Open Journal of Genetics, 2013, 3, 235-242 OJGen
http://dx.doi.org/10.4236/ojgen.2013.34026 Published Online December 2013 (http://www.scirp.org/journal/ojgen/)
Genetic structure and diversity of Ukrainian red clover
cultivars revealed by microsatellite markers
Yulia N. Dugar1, Vitalii N. Popov2
1Kharkov National Agrarian University nd. a. V. V. Dokuchaev, Post Office Communist-1, Kharkov District, Ukraine
2Рlant Production Institute nd. a. V. Ya. Yuryev of National Academy of Agrarian Science, Kharkov, Ukraine
Received 10 October 2013; revised 1 November 2013; accepted 28 November 2013
Copyright © 2013 Yulia N. Dugar, Vitalii N. Popov. This is an open access article distributed under the Creative Commons Attribu-
tion License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.
ABSTRACT
Polymorphism of microsatellite loci of Ukrainian red
clover cultivars has been studied. 87 microsatellite
alleles, which occurred in different combinations,
were identified. The number of alleles ranged from 7
to 10. Microsatellite allele distribution showed that 15
alleles were common for all the red clover cultivars
(17.2%). The red clover cultivars were represented by
homozygous and heterozygous genotypes. The ob-
served and expected heterozygosity ranged from
0.067 to 0.269 and from 0.225 to 0.807, respectively.
An analysis of molecular variance revealed that the
largest proportion of variation (68.5%) resided at the
intrapopulation level. Differentiation of the Ukrain-
ian cultivars was moderately expressed (FST = 0.07).
Keywords: Genetic Structure; Heterozygosity;
Microsatellites; Polymorphism; Trifolium pratense L.
1. INTRODUCTION
Genetic diversity and differentiation of current selection
cultivars and hybrids are primarily studied with different
types of DNA-markers in agricultural plants that domi-
nate in cropland acres—wheat, barley, soya, corn, sun-
flower [1-5]. DNA genome polymorphism has been also
thoroughly investigated in forage grasses belonging to
genera Medicago and Festuca [6,7], and the genome of
red clover is less studied (Trifolium pratense L.) as com-
pared with them. At present the red clover genome is
studied using a dominant marker system RAPD (Random
Amplifed Polymorphic DNA) [8-11]. Usage of such
DNA-markers is allowed to study red clover cultivars of
Ukrainian selection [12]. Additionally, another dominant
marker system, ISSR (Inter-Simple Sequence Repeats),
was used to evaluate genetic diversity of 6 species of the
genus Trifolium as well as of Ukrainian cultivars of red
clover [13,14]. The investigation of population structure
of red clover cultivars by means of microsatellite mark-
ers is topical at the moment. They are notable for high
polymorphism, co-dominantly inherited and well suitable
for differentiating natural populations and breeding mate-
rial [15,16]. At this point, microsatellite variability in the
red clover genome has been determined, which allowed
detailed genetic mapping as well as involving them in
QTL (Quantitative trait loci) mapping [17-19]. The ne-
cessity of utilization of microsatellite markers for differ-
entiating red clover cultivars is also associated with the
fact that the absence of clear marker morphological traits
used for characterization of most plant genetic resources
is a genetic peculiarity of clover plants [20]. However,
the lack of information on genetic peculiarities of red
clover cultivars of Ukrainian selection makes it impossi-
ble to judge the genetic diversity level of the world clo-
ver collection in full measure. In this context, the aim of
our research was to investigate genetic variability of mi-
crosatellite loci and to estimate genetic structure and
differentiation degree of Ukrainian red clover cultivars.
2. MATERIALS AND METHODS
Fifteen Ukrainian red clover cultivars, which were re-
ceived from Ustimovskaya experimental station of the
Рlant Production Institute nd. a. V. Ya. Yuryev of NAAS
(Kharkov, Ukraine) and from the Institute of Forage
Crops and Agriculture of Podol of NAAS (Vinnitsa,
Ukraine), were used as plant material (Table 1).
To assess variability of microsatellite loci 30 individ-
ual seeds of each of clover cultivars were analyzed. The
representative sample comprised 450 seeds.
Genome DNA was extracted from clover seeds with
CTAB buffer according to the standard protocol [21]. 10
microsatellite loci—TPSSR05, TPSSR16, TPSSR17,

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 236
Table 1. Investigated red clover cultivars.
