Engineering, 2012, 5, 163-164
doi:10.4236/eng.2012.410B042 Published Online October 2012 (http://www.SciRP.org/journal/eng)
Antitumor Effects of Conditional Replication Adenovirus in
Combination with Cisplatin on Lung Cancer
Yanan Liu, Yinghui Hua ng
China-Japan Union Hospital ofJilin university, Jilin, China
Received 2012
ABSTRACT
Object: To explore the therapeutic effects and therapeutic mechanisms of Conditional Replication Adenovirus(CRAd) in combination
with cisplatin on lung cancer cells. Methods: Using MTS / PMS assay, in vitro cell inhib ition assay was performed t o detect the cel l
viability of two lung cancer cell lines, NCI-H292 and NCI-H661. PCR was emplo yed t o d etect th e Coxsackie r ecept or (CAR) e xpres-
sion of can cer cells. The in vivo anti-tumor effect of CR Ad and cisplatin was evaluat ed using a subcu taneous mouse mod el. Results:
The CRAd with cisplatin is superior to the use of cisplatin or CRAd viruse alone on the suppression of lung cancer cell growth. The
mechanism of inhibition is associated with the increased CAR expression. Conclusion: The application of CRAd in combination with
cisplatin could play a better therap eutic effect on lun g cancer cell growth in hi bition.
Keywords: Lu ng Cancer; Adenovirus; Cisplatin
1. Introduction
Lung cancer is the second highest incidence of malignant tu-
mors and the most common cause of cancer mortality [1]. Cis-
platin (also known as DDP) is a chemotherpeutic drug often
used to treat lung cancer, but serious side effects and drug re-
sistance have severe impacts on clinical application [2,3].
CRAd (conditionally replication adenovirus) is able to specifi-
cally replicate and proliferate in tumor cells. When the tumor
cells are l ysised, then progeny virus will be releas ed and in fect
the surrounding tumor cells.The adenovirus in combination
with che moth erap y treatmen t o f can cer h as b ecome an e ffective
tool on cance treatment[4]. This experiment will explore the
therapeutic effect and mechanism of CRAd combined with
cisplatin in the treatment of lung cancer cell lines NCI-H292,
NCI-H661 in vitro and in vivo.
2. Methods
2.1. In vitro C e ll Inhibition A ssay
NCI-H292，NCI-H661 cell s were seeded in 24-well plat es , at a
density of 1 × 105per culture well,after 24 hours, each well (a)
treated three hours with different concentrations of cisplatin
0.25ug/ml, 1 ug /ml, 4 ug / ml, 16 ug / ml, 64 ug / ml; (b)
treated with different concentrations of CRAd virus 100MOI,
200MOI, 500MOI, 1000MOI, 2000MOI; (c) the treatment
group each hole by adding 100MOI CRAd for four hours, and
then different concentrations of cisplatin for three hours; (d)
treated with each hole by adding different concentrations of
cisplatin for three hours, then add 100MOI CRAd for four
hours; different treated cells transferred to 96 -well plate, three
wells, 5 × 10 3 cells per well, and obs erved for 5 days to add the
MTS / PMS reagents,the abs orbance at 490nm was detected.
2.2. Semiquantitative Reverse Transcription PCR
After treated with cisplatin, NCI -H292 and NCI-H661 cells
were collected , total RNA was extracted , each sample was
convert ed to complementary cDNA , primer sequen ce is belo w:
GAPDH: S: 5'GATTGTTGCCATCAACGACC3 ' AS: 5
'GTGCAGGATGCATTGCTGAC 3' 371bp CAR: S: 5
'CCACCTCCAAAGAGCCGTAC 3' AS: 5
'AT C AC A GGAATCGCACCC 3' 218bp
2.3. Tumor Model
BALB/C nude mice, female (6-8 weeks old) were acquired
from the Chinese Academy of Sciences, NCI -H292，NCI-H661
cells (4 × 106) inoculated subcutaneous into the right flank of
mice , Tumors were visible on the 15th day in NCI-H292 cell，
NCI-H661 did not form tumors.
