Open Journal of Endocrine and Metabolic Diseases, 2013, 3, 1-11
http://dx.doi.org/10.4236/ojemd.2013.34A2001 Published Online August 2013 (http://www.scirp.org/journal/ojemd)
Contribution of Estrogen to Sex Dimorphic Expression of
Cardiac Natriuretic Peptide and Nitric Oxide Synthase
Systems in ANP Gene-Disrupted Mice
Philip G. Wong, David W. J. Armstrong, M. Yat Tse, Nicole M. Ventura, Stephen C. Pang*
Department of Biomedical and Molecular Sciences, Queen’s University, Kingston, Canada
Received May 29, 2013; revised June 29, 2013; accepted July 23, 2013
Copyright © 2013 Philip G. Wong et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
Background: Sex dimorphism in the prevalence, onset, development and progression of cardiovascular disease (CVD)
is well recognized, but the mechanisms whereby sex hormones which are believed to confer cardioprotection are still
not fully understood. Objectiv e: This study more closely delineates the effect of 17β-Estradiol (E2) on the expression
and signaling of the cardiac NP and NOS systems, well-known cardioprotective modulators of the cardiac hypertrophy
(CH) response, that both contribute to downstream production of cyclic guanosine 3’,5’-monophosphate (cGMP). Ma-
terials and Methods: Ovariectomized (OVX) female ANP+/+ and ANP−/− mice, 6 - 7 weeks old, were subjected to a
five-week treatment with E2 (100 μg/100 μL/day) or vehicle (VEH). Left ventricle from these treatment groups, along
with that from age-matched male ANP+/+ and ANP−/− mice was used to assess expression of these systems by real-time
quantitative PCR (qPCR). Left ventricle tissue and plasma cGMP were measured by enzyme immunoassay to assess
alterations in resultant downstream signaling. Results: NP system expression was unchanged across genotype, sex and
E2 treatment. Sex-specific differences in NOS system expression were observed; female mice showed an increased ex-
pression of NOS system genes that were significantly elevated in all but one of the E2 treatment groups. Left ventricle
tissue cGMP remained unchanged across genotype, sex and E2 treatment. Plasma cGMP levels were unchanged in
ANP+/+ treatment groups. In ANP−/− treatment groups, plasma cGMP in the female OVX-E2 mice was significantly
higher compared to male and female OVX-VEH mice. Conclusion: These findings demonstrate that in the absence of
ANP, E2 upregulates cardiac NOS system expression to produce cGMP. This study confirms the importance of the car-
diac NOS system in females; this particular system may be a promising future target for sex-specific treatments and
therapies for CVD in women.
Keywords: Estrogen; Atrial Natriuretic Peptide; Nitric Oxide Synthase; Sex Dimorphism; Heart
1. Introduction
Cardiovascular disease (CVD) is a leading cause of mor-
bidity and mortality in the Western population; the past
decade has seen a decline in the rate of CVD related
deaths, but the burden of CVD continues to remain high
[1]. CVD-related mortality in older women is higher than
in older men; the contribution of sex hormone depletion
in menopause to the development of CVD remains con-
troversial [2]. Nevertheless, the dichotomy in sex-spe-
cific clinical CVD-related outcomes warrants further and
more complete investigation into sex-specific mecha-
nisms that presumably confer cardioprotection.
The development of cardiac hypertrophy (CH) is well
established as a primary independent risk factor for, and
indicator of future development of hypertension and as-
sociated CVD [3]. CH is a maladaptive increase in car-
diac mass that occurs as a consequence of a re-induction
of fetal cardiac gene programs, promoting cardiac adap-
tation to pathological stimuli [4]. The natriuretic peptide
(NP) and nitric oxide synthase (NOS) systems are con-
sidered to be cardioprotective, and responsible for the
modulation of the CH response through convergent down-
stream production of cyclic guanosine 3’,5’-mono-phos-
phate (cGMP), a secondary messenger that activates pro-
tein kinase G (PKG) which is responsible for the further
regulation of downstream gene systems that contribute to
maintenance and regulation of cardiomyocyte growth,
and modulation of cardiac remodeling [5-7].
*Corresponding author.
C
opyright © 2013 SciRes. OJEMD

P. G. WONG ET AL.
2
Recently, we presented evidence of the existence of
sex-specific differences in the expression of the cardiac
NP and NOS systems in ANP gene-disrupted mice
(ANP−/−), documenting how each sex utilizes a different
system to conserve downstream cGMP production [8].
Interestingly, changes in NOS system expression were
found to mirror the cyclical changes of the estrous cycle.
As an extension to these findings, the current study was
undertaken to determine and confirm if this female-spe-
cific estrous cycle-mediated alteration in cardiac gene
expression is sex hormone mediated, and specifically
attributable to estrogen. In this study, we explored the
direct impact of 17β-Estradiol (E2) on the expression and
signaling of the cardiac NP and NOS systems in ova-
riectomized (OVX) female ANP+/+ and ANP−/− mice
subjected to a five-week treatment of either E2 or vehicle
(VEH), compared to age matched male ANP+/+ and
ANP−/− mice.
It is well accepted that the NP and NOS systems can
exert effects, both systematically and targeted to indi-
vidual organs. In this study, we will focus on the organ-
specific effects of these systems. Specifically, we will
focus this study on the estrogenic influence on gene sys-
tems that are directly implicated in the modulation of the
cardiac hypertrophic response. Presently, the use of hor-
mone replacement therapy (HRT) has received close
scrutiny with regard to its efficacy and associated spec-
trum of risks and benefits. A deeper understanding of the
role of sex hormones in female-specific cardiac protec-
tion is warranted [9]. Deciphering the intricacies of sex
hormone influence on the heart will add to our under-
standing of female-specific mechanisms of cardioprotec-
tion, supplement existing research pertaining to the use
and implementation of HRT, and further contribute to
future development of sex-specific targeted therapies and
treatments for CVD in women.