No Cultivar Originator
1 Ternopil’s’ka 3
2 Ternopil’s’ka 4
Podilska Experimental Station of
Ternopil Institute of Agricultural
Production of UAAS, Ternopol region
3 Myronivs’ka 45 Muronivka Wheat Institute nd. a V. N.
Remeslo of UAAS, Kiev region
4 Darunok
5 Kumach
6 Marusia
7 Polis
8 Polianka
National Scientific Center “Institute of
Agriculture of UAAS”, Kiev region
9 Anitra
10 Politanka
11 Sparta
Institute of Forage Crops of UAAS,
Vinnitsa region
12 Ahros 12 Chernihiv Institute of Agricultural
Production of UAAS, Chernigov region
13 Falkon
Nosivska Selection-Experimental Station
of Chernihiv Institute of Agricultural
Production of UAAS, Chernigov region
14 Poltavs’ka 75
Poltavskaya State Agricultural
Experimental Station nd. Vavilov of
Poltava Institute of Agricultural
Production of UAAS, Poltava region
15 UDS00131 Carpathians, local cultivar
Footnote: UAAS—Ukrainian Academia of Agricultural Science.
TPSSR23, TPSSR28, TPSSR29, TPSSR34, TPSSR46,
TPSSR50, TPSSR52 (Table 2) was selected for our work,
which was development by Kolliker et al. [22]. Reac-
tions were carried out with the GenePak PCR Core re-
agent kit (IzoGen, Russia). 20 μl final volume of reagent
mixture containing 20 ng of genome DNA and 0.2 μM of
each SSR primer (forward, reverse). 20 l of mineral oil
was layered atop reagent mixture in vials. PCR (Poly-
merase Chain Reaction) was performed in a thermocy-
cler TP4-PCR-01 “Tertsik” (DNA-technology, Russia)
according to the program suggested by Кolliker et al.
[22].
The PCR products were separated by electrophoresis
in 3% high-resolution agarose gel with addition of
ethidium bromide in low ionic strength buffer [23] and
following photographing in UV-light. DNA ladders 50 bp
and pUC 19/MspI DNA Marker were used as fragment
length standards. Allele sizes of each microsatellite locus
were determined using the program Totallab version
TL120 [24].
The results were statistically processed using the Excel
Microsatellite Toolkit version 3.1.1. [25], which com-
puted the following population criteria: allele frequencies,
average number of alleles per locus (Na), observed (Ho)
and expected (He) heterozygosity. The effective number
of alleles was calculated with the formula (Ne) [26]:
2
11
Ne 1He
i
p


 (1)
The indices of genetic diversity of red clover popula-
tions were calculated with Analysis of Molecular Vari-
ance (AMOVA) in Arlequin version 3.11 [27]. We calcu-
lated the following indices of molecular variance: Va—
between red clover cultivars, Vb—between genotypes
within a cultivar, Vc—between loci in individual geno-
types. The differentiation degree between clover culti-
vars was carried out with F-statistics (FST, FIT, FIS). Step-
wise mutation model (SMM) for microsatellite loci was
used [28]. The statistical significance of the indices of
genetic variability was tested via 1000 permutations of
initial data [27].
A dendrogram of genetic relationships between red
clover cultivars was plotted with the Neighbor-Joining
method (NJ) in the Neighbor program in Phylip version
3.69 [29]. The factors were discriminated by a correla-
tion matrix of initial allelic frequencies of microsatellite
loci using principal components analysis (Q-factor analy-
sis) with factor rotation based on the varimax criterion.
To infer the structure and genetic relationships among the
15 varieties, the dataset was analyzed using Structure
version 2.3.4 [30].
3. RESULTS
Over the ten SSR loci, 87 fragments were scored, with
size ranging from 100 (TPSSR52) to 280 bp (TPSSR05)
(Table 3). The number of alleles per locus ranged from 7
to 10 and the mean number of alleles per locus was 8.70
± 1.16 (Table 3). The minimum number of alleles was
detected for loci TPSSR28 and TPSSR34, and the
maximum—for loci TPSSR23, TPSSR50 and TPSSR52.
The analysis of allelic frequencies showed that the
microsatellite loci studied in red clover were signifi-
cantly polymorphic for the selected monomorphity
threshold (р0 = 0.95) [31]. Allelic frequencies for each
microsatellite locus were determined in the sample stud-
ied, they ranged from 0.001 to 0.878. Altogether, 6 al-
leles occurred with the frequency of 0.001 (0.7% of the
total number of alleles). These alleles were 100, 232, 234,
280 bp in length for loci TPSSR52, TPSSR46, TPSSR34,
TPSSR05, respectively, and 2 alleles were 207 and 213
bp long in locus TPSSR17. A high frequency is typical
for 150 bp allele in locus TPSSR17.
The observed and expected heterozygosity levels are
measures of genetic variability of microsatellite loci. The
latter is more adequate, since it allows direct evaluating
allelic diversity level for a locus investigated [31]. The
values of observed and expected heterozygosity ranged

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 237
Table 2. Characteristics of SSR-primers.
