest gratitude
to Sime Darby Plantation Sdn Bhd for allowing the pub-
lication of this work.
REFERENCES
[1] N. Rajanaidu and A. Kushairi, “Strategies for the Devel-
opment of Future Oil Palm Planting Materials,” Paper
Presented at ISOPB Seminar on the Progress of Oil Palm
Breeding and Selection, Medan, 6-9 October 2003.
[2] S. Mayes, F. Hafeez, Z. Price, D. MacDonald, N. Billotte
and J. Roberts, “Molecular Research in Oil Palm, the Key
Oil Crop for the Future,” In: P. H. Moore and R. Ming,
Eds., Genomics in Tropical Crop Plants, Nottingham
University Press, Nottingham, 2008, pp. 371-404.
doi:10.1007/978-0-387-71219-2_15
[3] G. Van Der Linden, S. A. Sharifah, G. Angenent, S. C.
Cheah and R. Smulders, “Molecular Characterization of
Flower Development in Oil Palm in Relation to the Man-
tling Abnormality,” Proceedings MPOB 2001 Interna-
tional Palm Oil Congress―Agriculture, Kuala Lumpur,
2005, pp. 531-549.
[4] V. Le Guen, G. Samaritaan, Z. Othman, C. W. Chin, K. E.
Konan and T. Durand-Gasselin, “Oil Production in
Young Oil Palm Clones,” Oleagineux, Vol. 46, 1991, pp.
347-359.
[5] Y. Duval, P. Amblard, A. Rival, E. Konan, S. Gogor and
T. Durand-Gasselin, “Progress in Oil Palm Tissue Culture
and Clonal Performance in Indonesia and Côte d’Ivoire,”
Proceedings ISP Conference Plantation Management for
21st Century, Kuala Lumpur, 1997, pp. 291-307.
[6] A. B. Maheran and O. Abu Zarin, “Felda’s Experience in
Clonal Oil Palm Planting on Inland Soils,” Proceedings

DNA Sequence-Based Markers for Verification of Ramet-to-Ortet Relationship in Oil Palm (Elaeis guineensis Jacq.)
548
of the PORIM Oil Palm Congress, Kuala Lumpur, 1999,
pp. 330-343.
[7] A. C. Soh, Y. Y. Yong, Y. W. Ho and N. Rajanaidu,
“Commercial Potential of Oil Palm Clones: Early Results
of Their Performances,” In: V. Rao, I. E. Henson and N.
Rajanaidu, Eds., Recent Developments in Oil Palm Tissue
Culture and Technology, Palm Oil Research Institute of
Malaysia, Kuala Lumpur, 1995, pp. 134-144.
[8] A. C. Soh, G. Wong, C. C. Tan, P. S. Chew, T. Y. Hor, S.
P. Chong and K. Gopal, “Recent Advances towards Com-
Mercial Production of Elite Oil Palm Clones,” Proceed-
ings of the MPOB 2001 International Palm Oil Con-
gress―Agriculture, Kuala Lumpur, 2001, pp. 33-44.
[9] C. J. Eeuwens, S. Lord, C. R. Donough, V. Rao, G.
Vallejo and S. Nelson, “Effects of Tissue Culture Condi-
Tions during Embryoid Multiplication on the Incidence of
‘Mantled’ Flowering in Clonal Propagated Oil Palm,”
Cell Plant, Tissue Organ Culture, Vol. 70, 2002, pp.
311-323. doi:10.1023/A:1016543921508
[10] S. Jouannic, X. Argout, F. Lechauve, C. Fizames, A.
Borgel, F. Morcillo, F. Aberlec-Bertossi, Y. Duval and J.
W. Tregear, “Analysis of Expressed Sequence Tags from
Oil Palm (Elaeis guineensis),” FEBS Letters, Vol. 579,
2005, pp. 2709-2714. doi:10.1016/j.febslet.2005.03.093
[11] A. C. Soh, G. Wong, C. C. Tan, T. Y. Hor and C. K.
Wong, “Revisited: Cloning Seedling of Reproduced Best
Dxp Cross Strategy,” Paper Presented at ISOPB Seminar
on the Progress of Oil Palm Breeding and Selection,
Medan, 6-9 October 2003.
[12] S. Rajinder, N. Jayanthi, T. Soon-Guan, M. P. Jothi and S.
C. Cheah, “Development of Simple Sequence Repeat
(SSR) Markers for Oil Palm and Their Application in
Genetic Mapping and Fingerprinting of Tissue Culture
Clones,” Asia Pacific Journal of Molecular Biology and
Biotechnology, Vol. 15, 2007, pp. 121-131.