2. Materials and Methods
2.1. Experimental Animals
ANP+/+ and ANP−/− mice were bred and maintained by
Animal Care Services at Queen’s University, Kingston,
Ontario, Canada. This mouse colony was established
from breeding pairs originating from the laboratory of
Oliver Smithies, and has been maintained at Queen’s
University since 1995. Mice were housed in plastic cages
(maximum of four animals per cage), maintained at room
temperature (21˚C ± 1˚C) on a 12-hour light: 12-hour
dark schedule, and allowed access to normal mouse chow
and tap water ad libitum. Experimental animal protocols
were approved by the Animal Care Committee at
Queen’s University in accordance with the Canadian
Council on Animal Care. Genotyping of mice was ac-
complished using a tail sample retrieved at 3 weeks of
age and processed using a previously published PCR-
based method [10].
2.2. Ovariectomy
Female ANP+/+ and ANP−/− mice, 6 - 7 weeks of age,
were ovariectomized (OVX) using sterile technique.
Briefly, each mouse was anesthetized by isoflurane, the
dorsum shaved, and a single midline incision was made.
Subcutaneous spaces on either side of the incision were
made by blunt dissection. Bilateral access to the abdo-
men was achieved through two small incisions in the
posterior abdominal wall. Ovaries were exteriorized,
removed using sharp scissors and the intact uterine horns
returned to the abdomen. The midline skin incision was
closed and secured by two removable metal staples.
Bupivacaine (one dose post-surgery, 1 mg/kg body
weight) and Metacam (two doses, one dose post-surgery
and the second 24 hours post-surgery, 1 mg/kg body
weight) were administered for post-operative pain man-
agement.
2.3. 17β-Estradiol (E2) Administration
Administration of E2 commenced 1 - 2 weeks post-OVX.
E2 was dissolved in ethanol and diluted in sterilized corn
oil. Subcutaneous E2 injections delivered 100μg/100μL
daily over a five-week period. This dose was based upon
previously published work from our lab documenting the
cardioprotective effects of E2 in ANP−/− mice treated
with high dietary salt [11,12].
2.4. Plasma and Tissue Collection
Collection of plasma and cardiac tissues was accom-
plished by a previously published method [8]. Briefly,
mice were anesthetized using Somnotol (100 mg/kg body
weight). Blood was collected by cardiac puncture and
added to tubes containing aprotinin (1000 KIU/mL) and
disodium ethylenediaminetetraacetic acid (EDTA, 2
μmol/mL). Blood samples were centrifuged at 8000 ×g
for 10 minutes and the retrieved plasma was stored at
−80˚C. Following blood collection, the heart was har-
vested and dissected, separating left and right atria, left
ventricle (including ventricular septum) and right ventri-
cle. Heart chambers were weighed, divided into smaller
pieces (approximately 25 mg each), then snap frozen in
liquid nitrogen and stored at −80˚C.
2.5. 17β-Estradiol (E2) Enzyme Immunoassay
Plasma levels of E2 were assessed to confirm successful
administration of E2 in experimental animals using an E2
EIA (item no: 582251, Cayman Chemical Company, Ann
Arbor, MI, USA). Undiluted plasma samples were as-
sayed directly. Background activity was determined by

P. G. WONG ET AL.
3
stripping control plasma samples with dextran coated
Norit A charcoal (Cat. No.: AC40403-5000 Fisher Scien-
tific, Ottawa, Ontario, Canada). The detection limit for
this assay is 19 pg/mL.
2.6. Isolation of RNA and Generation of cDNA
by Reverse Transcription
Left ventricle tissue RNA was isolated by a modified
Trizol method utilizing a high pure RNA tissue isolation
kit (Cat. No. 11828665001, Roche Scientific Co., Laval,
QC, Canada). Subsequent reverse transcription of RNA
to cDNA was accomplished using a high-capacity cDNA
reverse transcription kit (Applied Biosystems, Streets-
ville, ON, Canada). Protocols were performed according
to manufacturer’s instructions; further experimental pro-
tocol details were previously published [8].
2.7. Real-Time Quantitative PCR
Analysis of expression of the NP and NOS systems was
determined relative to GAPDH mRNA using qPCR
(Roche LightCycler 480 II System, Laval, QC, Canada).
Roche LightCycler 480 II internal software was used to
determine relative quantification of gene levels by plot-
ting crossing point (Cp) values against standard curves
derived from each specific primer set. Primer sets were
designed using Primer Designer version 2.01 (Scientific
and Educational Software, Cary, Indiana, USA) in ac-
cordance with published GenBank sequences
(http://www.ncbi.nlm.nih.gov/Genbank). Conventional
PCR was used to confirm that these primer sets amplified
a single amplicon of the correct size. These primer sets
along with their respective annealing temperatures and
standard curve efficiencies are listed in Table 1. Only
primer sets yielding efficiencies within a range of 1.9 -
2.1 were used.
2.8. Cyclic GMP Enzyme Immunoassay
Left ventricle tissue and plasma levels of cGMP were
measured using a cGMP enzyme immunoassay (EIA) kit
(Item No.: 581021, Cayman Chemical Company, Ann-
Arbor, MI, USA). The detection limit for this assay is 0.1
pmol/mL. The immunoassay was carried out according
to the manufacturer’s instructions; further details per-
taining to the cGMP extraction from both left ventricle
tissue and plasma were previously published [8].
2.9. Data and Statistical Analysis
Left ventricle tissue weight to body weight ratios of male,
female OVX-VEH and female OVX-E2 ANP+/+ and
ANP−/− mice were compared using 2-way ANOVA with
Table 1. Real-time qPCR primer sets, annealing temperatures (Ta) and standard curve efficiency values for the NP and NOS
system genes assessed.