No Locus Repeat Sequence 5’-3’ Annealing temperature, ˚C
1 TPSSR05 (GT)n F: AGGGTGTGCGTGCAAACA
R: TATGTCTATCTTCCCTTTTAATGTCTTCTG 55
2 TPSSR16 (CT)n F: GCGCTTATTCGAAGACGGAA
R: TCAGTGGAGTAGGGTCGTCGT 60
3 TPSSR17 (CTT)n F: AAGCAGCGAGACTTCCCTTTG
R: TGGAAGGTTAACATCGAGAGCA 60
4 TPSSR23 (AG)n F: CAGTCGGGTTGTTGCCATTT
R: GAGGAATAAACTCAATACTTCAGTGACTAGAT 60
5 TPSSR28 (AG)n F: CTCTTAAGGGTTGGTATTGAAATCG
R:TCTTGTCTCGCCGACGTTT 60
6 TPSSR29 (GA)n
F: TTTCGGTAGTGGAAGATGATGGA
R: TCAATAATTTCAGAAAAAGATCAAAACC 60
7 TPSSR34 (CT)n
F: GTTAGTGCGCGAAAGGAAGG
R: GTTCAGTGGATCAGTGAGTAACACAA 60
8 TPSSR46 (TC)n
F: TCAAATAAAACTTTCATAACGTTCATCTC
R: TCCGAAGAAACCATTATCTACGTTG 60
9 TPSSR50 (CT)n
F: TTTGTTCAGGAAAATGAGGCG
R: ATTCCTTCCATCTTCTCTATGT 60
10 TPSSR52 (CT)n
F: ATTCCTTCCATCTTCTCTATGT
R: TTATATTAATGGGAGTTAGTATGATCTA 60
Table 3. Results of analysis of microsatellite loci genetic variability in red clover.
No Locus Ho He N Na Ne Fragment size, bp
1 TPSSR28 0.160 0.698 7 4.60 ± 0.91 3.31 128 - 182
2 TPSSR34 0.126 0.690 7 4.00 ± 1.00 3.22 164 - 246
3 TPSSR17 0.067 0.225 8 3.13 ± 1.41 1.29 141 - 213
4 TPSSR46 0.100 0.786 8 5.13 ± 0.92 4.67 158 - 232
5 TPSSR05 0.158 0.766 9 5.53 ± 0.92 4.27 170 - 280
6 TPSSR16 0.269 0.797 9 5.40 ± 0.99 4.93 166 - 260
7 TPSSR29 0.197 0.801 9 6.27 ± 0.80 5.03 136 - 214
8 TPSSR23 0.180 0.777 10 6.27 ± 1.33 4.48 138 - 246
9 TPSSR50 0.261 0.807 10 6.67 ± 1.11 5.18 130 - 230
10 TPSSR52 0.216 0.702 10 5.67 ± 1.35 3.36 100 - 188
Total 87
Mean 0.173 ± 0.006 0.705 ± 0.0558.70 ± 1.16 3.97 ± 1.20
Footnote: Ho—observed heterozygosity, He—expected heterozygosity (Nei’s genetic diversity), N—observed number of alleles, Na—average number of alleles
per locus, Nе—effective number of alleles.
within 0.067 - 0.269 (mean 0.173 ± 0.006) and 0.225 -
0.807 (mean 0.705 ± 0.055), respectively. We obtained a
high level of expected heterozygosity for all the mi-
crosatellite loci. This index ranged from 0.690 to 0.807
for 9 of 10 loci. The exception was locus TPSSR17, for
which this index of genetic diversity was considerably
lower—0.225 (Table 3).
The investigation of genetic structure of red clover
cultivars by the number of alleles of microsatellite loci
demonstrated that their numbers ranged from 1 to 9. For
example, a monomorphic 150 bp fragment was identified
for locus TPSSR17 in the cultivar Kumach, and in the
cultivar Marusia the maximum number of allelic variants
was recorded for locus TPSSR23—9. The analysis of

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 238
each cultivar by a set of alleles of microsatellite loci
showed considerable variations. The total number of
alleles ranged from 41 (mean 4.10 ± 0.88) in the cultivar
Polis to 59 (mean 5.90 ± 1.10) in the cultivar Terno-
pil’s’ka 4 (Table 4). In addition, the clover cultivars had
alleles, which were specific for a certain cultivar. These
are 250 and 100 bp alleles for loci TPSSR05 and
TPSSR52, respectively, in the cultivar Myronivs’ka 45;
207 and 213 bp alleles for locus TPSSR17 in the local
cultivar UDS00131; 234 bp allele (TPSSR34) in the cul-
tivar Ternopil’s’ka 4; and 232 bp allele for locus
TPSSR46 only occurred in the cultivar Falkon. Overall,
the analysis of distribution of alleles of microsatellite
loci in the general sample of cultivars-populations
showed that 15 of 87 identified alleles were common for
all the cultivars (17.2%).
