Engineering, 2012, 5, 165-166
doi:10.4236/eng.2012.410B043 Published Online October 2012 (http://www.SciRP.org/journal/eng)
Conditional Replication Adenovirus Sensitizes A549 Cancer
Cell to Cisplatin
Yanan Liu, Yinghui Huang
China-Japan Union Hospital of Jilin university, Jilin, China
Received 2012
ABSTRACT
Objective: The aim of the study was to improve the therapeutic effect for lung cancer using a synerget ic str ateg y of aden ovi ru s-based
gene therapy co mbined with che motherap y. Methods: A conditional replication adenovirus(CRAd) was employed to treat the A549
lung cancer cells and cisplatin-resisted A549(A549-DDP) cells. In vitro MTS / PMS assay were used to evaluate the cell viability.
PCR were used to detect expression of Coxsackie rec eptor (CAR ) and Multidrug resistance(MDR) gene. The in vivo anti-tumor ef-
fect of CRAd and cisplatin was evaluated using a subcutaneous mouse model. Results: The CRAd sensitizes A549 cancer cells to
cisplatin. The mechanism of enhanced cell growth inhibition is associated with the increased CAR and MDR expression. Conclusion:
Our approach is better than the conventional gene th er apy and chemother apy strategy.
Keywords: Cisplatin; Adenovirus; Lung Cancer
1. Introduction
Lung cancer is a common malignancy [1], the majority of pa-
tients lost the chance of surgery when found, chemotherapy
play a ver y importan t role in the clin ical treatmen t of lung can-
cer and prolong survival in patients [2,3], but resistance of
chemotherapy drug has hindered its development [4]. Overex-
pression of the MDR gene is one of the mechanisms leads to
tumor cell multidrug resistance [5], while adenovirus cancer
gene therapy has rapidly developed in natural medicine, condi-
tionally replicative adenovirus (CRAd) is able to selectively
copy in tumor cells and spread to more tumor cells, CRAd not
only has a stronger tumor scavenging, but also to reduce the
liver toxic effects of less dosage. This experiment combined
CRAd with the chemotherapy drug cisplatin, explore the effect
and mechanisms of A549 and A549-DDP .
2. Methods
2.1. MTS/PMS Assa y
A549, A549-DDP cell s were seeded in 24-well plates, at a den-
sity of 1 × 105 per culture well,after 24 hours, each well (a)
treated three hours with different concentrations of cisplatin
0.25ug/ml, 1 ug /ml, 4 ug / ml, 16 ug / ml, 64 ug / ml; (b)
treated with different concentrations of CRAd virus 100MOI,
200MOI, 500MOI, 1000MOI, 2000MOI; (c) the treatment
group each hole by adding 100MOI CRAd for four hours, and
then different concentrations of cisplatin for three hours; (d)
treated with each hole by adding different concentrations of
cisplatin for three hours, then add 100MOI CRAd for four
hours; different treated cells transferred to 96 -well plate, three
wells, 5 × 10 3 cells per well, an d observed for 4 days to add the
MTS / PMS reagents,t he absorbance at 490nm was detected.
2.2. Semiquantitative Reve r se Tr anscriptio n PCR
A549 and A549- DDP cells were collected , total RNA was
extracted , each sample was converted to complementary
cDNA , pr imer sequence is below:
GAPDH: S: 5 'GATTGTTGCC ATCAACGACC3 ' AS :
5 'GTGCAGGATGC ATTGCTGAC 3' 371bp CAR:
S: 5 'CCACCTCCAAAGAGCCGTAC 3' AS:
5 'ATCACAGGAATCGCACCC 3' 218bp MDR:
S: 5 'TC GTA GGAGT GT C CGTGGAT 3' AS :
5 'CATTGGCGAGCCTGGT AG 3' 417bp
2.3. Tumor Model
BALB/C nude mice, female (6-8 weeks old) were acquired
from the Chinese Academy of Sciences, A549, A549- DDP
cells (4 × 106) inoculated subcutaneous into the right flank of
mice , Tumors were visible on the 15th day.