GENE SEQUENCE ANNEALING
TEMPERATURES (Ta)
STANDARD CURVE
EFFICIENCY
ANP S CAAGAACCTGCTAGACCACC
AS AGCTGTTGCAGCCTAGTCC
62˚C
63˚C 2.036
BNP S CCAGAGACAGCTCTTGAAGG
AS TCCGATCCGGTCTATCTTG
63˚C
63˚C 2.026
NPR-A S CCAGCATCCTTCCATGAC
AS GTTCCACATCCGCTGAGT
61˚C
61˚C 2.047
NP System
NPR-C S CAGCAGACTTGGAACAGGA
AS CCATTAGCAAGCCAGCAC
62˚C
62˚C 2.079
iNOS S CCAGGCTGGAAGCTGTAAC
AS AGTGATGGCCGACCTGAT
63˚C
63˚C 2.003
eNOS S TTGAGGATGTGGCTGTGTG
AS GAGTTAGGCTGCCTGAGATG
63˚C
63˚C 1.988
sGCα1
S TGTGATCGCATCATGGTG
AS CTCTGTTGGCTCCTTAGGAA
61˚C
62˚C 2.089
NOS System
sGCβ1 S TTCGTCTTCTGCCAGGAGT
AS CCGAGTAGTAGTGCAGGATGA
63˚C
63˚C 2.087
GAPDH S TGACTCCACTCACGGCAA
AS ACTCCACGACATACTCAGCAC
63˚C
63˚C 1.909
S
ense (S, forward direction), Anti-Sense (AS, reverse direction).

P. G. WONG ET AL.
4
Bonferroni’s post hoc test. Within each genotype, plasma
E2 levels were compared in female OVX-VEH and fe-
male OVX-E2 treatment groups using unpaired Student’s
t test. All mRNA gene expression data using qPCR and
assessment of cGMP levels in both left ventricle tissue
and plasma were compared using one-way ANOVA with
Tukey’s post hoc test. Data were plotted and statistical
analysis was performed using Graph Pad Prism 6 soft-
ware (La Jolla, CA, USA). Other than stated, all data are
presented as means ± SEM. P ≤ 0.05 was considered
statistically significant.
3. Results
3.1. Cardiac Mass and Body Weight for Male,
Female OVX-VEH and Female OVX-E2
ANP+/+ and ANP−/− Mice
Table 2 presents a summary of the cardiac mass and
body weight for male, female OVX-VEH and female
OVX-E2 ANP+/+ and ANP−/− mice. Left ventricle tissue
weight to body weight ratios (LVW/BW), rather than
whole heart weight to body weight ratios were used be-
cause changes in left ventricle mass are a more accurate
indicator of cardiac mass changes associated with hyper-
tension development. Male, female OVX-VEH and fe-
male OVX-E2 ANP−/− mice exhibited significantly larger
LVW/BW ratios compared to their respective ANP+/+
counterparts. Male ANP−/− mice had a significant in-
crease of 31% compared to male ANP+/+ mice. Female
OVX-VEH treated ANP−/− mice had a significant in-
crease of 41% compared to female OVX-VEH treated
ANP+/+ mice. Female OVX-E2 treated ANP−/− mice had
a significant increase of 38% compared to female OVX-
E2 treated ANP+/+ mice.
3.2. Delivery of 17β-Estradiol in Female OVX
ANP+/+ and ANP−/− Mice
Levels of plasma E2 detected in female OVX-VEH and
female OVX-E2 ANP+/+ and ANP−/− mice are shown in
Table 2. Female OVX-E2 ANP+/+ and ANP−/− mice had
significantly higher plasma E2 levels than their respec-
tive genotype female OVX-VEH counterparts. Plasma
E2 levels were more prominently elevated in the female
OVX-E2 ANP+/+ mice compared to the female OVX-E2
ANP−/− mice.
3.3. Cardiac Natriuretic Peptide System
Expression of ANP and BNP, and their associated re-
ceptors NPR-A and NPR-C (clearance receptor) is shown
in Figure 1. Expression of ANP in male ANP+/+ mice
was higher than female OVX-VEH and female OVX-E2
ANP+/+ mice, but this increase did not reach statistical
significance. There was no significant difference in the
expression of BNP, NPR-A and NPR-C across genotype,
gender, or treatment with E2.
3.4. Cardiac Nitric Oxide Synthase System
The mRNA expression of iNOS, eNOS, sGCα1 and
sGCβ1 is shown in Figure 2. In both genotypes, there
was a trend towards increased expression of NOS system
counterparts in female OVX-VEH mice compared to
males of the same respective genotypes. The trend con-
tinues with female OVX-E2 mice demonstrating in-
creased expression of NOS system counterparts com-
pared to female OVX-VEH mice of the same respective
genotypes. Expression of iNOS in female OVX-VEH
ANP−/− mice was significantly higher compared to male
ANP−/− mice. Female OVX-VEH ANP−/− mice had sig-
nificantly higher levels of iNOS compared to female
OVX-E2 ANP−/− mice. In both genotypes, expression of
eNOS was significantly higher in the female OVX-VEH
treated mice compared to males. As well, in both geno-
types, with the exception of iNOS expression in the
ANP+/+ mouse treatment groups, levels of iNOS, eNOS,
sGCα1 and sGCβ1 expression were found to be signifi-
Table 2. Plasma 17β-Estradiol (E2) levels and cardiac mass data for male, female OVX-VEH and female OVX-E2 ANP+/+ and
ANP−/− mice.
GENDER GENOTYPE TREATMENT E2 (pg/mL) nLVW (mg) BW (g) LVW/BW (mg/g)
ANP+/+ n/a n/a 477.3 ± 4.1 23.8 ± 0.9 3.2 ± 0.1
Male
ANP−/− n/a n/a 4123.1 ± 9.5 29.5 ± 0.5 4.2 ± 0.4**
ANP+/+ OVX-VEH 5.6 ± 1.7 565.3 ± 3.2 24.8 ± 0.6 2.7 ± 0.2
ANP−/− OVX-VEH 3.2 ± 1.5 591.2 ± 3.6 24.1 ± 0.5 3.8 ± 0.1**
ANP+/+ OVX-E2 50.3 ± 9.5* 569.5 ± 3.6 24.0 ± 1.0 2.9 ± 0.1
Female
ANP−/− OVX-E2 19.5 ± 2.5* 6105.5 ± 7.2 26.1 ± 0.6 4.0 ± 0.2**
Plasma E2 data are presented as means ± S.E.M. *P ≤ 0.05 compared to OVX-VEH of the same respective genotype, using unpaired Student’s t test. N = 4 - 5.
Cardiac mass data are presented as mean ± SD. **P ≤ 0.05 compared to ANP+/+ genotype in males, and compared to ANP+/+ genotype and treatment (VEH or E2)
in females, using 2-way ANOVA and Bonferroni’s post hoc test. N = 4 - 6.