Allelic variants of microsatellite loci occurred in dif-
ferent combinations in red clover cultivars. The number
of genotypes ranged from 54 (Polis) to 87 (Darunok,
UDS00131), which, on average, made up 78 genotypes.
There were no identical or common genotypes among
the red clover cultivars investigated.
The analysis of frequency distribution of alleles of
microsatellite loci demonstrated that one or two, or three
(which is rarer) alleles occurred with the highest fre-
quencies in most of red clover cultivars. At the same time,
the same alleles usually occurred with the highest fre-
quencies in different cultivars-populations of clover.
Comparison of frequency distribution of alleles of locus
TPSSR17 in the red clover cultivars revealed predomi-
nance of 150 bp allele with the frequency of from 0.617
in UDS00131 to 1.00 in the cultivar Kumach. The ob-
served heterozygosity (Ho) ranged from 0.131 ± 0.020 to
0.212 ± 0.024 in the cultivars Polis and Darunok, respec-
tively. The indices of expected heterozygosity (He) were
substantial and ranged from 0.566 ± 0.045 to 0.703 ±
0.037 in the cultivars Polis and Ternopil’s’ka 4, respec-
tively (Table 4).
The analysis of Molecular Variance (AMOVA) of
three variability sources in the red clover cultivars re-
vealed that only 6.9% of the total genetic variability is
accounted for by the interpopulation level (Va), 68.5%
pertain to the intrapopulation level (Vb), and 24.5% are
attributed to variability of loci (Vc) belonging to a cer-
tain genotype (Table 5). The obtained values of inter-
population variance for each microsatellite locus allowed
identifying loci that most contribute to intravarietal dif-
ferences of red clover. These loci are TPSSR05 and
TPSSR23, which had variance values of 11.0% and
12.08%, respectively. The minimum value (2.49%) of
this index was recorded for locus TPSSR34 with the
maximum intrapopulation variance being 79.35% and
80.91% for this locus and locus TPSSR46, respectively.
The variance components for loci in genotypes ranged
Table 4. Results of withinpopulation variability analysis in clover cultivars.
No Cultivar Ho He Na Ne FIS for 10 loci
1 Ternopil’s’ka 3 0.208 ± 0.024 0.694 ± 0.035 5.20 ± 1.23 3.27 0.71
2 Ternopil’s’ka 4 0.177 ± 0.022 0.703 ± 0.037 5.90 ± 1.10 3.37 0.74
3 Myronivs’ka 45 0.200 ± 0.023 0.618 ± 0.059 5.60 ± 1.90 2.62 0.68
4 Darunok 0.212 ± 0.024 0.678 ± 0.056 5.60 ± 1.58 3.11 0.67
5 Kumach 0.137 ± 0.020 0.591 ± 0.071 4.70 ± 1.77 2.44 0.77
6 Marusia 0.174 ± 0.022 0.651 ± 0.071 5.40 ± 2.22 2.87 0.67
7 Polis 0.131 ± 0.020 0.566 ± 0.045 4.10 ± 0.88 2.30 0.76
8 Polianka 0.141 ± 0.020 0.619 ± 0.044 4.90 ± 1.10 2.62 0.77
9 Anitra 0.197 ± 0.023 0.668 ± 0.069 5.20 ± 1.69 3.01 0.73
10 Politanka 0.157 ± 0.021 0.643 ± 0.067 5.40 ± 1.51 2.80 0.78
11 Sparta 0.160 ± 0.021 0.679 ± 0.058 5.70 ± 1.25 3.12 0.78
12 Ahros 12 0.157 ± 0.021 0.643 ± 0.061 5.20 ± 1.69 2.80 0.72
13 Falkon 0.190 ± 0.023 0.659 ± 0.065 5.40 ± 1.43 2.93 0.71
14 Poltavs’ka 75 0.158 ± 0.021 0.657 ± 0.058 5.10 ± 1.10 2.92 0.73
15 UDS00131 0.198 ± 0.023 0.698 ± 0.034 5.60 ± 1.35 3.33 0.73
Footnote: Ho—observed heterozygosity, He—expected heterozygosity (Nei’s genetic diversity), Na—average number of alleles per locus, Nе—effective num-
ber of alleles, FIS—inbreeding coefficient.

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 239
Table 5. Results of molecular variance (AMOVA) analysis in clover cultivars.