2.4. In Vivo Tumor Inhibiton Assay
BALB/C nude mice, female (6-8 weeks old). A549 (4 x 106),
A549-DDP (4 ×106) cells were inoculated subcutaneous into
the right flank of mice ,tumor bearing mice(n = 6 per group)
were divid ed in to thr ee group s.Mice in each group were treated
as follow: (a) cisplatin treatment group (b) CRAd treatment
group (c) cisplatin combined CRAd treatment group (first give
cislatin then give CRAd); Ad-luc virus transfected to each
treatment group, a certain period of time to observe the effect
by vivo imaging.
3. Results
1) After treated with different concentrations of cisplatin,
cisplatin can inhibit the proliferation of A549 cells, but the
A549-DDP cell proliferation inhibition was not obvious.
2) After treat ed with d ifferent concen trations o f CRAd virus,

Y. N. LIU, Y. H. HUANG
166
CRAd virus can inhibit the proliferation of A549 and A549-
DDP cells, the inhibitory effect of the CRAd virus on A549-
DDP cell line is more obvious.
3) Treated A549 and A54 9- DDP cells by combined with
cisplatin and CRAd virus ,we found th a t the inhibition of cell
treated b y the method mention ed at MTS/PMS assay group (d)
is more obvious than group (c) on A549-DDP cell line
4) PCR results showed that the expression of CAR in
A549-DDP cells increased, expression of MDR in A549-DDP
cells also increased .
5) Tumor in vivo experimental results show that the A549
and A549-DDP cell line can form tumor. In vivo inhibition
experiments showed that cisplatin combined with CRAd virus
group treatment is the most valid on tumor growth (data not
shown).
4. Discussion
Our experiments found that cisplatin combined virus is more
effects than the separate application of cisplatin, or separate
Figure 1. Inhibi tory effects evaluated with M TS/ PMS a ss ay for the
A549 and A549-DDP cells treated with different concentration of
DDP.
Figure 2. Inhibitory effects eval uated with MTS/ PM S ass ay for the
A549 and A549-DDP cells treated with different concentration of
CRAd.
Figure 3. Inhi bitory effects evaluated wi th MTS/PMS assay for the
A549 cells treated with DDP and CRAd.
Figure 4. Inhi bitory effects evaluated wi th MTS/PMS assay for the
A549-DDP ce lls treated with DDP and CRAd.
Figure 5. Gene expression of MDR and CAR were examined with
PCR.
application of virus on tumor cells, its mechanism may be re-
lated to the adenovirus receptor CAR expression upregulation
on the A549-DDP resistant cell lines. The key aspects of ade-
noviral transduction of adenovirus is combined with the cell
surface co xsackie ad enoviru s recept or (CAR), our experi mental
results show that the A549-DDP cell surface of CAR receptor
expression enhanced, making the virus is more easily infected
tumor cells, that is why the effect o f combined treat ment better
than simple treatment. There are another possible mechanism
that high expression of MDR gene on A549-DDP cell affects
the chemotherapy, combination therapy can enhance the thera-
peutic effect of chemotherapy . Tumor in vivo experimental
results show that both A549 and A549-DDP cell can form tu-
mor. The in vivo inhibition of experimental results show that
the cisplatin combined with CRAd virus group is not only can
inhibit the A549 cell lines, but also can play a good role in in-
hibition of tumor growth resistant cell line A549-DDP. Its me-
chanism may still be raised Coxsackie and adenovirus receptor
of tumor cells and affect the expression of MDR.
REFERENCES
[1] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA
Can cer J Clin .2012:62（1）:10-29.
[2] Socinski MA, Bogart JA. Limited-stage small-cell lung cancer:
the current status of combined-modality therapy. J Clin Oncol
200 7, 25 : 4137-4145.
[3] Wan L,Hyo-Im C,Mi-Jin K, et a.l Depletion ofmitochondrial
DNA up-regu lates t he exp ressio n of M DR1 gen e via an incr ease
in mRNA stability.Exp.Mo .lMed, 2 00 8, 4 0(1): 1 0 9-117.
[4] Paredes Lario A，Blanco Garcia C et al.Expression of proteins
ass ociat ed with multid rug resi stanc e and res ista nce to ch emothe-
rapy in lung cancer[J].Arch Bronconeumol，2007;43(9):479 一
484.
[5] Pujol JL,Simony J,Gautier V,et al.Immuno-histochemical study
of p-glycoprotein distribution in lung [J].Cancer,1993,10:1.