P. G. WONG ET AL. 5
Figure 1. NP System Gene Expression-ANP mRNA expression in male, female OVX-VEH and female OVX-E2 ANP+/+ mice
(A); BNP mRNA expression in male, female OVX-VEH and female OVX-E2 ANP+/+ mice (B), BNP mRNA expression in male,
female OVX-VEH and female OVX-E2 ANP−/− mice (C); NPR-A expression in male, female OVX-VEH and female OVX-E2
ANP+/+ mice (D), NPR-A mRNA expression in male, female OVX-VEH and female OVX-E2 ANP−/− mice (E); NPR-C expres-
sion in male, female OVX-VEH and female OVX-E2 ANP+/+ mice (F), NPR-C mRNA expression in male, female OVX-VEH
and female OVX-E2 ANP−/− mice (G); Data are presented as means ± S.E.M. *P ≤ 0.05, using one-way ANOVA and Tukey’s
post hoc test. N = 4 - 6.
cantly higher in female OVX-E2 treated mice compared
to their respective male ANP+/+ and ANP−/− mouse treat-
ment groups.
3.5. Cyclic GMP Enzyme Immunoassay
Figure 3 shows the results of measurement of cGMP
levels found in left ventricle tissue and plasma in male,
female OVX-VEH and female OVX-E2 ANP+/+ and
ANP−/− mice. In both ANP+/+ and ANP−/− mice, there was
no significant difference in left ventricle cGMP levels
regardless of sex or treatment. In ANP+/+ mice, there was
no significant difference in plasma cGMP levels between
male, female OVX-VEH an female OVX-E2 mice. In d

P. G. WONG ET AL.
6
Figure 2. NOS System Gene Expression-iNOS mRNA expression in male, female OVX-VEH and female OVX-E2 ANP+/+
mice (A); iNOS mRNA expression in male, female OVX-VEH and female OVX-E2 ANP−/− mice (B); eNOS mRNA expression
in male, female OVX-VEH and female OVX-E2 ANP+/+ mice (C); eNOS mRNA expression in male, female OVX-VEH and
female OVX-E2 ANP−/− mice (D); sGCα1 expression in male, female OVX-VEH and female OVX-E2 ANP+/+ mice (E); sGCα1
mRNA expression in male, female OVX-VEH and female OVX-E2 ANP−/− mice (F); sGCβ1 expression in male, female OVX-
VEH and female OVX-E2 ANP+/+ mice (G), sGCβ1 mRNA expression in male, female OVX-VEH and female OVX-E2 ANP−/−
mice (H); Data are presented as means ± S.E.M. *P ≤ 0.05, using one-way ANOVA and Tukey’s post hoc test. N = 3 - 4.
ANP−/− mice, female OVX-E2 mice had significantly
higher levels of plasma cGMP compared to male and fe-
male OVX-VEH mice.
4. Discussion
While it is acknowledged and accepted that males and
females are different, particularly in the prevalence, onset
and development of risk factors that lead to CVD, this
recognition has been slow to translate into both clinical
and basic science research practice. Regardless of sex,
women continue to be administered the same therapeu-
tics as men, weight-adjusted for use by females. As well,
the predominance of male-only studies in basic science
research continues to be a widespread limitation to ex-
perimental scope, design and applicability. Sex is an im-
portant factor in the modultion of the progression of a

P. G. WONG ET AL. 7
Figure 3. Left ventricle tissue cGMP (pmol/g) in male, female OVX-VEH and female OVX-E2 ANP+/+ mice (A) and in male,
female OVX-VEH and female OVX-E2 ANP−/− mice (B); Plasma cGMP concentrations (pmol/mL) in male, female OVX-
VEH and female OVX-E2 ANP+/+ mice (C) and in male, female OVX-VEH and female OVX-E2 ANP−/− mice (D); Data are
presented as means ± S.E.M. *P ≤ 0.05, using one-way ANOVA and Tukey’s post hoc test. N = 3 - 6.
physiological and pathological changes to the myocar-
dium, and should be a primary consideration in the de-
velopment of more effective therapeutics to treat CVD
[13]. Furthermore, the significant increase in CVD re-
lated morbidity and mortality in post-menopausal fe-
males supports the role of sex as a cardiovascular system
modifier, confirming the need for a targeted sex-specific
approach to CVD treatment [14].
It is well recognized that sex hormones contribute to
the sex dimorphism in the incidence and development of
cardiovascular risk factors and that sex hormone deple-
tion associated with the menopause can have an unfa-
vourable effect on the development of traditionally de-
fined CVD risk factors [15]. The prevailing concern of
the increased incidence of cardiovascular risk associated
with HRT has long cast suspicion on the beneficial ef-
fects of sex hormones [16]. However, recent review and
analysis of data retrieved from HRT studies and trials
reveals that in certain circumstances, taking into account
the mode of delivery, dosage, therapy regime, and time
between onset of menopause and HRT commencement,
HRT can in fact minimize cardiovascular risk factors
[17]. This continuing discrepancy in current opinions on
the delicate balance between the risks and benefits of
HRT only confirms that our knowledge and understand-
ing of sex hormone signaling and cardioprotective func-
tion remain incomplete.
This current study served multiple purposes: 1) to add
to our understanding of how sex hormones confer their
cardioprotective effect through modulation of cardiac
gene systems that impact cardiac remodeling mecha-
nisms; 2) to further elucidate and confirm if the estrous
cycle changes associated with changes in cardiac gene
system expression that we observed previously are in-
deed attributable to sex hormones, namely estrogen; and
3) to underline and support the idea that males and fe-
males are inherently different, and that each sex should
be considered and thus treated as such.