Source of variation Sum of squares Variance components Percentage variation
Among populations 285.057 0.24477 6.90341
Among individuals within populations 2471.380 2.42977 68.52831
Within individuals 389.500 0.87110 24.56828
Total 3145.937 3.54564
from 12.66% for TPSSR46 to 33.53% for TPSSR16
(data are not presented). Differentiation of the Ukrainian
cultivars was moderately expressed (FST = 0.07). The
values FIS and FIT for 10 loci were 0.74 and 0.75, respec-
tively.
Slatkin’s genetic distances [27] between populations
of the red clover cultivars ranged from 0.03700 to
0.16845. The maximum differentiation was noticed be-
tween the cultivars Darunok and Ternopil’s’ka 4 as well
as between the cultivars Darunok and Kumach. The dis-
tances values for these pairs of cultivars were 0.16845
and 0.16573, respectively. Pairs of cultivars with mini-
mum genetic differentiation, for which the distances
values fell within 0.03700 - 0.04816, were identified.
Peculiarities of grouping the red clover cultivars were
studied using cluster and Q-factor analyses. The patterns
of distribution of the red clover cultivars on the dendro-
gram obtained with cluster analysis (Figure 1) and in the
coordinate system of the first and second factors (Figure
2) showed similar results, the only exception being vari-
ety Polis. The cluster analysis based on Nei’s genetic
distances and performed by the Neighbour-joining
method (NJ) allowed distinguishing two main clusters
(Figure 1). The first cluster comprised the cultivars Da-
runok, Sparta, Falkon, Polianka, Marusia, Poltavs’ka 75,
Kumach, Polis.
The second cluster was represented by the following
cultivars: Ahros 12, Myronivs’ka 45, Anitra, Politanka,
Ternopil’s’ka 3, UDS00131 and Ternopil’s’ka 4.
The two-factor model used Q-factor analysis described
79.9% of the total variance of allelic frequencies of mi-
crosatellite loci (Figure 2). Factor 1 was established to
have significant factor loadings for 5 cultivars, factor 2—
for 7 cultivars with their values exceeding the preset
threshold of 0.70. At the same time we could not ascer-
tain pertinence of three cultivars to the distinguished
factors according to their factor loadings (<0.70), but
managed to reveal certain tendencies, consisting in the
fact that the cultivars Kumach and Marusia gravitate
toward factor 1, and the cultivar Ternopil’s’ka 3—toward
factor 2 (Figure 2). The cluster and factor analyses re-
vealed no clear patterns in genetic divergence of mi-
crosatellite loci in the red clover cultivars depending on a
place of their creation. To confirm this initial data were
additionally processed by means of a Bayesian model
implemented in Structure version 2.3.4. The statistically
significant number of clusters according to the algorithm
of Evanno et al. [32] was 2. Analyzing the graph we can
state that none of the investigated red clover cultivars
clearly belonged to the first or the second cluster (Figure
3).
4. DISCUSSION
Red clover is a typical entomophilous cross-pollinated
plant with gametophyte self-incompatibility. Such polli-
nation system in red clover can result in high levels of
genetic diversity due to free exchange of genes between
populations, inter alia between cultured and wild clover
populations. Absence of clear morphological markers
prevents performing necessary population assessments
[20]. It is possible to assess genetic diversity of red clo-
ver cultivars using polymorphic marker traits. Therefore,
genetic structure of red clover cultivars can be judged by
different types of DNA markers [8-14,17-19,22]. In our
study of population-genetic peculiarities of variability of
10 microsatellite loci homozygous and heterozygous
genotypes were identified in the sample investigated.
Consequently, the investigated red clover cultivars are
heterogeneous populations, which are related not only to
pollination biology of this species, but also to peculiari-
ties of breeding process. Mass selection and poly-cross
are the most often used methods of the creation of red
clover cultivars-populations [33]. In general, the level of
allelic diversity of microsatellite loci established in our
work is in agreement with previously published findings
of the studies of red clover cultivars-populations of other
countries’ selection [17,22,34-37].
The estimation of genetic diversity criteria showed
their high values. It is noteworthy that comparison of the
expected heterozygosity values (He) revealed that the
average heterozygosity of microsatellite loci (0.705 ±
0.055) was significantly higher that the heterozygosity of
isoenzyme markers estimated for the general sample of
cultured clover cultivars-populations [38-40]. Addition-
ally, the genetic diversity parameters of isoenzymes in
natural populations are also considerably lower than
those of DNA markers [41]. Our estimate of expected
heterozygosity (0.705 ± 0.055) of microsatellite loci con-
firms the previous data on high levels of intrapopulation

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 240
Figure 1. Results of clover cultivars clusterization by the
neighbor joining (NJ) method based on Nei’s genetic distances.