[13] M. Delseny, M. Laroche and P. Penon, “Detection of
Sequences with Z-DNA Forming Potential in High
Plants,” Biochemical and Biosphysical Research Com-
mununications, Vol. 116, 1983, pp. 113-120.
doi:10.1016/0006-291X(83)90388-1
[14] W. Amos, S. J. Sawcer, R. W. Feakes and D. C.
Rubinsztein, “Microsatellites Show Mutational Bias and
Heterozygote Instability,” Nature Genetics, Vol. 13, 1996,
pp. 390-391. doi:10.1038/ng0896-390
[15] J. S. C. Smith, E. C. L. Chin, H. Shu, O. S. Smith, S. J.
Wall, M. L. Senior, S. E. Mitchel, S. Kresovich and J.
Ziegle, “An Evaluation of the Utility of SSR Loci as Mo-
Lecular Markers in Maize (Zea mays L.), Comparisons
with Data from RFLPs and Pedigree,” Theoretical and
Applied Genetics, Vol. 95, 1997, pp. 163-173.
doi:10.1007/s001220050544
[16] J. Doyle and L. Doyle, “Isolation of Plant DNA from
Fresh Tissue,” Focus, Vol. 12, 1990, pp. 13-15.
[17] N. Billotte, N. A. M. Risterucci, E. Barcelos, L. Noyer, P.
Amblard and F. C. Baurens, “Development, Characterisa-
tion, and Across-Taxa Utility of Oil Palm (Elaeis
guineensis Jacq.) Microsatellite Markers,” Genome, Vol.
44, 2001, pp. 413-425.
[18] M. Nei and N. Takezaki, “Estimation of Genetic Dis-
tances and Phylogenetic Trees from DNA Analysis,”
Proceedings of the 5th World Congress on Genetics. Ap-
plied to Livestock Production, Vol. 21, 1983, pp. 405-
412.
[19] P. H. A. Sneath and R. R. Sokal, “Numerical Taxonomy,”
W. H. Freeman Press, San Francisco, 1973.
[20] B. S. Weir, “Genetic Data Analysis II,” MA: Sinauer As-
sociates, Inc., Sunderland, 1996.
[21] M. Nei, “Analysis of Gene Diversity in Subdivided
Populations,” Proceedings of the National Academy of
Science of the USA, Vol. 70, 1973, pp. 3321-3323.
doi:10.1073/pnas.70.12.3321
[22] K. Liu and S. V. Muse, “PowerMarker: Intergrated
Analysis Environment for Genetic Marker Data,” Bioin-
formatics, Vol. 21, 2005, pp. 2128-2129.
doi:10.1093/bioinformatics/bti282
[23] B. Cochard, “Etude de la Diversité Génétique et du
Déséquilibre de Liaison au Sein de Populations
Améliorées de Palmier à Huile (Elaeis guineensis Jacq.),”
Ph.D. Dissertation, SUPAGRO, Montpellier, 2008.
[24] F. C. Yeh, “Population Genetics,” In: A. Young, D. Bosh-
ier and T. Boyle, Eds., Forest Conservation Genetics:
Principles and Practice, CSIRO Publishing, Collingwood,
2000, pp. 21-37.
[25] R. V. H. Corley, “Illegitimacy in Oil Palm Breeding,”
Journal of Oil Palm Research, Vol. 17, 2005, pp. 64-69.
[26] N. Billotte, P. J. L. Lagoda, A. M. Risterucci and F. P.
Baurens, “Microstellite-Enriched Libraries: Applied
Methodology for the Development of SSR Markers in
Tropical Crops,” Fruits, Vol. 54, 1999, pp. 277-288.
[27] C. Bakoumé, R. Wickneswari, N. Rajanaidu, A. Kushairi,
P. Amblard and N Billotte, “Allelic Diversity of Natural
Oil Palm (Elaeis guineensis Jacq.) Populations Detected
by Microsatellite Markers: Implication in Conservation,”
Plant Genetic Resources Characterization and Utilization,
Vol. 5, 2007, pp. 104-107.
doi:10.1017/S1479262107710870
[28] C. W. S. Hartley, “The Oil Palm (Elaeis guineensis
Jacq.),” Longman Scientific and Technical, New York,
1988.
[29] C. Bakoumé, “Genetic Diversity of Natural Oil Palm
(Elaeis guineensis Jacq.) Populations Using Microsatel-
lite Markers,” unpublished Ph.D. dissertation, Universiti
Kebangsaan Malaysia, Bangi, 2006.
[30] S. Diabate, H. De Franqueville, D. Allou, K. E. Konan, O.
A. Coulibaly and W. P. N’Guessan, “Phenolic Diversity
in the Defense Reaction of the Oil Palm against Vascular
Wilt Disease,” Proceedings of the 2009 International
Palm Oil Congress on Palm Oil: Balancing Ecologics
with Economics, Kuala Lumpur, 2009, pp. 1027-1034.