The development of CH is considered a primary risk
factor for CVD as these abnormal compensatory cellular
adaptations, as a consequence of pathological stimuli
such as chronically elevated hemodynamic demands and
adverse biomechanical stresses, can ultimately lead to
arrhythmia, heart failure and death [18]. The effect of
estrogen on the modulation of cardiac gene systems,
primarily through estrogen receptor β, affects the devel-
opment of the CH response and is thought to contribute
to its cardioprotective function in women [19-22]. The
cardiac NP and NOS systems modulate the CH response
and are able to be activated by systemic estrogen. E2 has
been found to attenuate the development of pressure-
overload hypertrophy induced by transverse aortic con-

P. G. WONG ET AL.
8
striction (TAC) and has been linked to an upregulation in
ANP expression [23]. This E2-induced activation of
ANP was further confirmed in the rat heart [24]. Sanga-
ralingham et al. also demonstrated the involvement of the
NP system in E2-mediated protection from salt-induced
cardiac hypertrophy in heterozygous pro-ANP gene-
disrupted (ANP−/−) mice [12]. In addition, E2 has been
found to stimulate components of the NOS system, iNOS
and eNOS, in the myocardium as evidenced from as-
sessment of the effect of E2 on neonatal and adult rat
cardiomyocytes [25]. The link between E2 and down-
stream eNOS signaling was confirmed in a study that
showed that OVX-mediated augmentation of pressure
overload hypertrophy caused resultant changes in Akt
and NOS signaling pathways [26]. Further investigation
into the impact of pressure overload and E2 signaling has
revealed that iNOS activity is mediated primarily by re-
sponse to pressure overload and eNOS activity is medi-
ated by E2 signaling [27].
Enlisting the use of the ANP−/− mouse model, the in-
terrelation between the NP and NOS systems and their
subsequent impact on downstream cGMP was further
delineated previously, confirming the existence of sex-
specific differences in the expression of these two sys-
tems, as well as an additional level of estrous cycle-me-
diated regulation of the NOS system [8]. However
tempting it is to directly attribute these gene expression
changes to sex hormones, it is important to note that the
estrous cycle is a physical manifestation of multiple,
complex signaling mechanisms, and sex hormones only
play a part. Thus, this study sought to confirm if in fact
these observed estrous cycle-mediated cardiac gene ex-
pression changes were indeed attributable to estrogen.
Ovariectomy (OVX) and subsequent reintroduction of
E2 into female ANP+/+ and ANP−/− mice served multiple
purposes: firstly, removal of the ovaries permitted as-
sessment of potential sex-specific, ovary-independent
factors that may contribute to sex dimorphic expression
of cardiac gene systems when comparing male ANP+/+
and ANP−/− mice age-matched with female OVX-VEH
ANP+/+ and ANP−/− mice. Secondly, reintroduction of E2
in the female ANP+/+ and ANP−/− OVX-E2 treatment
groups permitted demonstration of the sole effects of E2
on the expression of cardiac gene systems. This study
sought to confirm how E2 signaling is facilitated in tan-
dem through these two converging pathways, independ-
ent of other ovary specific factors and sex hormones, an
opportunity conveniently permitted by the ANP−/− mouse
model.
The ANP−/− mice are chronically hypertensive and
possess significant cardiac hypertrophy compared to its
wild type counterpart. As expected male, female OVX-
VEH and female OVX-E2 ANP−/− mouse treatment
groups exhibited significant cardiac hypertrophy com-
pared to their respective ANP+/+ treatment groups. Treat-
ment with E2 did not impact the extent of cardiac hyper-
trophy compared with vehicle treated groups in each re-
spective genotype.
Analysis of expression of the NP system components,
ANP, BNP, NPR-A and NPR-C was accomplished by
qPCR. There was no significant difference in the expres-
sion of these genes across genotype, sex and E2 treat-
ment. Expression of ANP was slightly elevated in male
ANP+/+ mice compared with female OVX-VEH and
OVX-E2 ANP+/+ mice, a pattern that was found previ-
ously when comparing ANP expression in male ANP+/+
mice compared with female ANP+/+ mice with intact ova-
ries in proestrus [8]. The absence of changes in the NP
system despite OVX and reintroduction of E2 was sur-
prising but not wholly unexpected. The wealth of studies
designating the NP system as a downstream target of E2,
often enlist transverse aortic constriction (TAC) or other
stressful means of procuring a pressure-overload hyper-
trophy in animal models [28-30]. The finding that rein-
troduction of E2 in OVX female mice, regardless of
genotype, does not alter expression of NP system com-
ponents confirms that although E2 is capable of enlisting
the NP system, it only does so in instances of significant
pathological insult and stress in order to contribute to the
upregulation of downstream cGMP.
Interestingly, it was the expression of NOS system
components, iNOS, eNOS, sGCα1 and sGCβ1 that dem-
onstrated and confirmed sex-specific differences as well
as the overriding regulation by E2. Levels of eNOS were
significantly elevated in female OVX-VEH ANP+/+ mice
compared with male ANP+/+ mice. As well, levels of both
iNOS and eNOS were significantly elevated in female
OVX-VEH ANP−/− mice compared with male ANP−/−
mice. This finding is significant because it provides clear
indication that the presence of sex hormones in females
with intact ovaries cannot alone account for the sex-spe-
cific differences in cardiac gene expression. Even despite
removal of the ovaries, a surgical intervention that should
in theory render females as phenotypic males, there is
something ovary-independent and intrinsically female
that contributes to the significantly higher levels of iNOS
and eNOS in females compared to males. This observa-
tion of ovary independent sex-specific differences is
similar to one made by O’Connell et al.; they noted that
ovariectomy of females did not ablate the sex-specific
differences observed in the function of α1-adrenergic
receptors and their impact on heart size and response to
pathological and physiological stimuli [31].
Analysis of the NOS system gene expression revealed
an overarching trend towards increased expression of
NOS system components in female OVX-VEH ANP+/+
and ANP−/− mice compared to their respective male
genotype counterparts. Furthermore, reintroduction of E2

P. G. WONG ET AL. 9
in female OVX-E2 ANP+/+ and ANP−/− mice resulted in a
trend towards even higher NOS system component gene
expression compared to both OVX-E2 and male ANP+/+
and ANP−/− mice. Expression of iNOS in female OVX-
E2 ANP−/− mice was significantly higher compared to
male ANP−/− mice. In both ANP+/+ and ANP−/− mice, le-
vels of eNOS, sGCα1 and sGCβ1 were significantly ele-
vated in female OVX-E2 mice compared with male mice.