Figure 2. Results of factorization of red clover cultivars: num-
bers correspond to the numbers of varieties in Table 1.
Figure 3. Results of clover cultivars clusterization in pro-
gramm Structure. Each individual is represented by a vertical
line; numbers correspond to the numbers of varieties in Table
1.
variability of red clover [22,34]. High heterozygosity of
microsatellite loci appears to be attributed to their mul-
tiallelism, which arises from high rates of mutagenesis
process in these DNA sequences [16].
Cross-pollinated perennials are characterized by pre-
dominance of their variation within populations, whereas
among populations variation is typical for self-pollinated
annuals [15]. The analysis of literature data showed that
most of genetic diversity of red clover was accounted for
by intrapopulation level, and an insignificant part—by
interpopulation level, which was also confirmed by this
study. For example, having studied RAPD markers, Ul-
loa et al. [42] showed that 80.4% of the total variability
of red clover was related to intrapopulation one. Similar
findings were obtained when clover variability was esti-
mated using another polylocus system—AFLP, though
the values were slightly lower [43]. Extended areas of
clover cultivating and large distribution areals of wild red
clover are likely to cause enhancement in migration fac-
tors. As a consequence of such population factors, natu-
ral populations become weakly differentiated between
one another. The same also concerns cultured clover cul-
tivars that were created by free transpollination between
cultivars close to each other by development type, which
promotes an increase in adaptive characteristics and yield
capacity.
On the ground of the results of cluster and factor
analyses one can state that in most cases the investigated
red clover cultivars were characterized by similar allelic
composition of microsatellite loci despite the fact that
they were created in different regions of Ukraine. We
revealed no clear patterns in disposition of cultivars de-
pending on places of their creation. This is likely to be
due to involvement of the same material in breeding
programs and to prevalence of breeding methods based
on free transpollination between the best genotypes.
5. CONCLUSION
The data on polymorphism of microsatellite loci and va-
riability of the red clover cultivars of Ukrainian selec-
tion attest to a high level of genetic diversity of microsa-
tellite loci, and moderate differentiation between varie-
ties as well as to their similar genetic structure, which
can be related to the breeding peculiarities and the large
distribution areal of this culture. It is doubtless that infor-
mation on the red clover gene pool will be supplemented
owing to expansion of quantity of studied cultivarspopu-
lations and repertoire of analyzed DNA markers.
REFERENCES
[1] Roussel, V., Leisova, L., Exbrayat, F., Stehno, Z. and
Balfourier, F. (2005) SSR allelic diversity changes in 480
European bread wheat cultivars released from 1840 to
2000. Theoretical and Applied Genetics , 111, 162-170.
http://dx.doi.org/10.1007/s00122-005-2014-8
[2] Kolodinska Brantestam, A., von Bothmer, R., Dayteg, C.,
Rashal, I., Tuvesson, S. and Weibull, J. (2007) Genetic
diversity changes and relationships in spring barley (Hor-

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 241
deum vulgare L.) germplasm of Nordic and Baltic areas
as shown by SSR markers. Genetic Resources and Crop
Evolution, 54, 749-758.
http://dx.doi.org/10.1007/s10722-006-9159-4
[3] Mimura, M., Coyne, C.J., Bambuck, M.W. and Lumpkin,
T.A. (2007) SSR diversity of vegetable soybean [Glycine
max (L.) Merr.]. Genetic Resources and Crop Evolution,
54, 497-508.
http://dx.doi.org/10.1007/s10722-006-0006-4
[4] van Inghelandt, D., Melchinger, A.E., Lebreton, C. and
Stich B. (2010) Population structure and genetic diversity
in a commercial maize breeding program assessed with
SSR and SNP markers. Theoretical and Applied Genetics,
120, 1289-1299.
http://dx.doi.org/10.1007/s00122-009-1256-2
[5] Heesacker, A., Kishore, V., Gao, W., Tang, S., Kolkman,
J., Gingle, A., Matvienko, M., Kozik, A., Michelmore, R.,
Lai, Z., Rieseberg, L. and Knapp, S. (2008) SSRs and
INDELs mined from the sunflower EST database: Abun-
dance, polymorphisms, and cross-taxa utility. Theoretical
and Applied Genetics, 117, 1021-1029.
http://dx.doi.org/10.1007/s00122-008-0841-0
[6] Gupta, S. and Prasad, M. (2009) Development and cha-
racterization of genic SSR markers in Medicago trunca-
tula and their transferability in leguminous and non-le-
guminous species. Genome, 52, 761-771.
http://dx.doi.org/10.1139/G09-051
[7] Saha, M.C., Cooper, J.D., Mian, M.A.R., Chekhovskiy, K.