2.4. In Vivo Tumor Inhibition Assay
BALB/C nude mice, female (6-8 weeks old). NCI-H292 (8 x
106), NCI-H661 (8 ×106) cells were inoculated subcutaneous
into the right flank of mice ,tumor bearing mice(n = 6 per group)
were divid ed in to thr ee group s.Mice in each group were treated
as follow: (a) cisplatin treatment group (b) CRAd treatment
group (c) cisplatin combine CRAd treatment group (first give
cislatin then give CRAd); Ad-luc virus transfected to each
treatment group, a certain period of time to observe the effect
by vivo imaging.
3. Results
1) Cisplatin could inhibit NCI-H292, NCI-H661 cell growth
in a dose-dependent manner. No difference on the inhibition
was found between the two cell lines
2) CRAd virus could significantly suppress the growth of
NCI-H661 cells, but not on NCI-H292 cell line.

Y. N. LIU, Y. H. HUANG
164
Fi gur e 1. I nhibi tory eff ects eva luated with MTS/PMS assay for the
NCI-H292 and NCI-H661 cells treated with different concentration
of DDP.
Figure 2. I nhi bi tory eff ect s e val uate d w ith MT S/PM S as say for the
NCI-H292 and NCI-H661 cells treated with different concentration
of CRAd.
Figure 3. I nhi bi tory eff ect s e val uate d w ith MT S/PM S as say for the
NCI-H292 cells treated with DDP and CRAd.
Figure 4. I nhi bi tory eff ect s e val uate d w ith MT S/PM S as say for the
NCI-H661cells treate d with DDP and CRAd.
Figure 5. Gene expres si on o f MDR was examined with P CR.
3) In combination with cisplatin and viral approach that
MTS/PMS assay (d) is more obvious than the(c) inhibition of
NCI-H292，NCI-H661 cells
4) P CR results showed that cisplatin promoted expression of
CAR in the NCI-H292, NCI-H661 cells.
5) Tumor formation assay showed that NCI-H292 cell lines
can form tumors, NCI-H661 cell lines is not easy to form a
tumor.
6) The in vivo cell inhibition assay showed that enhanced
inhibition of tumor growth was found in the group of cisplatin
combined with CRAd virus.
4. Discussion
Our experimental results show that combined cisplatin and the
virus is more ef fe ctive than the separat e application of cisplatin,
or alone virus in the inhibition of tumor cell, the mechanism
may be raised with cisplatin on the expression of adenovirus
CAR receptor.Th e key aspects of adeno vi ral tran s duction is that
adenovirus and the cell surface coxsackie adenovirus receptor
(CAR) [5] combining. Our experimental results show that the
CAR of the cell surface receptor expression is enhanced by
cisplatin, making the virus easier to invasive tumor cells, the
combined treatment effects b etter than th e simple .
Tu mo r in vivo experiments show that the transfer properties
of the tumor cell line NCI-H292 more easily format tumor than
without metastasis of cell line NCI-H661 , in vivo inhibition of
experimental results show that cisplatin combined CRAd virus
group, inhibition of tumor growth and metastasis is the most
effective. I ts mechan ism may sti ll be raised coxsackie aden ovi-
rus rec e pt or of tumor cells.
REFERENCES
[1] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA
Can cer J Clin . 2012 : 62（1）:10-29.
[2] Aran y I，Safirstein RL.Cisplatin nephrotoxicity.Semin NePhlol.
2003; 23 (5): 460 -464.
[3] Uyama N，Hatano E，Maetani Y，et al. Efficacy and toxicity
of transcatheter arterial chemoembolization with cisplatin sus-
pended inlipiodol for unresectable hepatocellularearcino-
ma.GanT o Kagaku Ryoho，2008;35(5):775-780
[4] Chu RL，Post DE，Khuri FR,et al.Use of Replicating Oncolytic
Adenoviruses in Combination Therapy for Caneer.Clinical Can-
cer Research .2004; 10(16): 5299- 5312.
[5] Honda T， Saitoh H，Masuko M，et al.The coxsackievirus
adenovirus receptor protein as a cell adhesion molecule in the
developing mouse brain [J] .Brain Res Mol Brain Res，
2000,77:19-8.