These findings demonstrate that the presence of E2 fur-
ther augments the sex-specific differences observed in
the expression of the cardiac NOS system. The signifi-
cantly decreased level of iNOS in female OVX-E2
ANP+/+ mice compared to female OVX-VEH ANP+/+
mice is somewhat surprising. The classic understanding
of E2 signaling involves the concurrent increase in iNOS
and eNOS to facilitate downstream upregulation of
cGMP production [25]. However, it has been noted that
in some instances, including angiotensin II-based stimu-
lation of endothelial cells, E2 can effectively downregu-
late the expression of iNOS and eNOS [32]. One can also
speculate that in a situation of minimal stress, where sig-
naling through eNOS via E2 is sufficient and not requir-
ing recruitment of a significant amount of iNOS could
explain the lower levels of iNOS in female OVX-E2
ANP−/− mice compared with female OVX-VEH ANP−/−
mice. Regardless, these results show that the NOS sys-
tem is a key system that is activated by E2, and demon-
strates the sex dimorphic expression of cardiac genes;
E2-mediated signaling through the NOS system may
very well contribute to cardioprotective modulation of
the cardiac remodeling response.
As stated previously, both the NP and NOS systems
converge on the downstream production of secondary
messenger cGMP. Further signaling initiated by cGMP
acts on protein kinase G, which itself acts to inhibit car-
diac hypertrophic signaling systems including the cal-
cineurin-NFAT and CaM kinase signaling pathways [33,
34]. For both ANP+/+ and ANP−/− mice, left ventricle tis-
sue cGMP levels remained unchanged across sex, OVX
and E2 treatment. This was expected due to the tight re-
gulation of tissue cGMP levels; excess cGMP is immedi-
ately released into the systemic circulation or degraded
by local phosphodiesterases [35]. Plasma cGMP levels in
ANP+/+ mice remained unchanged across sex, OVX and
E2 treatment. In ANP−/− mice, there was no change in
plasma cGMP when comparing male and female OVX-
VEH. However, there was a significant increase in
plasma cGMP in the female OVX-E2 ANP−/− mice com-
pared to male and female OVX-VEH ANP−/− mice. This
shows that in the absence of the ANP signaling, E2
enlists the use of the NOS system, likely eNOS primarily,
to upregulate cGMP. In the instance of the ANP+/+ mice
treatment groups, since the ANP signaling axis remains
intact, both NP and NOS systems are working together to
conserve the downstream levels of cGMP.
The results of this study further support and confirm
the understanding that males and females are inherently
different and as such, must ultimately be considered and
treated differently. As shown, sex dimorphic expression
of specific cardiac gene systems is attributable to the
presence of sex hormones. Our findings indicate that in
normal circumstances, E2 acts on both the NP and NOS
systems to conserve downstream cGMP. However, in the
absence of the ANP signaling axis in the ANP−/− mouse,
E2 primarily activates the cardiac NOS system, which in
turn contributes to the significantly elevated systemic
plasma cGMP. Based on these findings of E2-mediated
activation of the cardiac NOS gene system, it can be
concluded that this particular system is an important con-
tributor to the modulation of the CH response and the
sex-specific cardioprotection observed in women. By ex-
tension, we speculate that this particular system may be a
promising target for the future development of sex-spe-
cific treatments for CVD.
5. Acknowledgements
PGW is a recipient of the R.J. Wilson Graduate Award
and Ontario Graduate Scholarship Award. DWJA is a
recipient of an Ontario Graduate Scholarship Award.
Financial support from the Heart and Stroke Foundation
of Ontario to SCP (Grant #: NA7297) is gratefully
acknowledged. The purchase of the Roche Lightcycler
480II was made possible by a Canada Foundation for
Innovation (CFI) equipment grant to Drs. Amsden, Wald-
man and Pang.
REFERENCES
[1] A. S. Go, D. Mozaffarian, V. L. Roger, E. J. Benjamin, J.
D. Berry, W. B. Borden, D. M. Bravata, S. Dai, E. S.
Ford, C. S. Fox, S. Franco, H. J. Fullerton, C. Gillespie, S.
M. Hailpern, J. A. Heit, V. J. Howard, M. D. Huffman, B.
M. Kissela, S. J. Kittner, D. T. Lackland, J. H. Lichtman,
L. D. Lisabeth, D. Magid, G. M. Marcus, A. Marelli, D. B.
Matchar, D. K. McGuire, E. R. Mohler, C. S. Moy, M. E.
Mussolino, G. Nichol, N. P. Paynter, P. J. Schreiner, P. D.
Sorlie, J. Stein, T. N. Turan, S. S. Virani, N. D. Wong, D.
Woo, M. B. Turner, on Behalf of the American Heart
Association Statistics Committee and Stroke Statistics
Subcommittee, “Executive Summary: Heart Disease and
Stroke Statistics: 2013 Update: A Report from the Ame-
rican Heart Association,” Circulation, Vol. 127, No. 1,
2013, pp. 143-152. doi:10.1161/CIR.0b013e318282ab8f
[2] J. Johannes and C. N. Bairey Merz, “Is Cardiovascular
Disease in Women Inevitable?” Cardiology in Review,
Vol. 19, No. 2, 2011, pp. 76-80.
doi:10.1097/CRD.0b013e318209a711
[3] W. S. Post, M. G. Larson, and D. Levy, “Impact of Left
Ventricular Structure on the Incidence of Hypertension.
The Framingham Heart Study,” Circulation, Vol. 90, No.

P. G. WONG ET AL.
10
1, 1994, pp. 179-185. doi:10.1161/01.CIR.90.1.179
[4] N. Frey and E. N. Olson, “Cardiac Hypertrophy: The
Good, the Bad, and the Ugly,” Annual Review of Physi-
ology, Vol. 65, No. 1, 2003, pp. 45-79.
doi:10.1146/annurev.physiol.65.092101.142243
[5] R. Feil, S. M. Lohmann, H. de Jonge, U. Walter and F.
