Paper Menu >>
Journal Menu >>
![]() Engineering, 2012, 5, 163-164 doi:10.4236/eng.2012.410B042 Published Online October 2012 (http://www.SciRP.org/journal/eng) Copyright © 2012 SciRes. ENG Antitumor Effects of Conditional Replication Adenovirus in Combination with Cisplatin on Lung Cancer Yanan Liu, Yinghui Hua ng China-Japan Union Hospital ofJilin university, Jilin, China Email: dl0009@sina.com, yhuang@jlu.edu.cn Received 2012 ABSTRACT Object: To explore the therapeutic effects and therapeutic mechanisms of Conditional Replication Adenovirus(CRAd) in combination with cisplatin on lung cancer cells. Methods: Using MTS / PMS assay, in vitro cell inhib ition assay was performed t o detect the cel l viability of two lung cancer cell lines, NCI-H292 and NCI-H661. PCR was emplo yed t o d etect th e Coxsackie r ecept or (CAR) e xpres- sion of can cer cells. The in vivo anti-tumor effect of CR Ad and cisplatin was evaluat ed using a subcu taneous mouse mod el. Results: The CRAd with cisplatin is superior to the use of cisplatin or CRAd viruse alone on the suppression of lung cancer cell growth. The mechanism of inhibition is associated with the increased CAR expression. Conclusion: The application of CRAd in combination with cisplatin could play a better therap eutic effect on lun g cancer cell growth in hi bition. Keywords: Lu ng Cancer; Adenovirus; Cisplatin 1. Introduction Lung cancer is the second highest incidence of malignant tu- mors and the most common cause of cancer mortality [1]. Cis- platin (also known as DDP) is a chemotherpeutic drug often used to treat lung cancer, but serious side effects and drug re- sistance have severe impacts on clinical application [2,3]. CRAd (conditionally replication adenovirus) is able to specifi- cally replicate and proliferate in tumor cells. When the tumor cells are l ysised, then progeny virus will be releas ed and in fect the surrounding tumor cells.The adenovirus in combination with che moth erap y treatmen t o f can cer h as b ecome an e ffective tool on cance treatment[4]. This experiment will explore the therapeutic effect and mechanism of CRAd combined with cisplatin in the treatment of lung cancer cell lines NCI-H292, NCI-H661 in vitro and in vivo. 2. Methods 2.1. In vitro C e ll Inhibition A ssay NCI-H292,NCI-H661 cell s were seeded in 24-well plat es , at a density of 1 × 105per culture well,after 24 hours, each well (a) treated three hours with different concentrations of cisplatin 0.25ug/ml, 1 ug /ml, 4 ug / ml, 16 ug / ml, 64 ug / ml; (b) treated with different concentrations of CRAd virus 100MOI, 200MOI, 500MOI, 1000MOI, 2000MOI; (c) the treatment group each hole by adding 100MOI CRAd for four hours, and then different concentrations of cisplatin for three hours; (d) treated with each hole by adding different concentrations of cisplatin for three hours, then add 100MOI CRAd for four hours; different treated cells transferred to 96 -well plate, three wells, 5 × 10 3 cells per well, and obs erved for 5 days to add the MTS / PMS reagents,the abs orbance at 490nm was detected. 2.2. Semiquantitative Reverse Transcription PCR After treated with cisplatin, NCI -H292 and NCI-H661 cells were collected , total RNA was extracted , each sample was convert ed to complementary cDNA , primer sequen ce is belo w: GAPDH: S: 5'GATTGTTGCCATCAACGACC3 ' AS: 5 'GTGCAGGATGCATTGCTGAC 3' 371bp CAR: S: 5 'CCACCTCCAAAGAGCCGTAC 3' AS: 5 'AT C AC A GGAATCGCACCC 3' 218bp 2.3. Tumor Model BALB/C nude mice, female (6-8 weeks old) were acquired from the Chinese Academy of Sciences, NCI -H292,NCI-H661 cells (4 × 106) inoculated subcutaneous into the right flank of mice , Tumors were visible on the 15th day in NCI-H292 cell, NCI-H661 did not form tumors. 