and May, G.D. (2006) Tall fescue genomic SSR markers:
Development and transferability across multiple grass
species. Theoretical and Applied Genetics, 113, 1449-
1458. http://dx.doi.org/10.1007/s00122-006-0391-2
[8] Kongkiatngam, P., Waterway, M.J., Fortin, M.G. and
Coulman, B.E. (1995) Genetic variation within and be-
tween two cultivars of red clover (Trifolium pratense L.):
Comparisons of morphological, isozyme, and RAPD
markers. Euphytica, 84, 237-246.
http://dx.doi.org/10.1007/BF01681816
[9] Kongkiatngam, P., Waterway, M.J., Coulman, B.E. and
Fortin, M.G. (1996) Genetic variation among cultivars of
red clover (Trifolium pratense L.) detected by RAPD
markers amplified from bulk genomic DNA. Euphytica,
89, 355-361.
[10] Campos-de-Quiroz, H. and Ortega-Klose, F. (2001) Ge-
netic variability among elite red clover (Trifolium prat-
ense L.) parents used in Chile as revealed by RAPD
markers. Euphytica, 122, 61-67.
http://dx.doi.org/10.1023/A:1012617504493
[11] Grljusic, S., Bolaric, S., Popovic, S., Cupic, T., Tucak, M.
and Kozumplik, V. (2005) Assessment of morphological
and RAPD variation among and within red clover culti-
vars after natural selection. Die Bodenkultur, 56, 183-
188.
[12] Dugar, Yu.N. and Popov, V.N. (2011) RAPD analysis of
Ukrainian red clover (Trifolium pratense L.) cultivars of
different ecology-geographical origin. Vestnik KNU nd. a
V.N. Karazin. Series Biology, 13, 81-86.
[13] Rizza, M.D., Real, D., Reyno, R., Porro, V., Burgueсo, J.,
Errico, E. and Quesenberry, K.H. (2007) Genetic diver-
sity and DNA content of three South American and three
Eurasiatic Trifolium species. Genetics and Molecular Bi-
ology, 30, 1118-1124.
[14] Dugar, Yu.N. (2012) ISSR-analyses of the Ukrainian red
clover cultivars (Trifolium pretense L.). Vestnik KNAU.
Series Biology, 2, 98-103.
[15] Weising, K., Nybom, H., Wolff, K. and Kahl, G. (2005)
DNA fingerprinting in plants: Principles, methods, and
applications. 2nd Edition, CRC Press Taylor & Francis
Group, Boca Raton.
http://dx.doi.org/10.1201/9781420040043
[16] Kalia, R.K., Rai, M.K., Kalia, S., Singh, R. and Dhawan,
A.K. (2011) Microsatellite markers: An overview of the
recent progress in plants. Euphytica, 177, 309-334.
http://dx.doi.org/10.1007/s10681-010-0286-9
[17] Sato, S. Isobe, S., Asamizu, E., Ohmido, N., Kataoka, R.,
Nakamura, Y., Kaneko, T., Sakurai, N., Okumura, K.,
Klimenko, I., Sasamoto, S., Wada, T., Watanabe, A.,
Kohara, M., Fujishiro, T. and Tabata, S. (2005) Compre-
hensive structural analysis of the genome of red clover
(Trifolium pratense L.). DNA Research, 12, 301-364.
http://dx.doi.org/10.1093/dnares/dsi018
[18] Isobe, S., Kolliker, R., Hisano, H., Sasamoto, S., Wada,
T., Klimenko, I., Okumura, K. and Tabata, S. (2009)
Construction of a consensus linkage map for red clover
(Trifolium pratense L.). BMC Plant Biology, 9.
[19] Klimenko, I, Razgulayeva, N., Gau, M., Okumura, K.,
Nakaya, A., Tabata, S., Kozlov, N. and Isobe, S. (2010)
Mapping candidate QTLs related to plant persistency in
red clover. Theoretical and Applied Genetics, 120, 1253-
1263. http://dx.doi.org/10.1007/s00122-009-1253-5
[20] Mukhina, N.A. and Stankevich, A.K. (1993) Cultured
flora: V. ХІІІ. Perennial legume grasses. Kolos, Moscow.
[21] Ausubel, F.M., Brent, R., Kingston, R.E., Moor, D.D. and
Seidman, J.G. (1987) Current protocols in molecular bi-
ology. John Wiley & Sons, New York.
[22] Kolliker, R., Enkerli, J. and Widmer, F. (2006) Charac-
terization of novel microsatellite loci for red clover (Tri-
folium pratense L.) from enriched genomic libraries. Mo-
lecular Ecology Notes, 6, 50-53.
http://dx.doi.org/10.1111/j.1471-8286.2005.01133.x
[23] Brody, J.R. and Kern, S.E. (2004) Sodium boric acid: A
Tris-free, cooler conductive medium for DNA electro-
phoresis. BioTechniques, 36, 214-216.