Hofmann, “Cyclic GMP-Dependent Protein Kinases and
the Cardiovascular System: Insights from Genetically
Modified Mice,” Circulation Research, Vol. 93, No. 10,
2003, pp. 907-916.
doi:10.1161/01.RES.0000100390.68771.CC
[6] T. Nishikimi, N. Maeda and H. Matsuoka, “The Role of
Natriuretic Peptides in Cardioprotection,” Cardiovascular
Research, Vol. 69, No. 2, 2006, pp. 318-328.
doi:10.1016/j.cardiores.2005.10.001
[7] J. Hammond and J.-L. Balligand, “Nitric Oxide Synthase
and Cyclic GMP Signaling in Cardiac Myocytes: From
Contractility to Remodeling,” Journal of Molecular and
Cellular Cardiology, Vol. 52, No. 2, 2012, pp. 330-340.
doi:10.1016/j.yjmcc.2011.07.029
[8] P. G. Wong, D. W. J. Armstrong, M. Y. Tse, E. P. A.
Brander and S. C. Pang, “Sex-Specific Differences in Na-
triuretic Peptide and Nitric Oxide Synthase Expression in
ANP Gene-Disrupted Mice,” Molecular and Cellular Bio-
chemistry, Vol. 374, No. 1, 2012, pp. 125-135.
doi:10.1007/s11010-012-1511-8
[9] E. Barrett-Connor and D. Grady, “Hormone Replacement
Therapy, Heart Disease, and Other Considerations,” An-
nual Review of Public Health, Vol. 19, 1998, pp. 55-72.
doi:10.1146/annurev.publhealth.19.1.55
[10] E. Angelis, M. Y. Tse and S. C. Pang, “Interactions be-
tween Atrial Natriuretic Peptide and the Renin-Angio-
tensin System during Salt-Sensitivity Exhibited by the
proANp Gene-Disrupted Mouse,” Molecular and Cellu-
lar Biochemistry, Vol. 276, No. 1, 2005, pp. 121-131.
doi:10.1007/s11010-005-3672-1
[11] S. J. Sangaralingham, M. Y. Tse and S. C. Pang, “Estro-
gen Delays the Progression of Salt-Induced Cardiac Hy-
pertrophy by Influencing the Renin-Angiotensin System
in Heterozygous proANP Gene-Disrupted Mice,” Mo-
lecular and Cellular Biochemistry, Vol. 306, No. 1, 2007,
pp. 221-230. doi:10.1007/s11010-007-9573-8
[12] S. J. Sangaralingham, M. Y. Tse and S. C. Pang, “Estro-
gen Protects against the Development of Salt-Induced
Cardiac Hypertrophy in Heterozygous proANP Gene-
Disrupted Mice,” Journal of Endocrinology, Vol. 194, No.
1, 2007, pp. 143-152. doi:10.1677/JOE-07-0130
[13] L. A. Leinwand, “Sex Is a Potent Modifier of the Cardio-
vascular System,” Journal of Clinical Investigation, Vol.
112, No. 3, 2003, pp. 302-307. doi:10.1172/JCI19429
[14] C. Vassalle, T. Simoncini, P. Chedraui and F. R. Pérez-
López, “Why Sex Matters: The Biological Mechanisms of
Cardiovascular Disease,” Gynecological Endocrinology,
Vol. 28, No. 9, 2012, pp. 746-751.
doi:10.3109/09513590.2011.652720
[15] G. M. C. Rosano, C. Vitale, G. Marazzi and M. Volter-
rani, “Menopause and Cardiovascular Disease: The Evi-
dence,” Climacteric, Vol. 10, No. 1, 2007, pp. 19-24.
doi:10.1080/13697130601114917
[16] W. B. Kannel, M. C. Hjortland, P. M. McNamara and T.
Gordon, “Menopause and Risk of Cardiovascular Disease:
The Framingham Study,” Annals of Internal Medicine,
Vol. 85, No. 4, 1976, pp. 447-452.
doi:10.7326/0003-4819-85-4-447
[17] S. R. Salpeter, J. M. E. Walsh, T. M. Ormiston, E. Grey-
ber, N. S. Buckley and E. E. Salpeter, “Meta-Analysis:
Effect of Hormone-Replacement Therapy on Components
of the Metabolic Syndrome in Postmenopausal Women,”
Diabetes Obesity & Metabolism, Vol. 8, No. 5, 2006, pp.
538-554. doi:10.1111/j.1463-1326.2005.00545.x
[18] J. Heineke and J. D. Molkentin, “Regulation of Cardiac
Hypertrophy by Intracellular Signalling Pathways,” Na-
ture Reviews Molecular Cell Biology, Vol. 7, No. 8, 2006,
pp. 589-600. doi:10.1038/nrm1983
[19] M. Skavdahl, C. Steenbergen, J. Clark, P. Myers, T. De-
mianenko, L. Mao, H. A. Rockman, K. S. Korach and E.
Murphy, “Estrogen Receptor-β Mediates Male-Female
Differences in the Development of Pressure Overload Hy-
pertrophy,” American Journal of Physiology: Heart and
Circulatory Physiology, Vol. 288, No. 2, 2004, pp. H469-
H476. doi:10.1152/ajpheart.00723.2004
[20] F. A. Babiker, D. Lips, R. Meyer, E. Delvaux, P. Zand-
berg, B. Janssen, G. van Eys, C. Grohé and P. A. Do-
evendans, “Estrogen Receptor β Protects the Murine
Heart Against Left Ventricular Hypertrophy,” Arterio-
sclerosis Thrombosis and Vascular Biology, Vol. 26, No.
7, 2006, pp. 1524-1530.
doi:10.1161/01.ATV.0000223344.11128.23
[21] A. Pedram, M. Razandi, M. Aitkenhead and E. R. Levin,
“Estrogen Inhibits Cardiomyocyte Hypertrophy in Vitro:
Antagonism of Calcineurin-Related Hypertrophy through
Induction of MCIP1,” Journal of Biological Chemistry,
Vol. 280, No. 28, 2005, pp. 26339-26348.
doi:10.1074/jbc.M414409200
[22] A. Pedram, M. Razandi, D. Lubahn, J. Liu, M. Vannan
and E. R. Levin, “Estrogen Inhibits Cardiac Hypertrophy:
Role of Estrogen Receptor-β to Inhibit Calcineurin,” En-
docrinology, Vol. 149, No. 7, 2008, pp. 3361-3369.
doi:10.1210/en.2008-0133
[23] M. van Eickels, C. Grohé, J. P. M. Cleutjens, B. J. Jans-
sen, H. J. J. Wellens and P. A. Doevendans, “17β-Estra-
diol Attenuates the Development of Pressure-Overload
Hypertrophy,” Circulation, Vol. 104, No. 12, 2001, pp.