2.4. In Vivo Tumor Inhibition Assay BALB/C nude mice, female (6-8 weeks old). NCI-H292 (8 x 106), NCI-H661 (8 ×106) cells were inoculated subcutaneous into the right flank of mice ,tumor bearing mice(n = 6 per group) were divid ed in to thr ee group s.Mice in each group were treated as follow: (a) cisplatin treatment group (b) CRAd treatment group (c) cisplatin combine CRAd treatment group (first give cislatin then give CRAd); Ad-luc virus transfected to each treatment group, a certain period of time to observe the effect by vivo imaging. 3. Results 1) Cisplatin could inhibit NCI-H292, NCI-H661 cell growth in a dose-dependent manner. No difference on the inhibition was found between the two cell lines 2) CRAd virus could significantly suppress the growth of NCI-H661 cells, but not on NCI-H292 cell line. ![]() Y. N. LIU, Y. H. HUANG Copyright © 2012 SciRes. ENG 164 Fi gur e 1. I nhibi tory eff ects eva luated with MTS/PMS assay for the NCI-H292 and NCI-H661 cells treated with different concentration of DDP. Figure 2. I nhi bi tory eff ect s e val uate d w ith MT S/PM S as say for the NCI-H292 and NCI-H661 cells treated with different concentration of CRAd. Figure 3. I nhi bi tory eff ect s e val uate d w ith MT S/PM S as say for the NCI-H292 cells treated with DDP and CRAd. Figure 4. I nhi bi tory eff ect s e val uate d w ith MT S/PM S as say for the NCI-H661cells treate d with DDP and CRAd. Figure 5. Gene expres si on o f MDR was examined with P CR. 3) In combination with cisplatin and viral approach that MTS/PMS assay (d) is more obvious than the(c) inhibition of NCI-H292,NCI-H661 cells 4) P CR results showed that cisplatin promoted expression of CAR in the NCI-H292, NCI-H661 cells. 5) Tumor formation assay showed that NCI-H292 cell lines can form tumors, NCI-H661 cell lines is not easy to form a tumor. 6) The in vivo cell inhibition assay showed that enhanced inhibition of tumor growth was found in the group of cisplatin combined with CRAd virus. 4. Discussion Our experimental results show that combined cisplatin and the virus is more ef fe ctive than the separat e application of cisplatin, or alone virus in the inhibition of tumor cell, the mechanism may be raised with cisplatin on the expression of adenovirus CAR receptor.Th e key aspects of adeno vi ral tran s duction is that adenovirus and the cell surface coxsackie adenovirus receptor (CAR) [5] combining. Our experimental results show that the CAR of the cell surface receptor expression is enhanced by cisplatin, making the virus easier to invasive tumor cells, the combined treatment effects b etter than th e simple . Tu mo r in vivo experiments show that the transfer properties of the tumor cell line NCI-H292 more easily format tumor than without metastasis of cell line NCI-H661 , in vivo inhibition of experimental results show that cisplatin combined CRAd virus group, inhibition of tumor growth and metastasis is the most effective. I ts mechan ism may sti ll be raised coxsackie aden ovi- rus rec e pt or of tumor cells. REFERENCES [1] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Can cer J Clin . 2012 : 62(1):10-29. [2] Aran y I,Safirstein RL.Cisplatin nephrotoxicity.Semin NePhlol. 2003; 23 (5): 460 -464. [3] Uyama N,Hatano E,Maetani Y,et al. Efficacy and toxicity of transcatheter arterial chemoembolization with cisplatin sus- pended inlipiodol for unresectable hepatocellularearcino- ma.GanT o Kagaku Ryoho,2008;35(5):775-780 [4] Chu RL,Post DE,Khuri FR,et al.Use of Replicating Oncolytic Adenoviruses in Combination Therapy for Caneer.Clinical Can- cer Research .2004; 10(16): 5299- 5312. [5] Honda T, Saitoh H,Masuko M,et al.The coxsackievirus adenovirus receptor protein as a cell adhesion molecule in the developing mouse brain [J] .Brain Res Mol Brain Res, 2000,77:19-8. |