[24] http://www.totallab.com
[25] http://animalgenomics.ucd.ie/sdepark/ms-toolkit
[26] Berg, E.E. and Hamrick, J.L. (1997) Quantification of
genetic diversity at allozyme loci. Canadian Journal of
Forest Research, 27, 415-424.
http://dx.doi.org/10.1139/x96-195
[27] http://cmpg.unibe.ch/software/arlequin3/
[28] Balloux, F. and Lugon-Moulin, N. (2002) The estimation
of population differentiation with microsatellite markers.
Molecular Ecology, 11, 155-165.
http://dx.doi.org/10.1046/j.0962-1083.2001.01436.x
[29] http://evolution.genetics.washington.edu/phylip.html
[30] http://pritchardlab.stanford.edu/structure.html

Y. N. Dugar, V. N. Popov / Open Journal of Genetics 3 (2013) 235-242 242
[31] Zhivotovsky, L.A. (1991) Population biometry. Nauka,
Moscow.
[32] Evanno, G., Regnaut, S. and Goudet, J. (2005) Detecting
the number of clusters of individuals using the software
STRUCTURE: A simulation study. Molecular Ecology,
14, 2611-2620.
http://dx.doi.org/10.1111/j.1365-294X.2005.02553.x
[33] Taylor, N.L. (2008) A Century of Clover Breeding De-
velopments in the United States, Crop Science, 48, 1-13.
http://dx.doi.org/10.2135/cropsci2007.08.0446
[34] Berzina, I., Zhuk, A., Veinberga, I., Rashal, I. and Rungis,
D. (2008) Genetic fingerprinting of Latvian red clover
(Trifolium pratense L.) cultivars using simple sequence
repeat (SSR) markers: Comparisons over time and space.
Latvian Journal of Agronomy, 11, 28-32.
[35] Dias, P.M.B., Julier, B., Sampoux, J.-P., Barre, P. and
Dall’Agnol, M. (2008) Genetic diversity in red clover
(Trifolium pratense L.) revealed by morphological and
microsatellite (SSR) markers. Euphytica, 160, 189-205.
http://dx.doi.org/10.1007/s10681-007-9534-z
[36] Martina, S. (2007) New microsatellite loci for red clover
(Trifolium pratense L.) and study its polymorphism.
Proceeding of the XXVIIth Eucarpia Symposium on Im-
provement of Fodder Crops and Amenity Grasses, Co-
penhagen, 19-23 August 2007, Denmark, 217-219.
[37] Vymyslicky, T., Smarda, P., Pelikan, J., Cholastova, T.,
Nedelnik, J., Moravcova, H., Pokorny, R., Soldanova, M.
and Polakova, M. (2012) Evaluation of the Czech core
collection of Trifolium pratense, including morphological,
molecular and phytopathological data. African Journal of
Biotechnology, 11, 3583-3595.
[38] Yu, J., Mosjidis, J.A., Klingler, K.A. and Woods, F.M.
(2001) Isozyme diversity in North American cultivated
red clover. Crop Science, 41, 1625-1628
http://dx.doi.org/10.2135/cropsci2001.4151625x
[39] Semerikov, V.L. and Belyaev, A.Y. (1995) Allozyme
polymorphism in natural populations and cultivars of red
clover Trifolium pratense L. Genetika, 31, 815-819.
[40] Semerikov, V.L., Belyaev, A.Y. and Lascoux, M. (2002)
The origin of Russian cultivars of red clover (Trifolium
pratense L.) and their genetic relationships to wild popu-
lations in the Urals. Theoretical and Applied Genetics,
106, 127-132
[41] Mosjidis, J.A., Greene, S.L., Klingler, K.A. and Afonin,
A. (2004) Isozyme diversity in wild red clover popula-
tions from the Caucasus. Crop Science, 44, 665-670.
http://dx.doi.org/10.2135/cropsci2004.1039
[42] Ulloa, O., Ortega, F. and Campos, H. (2003) Analysis of
genetic diversity in red clover (Trifolium pratense L.)
breeding populations as revealed by RAPD genetic mar-
kers. Genome, 46, 529-535.
http://dx.doi.org/10.1139/g03-030
[43] Herrmann, D., Boller, B., Widmer, F. and Kolliker, R.
(2005) Optimization of bulked AFLP analysis and its ap-
plication for exploring diversity of natural and cultivated
populations of red clover. Genome, 48, 474-486.
http://dx.doi.org/10.1139/g05-011