1419-1423. doi:10.1161/hc3601.095577
[24] M. Jankowski, G. Rachelska, W. Donghao, S. M. Mc-
Cann and J. Gutkowska, “Estrogen Receptors Activate
Atrial Natriuretic Peptide in the Rat Heart,” Proceedings
of the National Academy of Sciences USA, Vol. 98, No.
20, 2001, pp. 11765-11770. doi:10.1073/pnas.201394198
[25] S. Nuedling, S. Kahlert, K. Loebbert, P. A. Doevendans,
R. Meyer, H. Vetter and C. Grohé, “17 Beta-Estradiol
Stimulates Expression of Endothelial and Inducible NO
Synthase in Rat Myocardium In-Vitro and In-Vivo,” Car-
diovascular Research, Vol. 43, No. 3, 1999, pp. 666-674.
doi:10.1016/S0008-6363(99)00093-0
[26] M. S. Bhuiyan, N. Shioda and K. Fukunaga, “Ovariec-
tomy Augments Pressure Overload-Induced Hypertrophy
Associated with Changes in Akt and Nitric Oxide Syn-

P. G. WONG ET AL.
11
thase Signaling Pathways in Female Rats,” American
Journal of Physiology: Endocrinology and Metabolism,
Vol. 293, No. 6, 2007, pp. E1606-E1614.
doi:10.1152/ajpendo.00246.2007
[27] X. Loyer, T. Damy, Z. Chvojkova, E. Robidel, F. Marotte,
P. Oliviero, C. Heymes and J. L. Samuel, “17β-Estradiol
Regulates Constitutive Nitric Oxide Synthase Expression
Differentially in the Myocardium in Response to Pressure
Overload,” Endocrinology, Vol. 148, No. 10, 2007, pp.
4579-4584. doi:10.1210/en.2007-0228
[28] R. D. Patten, I. Pourati, M. J. Aronovitz, A. Alsheikh-Ali,
S. Eder, T. Force, M. E. Mendelsohn and R. H. Karas,
“17 Beta-Estradiol Differentially Affects Left Ventricular
and Cardiomyocyte Hypertrophy Following Myocardial
Infarction and Pressure Overload,” Journal of Cardiac
Failure, Vol. 14, No. 3, 2008, pp. 245-253.
doi:10.1016/j.cardfail.2007.10.024
[29] H. Witt, C. Schubert, J. Jaekel, D. Fliegner, A. Penkalla,
K. Tiemann, J. Stypmann, S. Roepcke, S. Brokat, S. Mah-
moodzadeh, E. Brozova, M. M. Davidson, P. Ruiz Nop-
pinger, C. Grohé and V. Regitz-Zagrosek, “Sex-Specific
Pathways in Early Cardiac Response to Pressure Over-
load in Mice,” Journal of Molecular Medicine, Vol. 86,
No. 9, 2008, pp. 1013-1024.
doi:10.1007/s00109-008-0385-4
[30] X.-M. Li, Y.-T. Ma, Y.-N. Yang, F. Liu, B.-D. Chen, W.
Han, J.-F. Zhang and X.-M. Gao, “Downregulation of
Survival Signalling Pathways and Increased Apoptosis in
the Transition of Pressure Overload-Induced Cardiac Hy-
pertrophy to Heart Failure,” Clinical and Experimental
Pharmacology and Physiology, Vol. 36, No. 11, 2009, pp.
1054-1061. doi:10.1111/j.1440-1681.2009.05243.x
[31] T. D. O’Connell, S. Ishizaka, A. Nakamura, P. M. Swi-
gart, M. C. Rodrigo, G. L. Simpson, S. Cotecchia, D. G.
Rokosh, W. Grossman, E. Foster and P. C. Simpson,
“The α1A/C- and α1B-Adrenergic Receptors Are Re-
quired for Physiological Cardiac Hypertrophy in the
Double-Knockout Mouse,” Journal of Clinical Investiga-
tion, Vol. 111, No. 11, 2003, pp. 1783-1791.
doi:10.1172/JCI16100
[32] F. S. Gragasin, Y. Xu, I. A. Arenas, N. Kainth and S. T.
Davidge, “Estrogen Reduces Angiotensin II-Induced Ni-
tric Oxide Synthase and NAD(P)H Oxidase Expression in
Endothelial Cells,” Arteriosclerosis Thrombosis and Vas-
cular Biology, Vol. 23, No. 1, 2002, pp. 38-44.
doi:10.1161/01.ATV.0000047868.93732.B7
[33] J. D. Molkentin, J. R. Lu, C. L. Antos, B. Markham, J.
Richardson, J. Robbins, S. R. Grant and E. N. Olson,
“Acalcineurin-Ependent Transcriptional Pathway for Car-
diac Hypertrophy,” Cell, Vol. 93, No. 2, 1998, pp. 215-
228. doi:10.1016/S0092-8674(00)81573-1
[34] R. Passier, H. Zeng, N. Frey, F. J. Naya, R. L. Nicol, T. A.
McKinsey, P. Overbeek, J. A. Richardson, S. R. Grant
and E. N. Olson, “CaM kinas Signaling Induces Cardiac
Hypertrophy and Activates the MEF2 Transcription Fac-
tor in Vivo,” Journal of Clinical Investigation, Vol. 105,
No. 10, 2000, pp. 1395-1406. doi:10.1172/JCI8551
[35] S. D. Rybalkin, C. Yan, K. E. Bornfeldt and J. A. Beavo,
“Cyclic GMP Phosphodiesterases and Regulation of Smooth
Muscle Function,” Circulation Research, Vol. 93, No. 4,
2003, pp. 280-291.
doi:10.1161/01.RES.0000087541.15600.2B