American Journal of Plant Sciences, 2010, 1, 69-76
doi:10.4236/ajps.2010.12009 Published Online September 2010 (http://www.SciRP.org/journal/ajps)
69
Differential Expression of microRNAs in Maize
Inbred and Hybrid Lines during Salt and Drought
Stress
Yeqin M. Kong1*, Axel A. Elling1,2*, Beibei Chen1, Xing Wang Deng1
1Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT, USA; 2Current affiliation: De-
partment of Plant Pathology, Washington State University, Pullman, WA, USA.
Received August 14th, 2010; revised November 7th, 2010; accepted November 23rd, 2010.
ABSTRACT
Here, we analyzed whether the microRNA (miRNA) expression levels differ between maize inbred lines B73 and Mo17
and their reciprocal hybrids under salt and drought stress. We found that miR156, miR164, miR166, miR168, miR171
and miR319 are differentially expressed under abiotic stress. Interestingly, Mo17 × B73 showed the strongest change in
miRNA expression in response to sa lt or drought stress, and was also the most resilient line when under abiotic stress in
terms of water loss. In summary, our findings open the possibility that differential miRNA expression levels might be
involved in heightened stress tolerance in ma ize hybrids.
Keywords: microRNA, Maize, Hybrid, Inbred, Salt Stress, Drough
1. Introduction
MicroRNAs (miRNAs) are non-coding RNAs appro-
ximately 20-24 nucleotides in length that act as negative
post-transcriptional regulators [1,2]. In plants, single-
stranded primary miRNAs are transcribed from miRNA
loci and are processed by Dicer-like 1 (DCL1) to yield
mature single-stranded miRNAs, which are loaded into
the RNA-induced silencing complex (RISC). miRNA-
loaded RISC targets cognate transcripts and induces their
cleavage [3].
To date, about 1000 miRNAs have been identified in
various plant species, with 20 miRNA families that are
well conserved between dicots and monocots [4]. As one
of the world’s most important crop species, significant
progress has been made in characterizing and analyzing
miRNAs in the maize (Zea mays) genome [5,6]. While a
significant proportion of known miRNA target genes
regulates plant development [1,7,8], recent studies have
shown that miRNAs are also involved in abiotic and bi-
otic stress responses [2,9]. Abiotic stress, in particular
drought and salt stress, is a significant yield-limiting
factor for agriculture in many regions of the world. Thus,
understanding plant responses to abiotic stress is vital for
improving crop productivity. It is well documented that
the F1 hybrid progeny of inbred parental lines shows
superior performance and stress tolerance compared to
either parent [10-12]. This effect is called heterosis and is
widely exploited in plant breeding. In the present study,
we determined whether seedlings of maize inbred lines
B73 and Mo17 and their reciprocal F1 hybrids show dif-
ferential miRNA expression patterns in response to salt
and drought stress and whether heightened stress toler-
ance in F1 hybrids correlates with changes in miRNA
abundance.
2. Materials and Methods
2.1. Plant Material and Stress Treatment
Seeds of maize (Zea mays) inbred lines B73 and Mo17,
and their reciprocal hybrids B73 × Mo17 and Mo17 ×
B73 were individually planted in pots containing a 3:2
soil:vermiculite mixture. Plants were grown under con-
trolled environmental conditions (15 h light/25℃, 9 h
dark/20℃) in a growth room, and watered with 0.7 mM
Ca(NO3)2 for 13 days. Salt or drought stress treatments
began at the onset of day 14 by either watering with 200
mM NaCl, or by carefully removing plants from potted
soil and dehydrating them on filter paper following previ-
ously described methods [13]. Control plants continued to
grow in pots watered with 0.7 mM Ca(NO3)2. Stress
*These authors contributed equally to this work.

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
70
treatment lasted for 24 h, after which all stress- treated and
control seedlings were harvested, separated into shoots
and roots and stored at –80℃. Each treatment was set up
in three replicates with five to seven seedlings per geno-
type each.
Water content of 14-day-old shoot tissues was assayed
by measuring fresh and dry weight of shoots of salt-
treated, drought-treated, and control seedlings at 0, 2, 12,
and 24 h after onset of treatment following previously
described methods [14].
2.2. RNA Isolation and Northern Blot Analysis of
miRNA Expression
Total RNA was extracted using TRIzol reagent (Invitro-
gen). Northern blot analysis of miRNA was performed as
described [15]. Briefly, 20 μg of total RNA was loaded
per lane and resolved on a denaturing 12% polyacryla-
mide gel, electrophoretically transferred to Hybond-N+
membranes (GE Healthcare) and UV cross-linked. We
selected one miRNA each of 20 miRNA families that
were known in maize at the time of this study (miR156,
miR159, miR160, miR162, miR164, miR166, miR167,
miR168, miR169, miR171, miR172, miR319, miR390,
miR393, miR394, miR396, miR397, miR398, miR399,
miR408. Membranes were hybridized with DNA oli-
gonucleotide probes end-labeled with γ-32P-ATP, which
were comple- mentary to the mature miRNA sequences.
Membranes were exposed on BioMax MR film (Kodak)
for 18 h, which were scanned to quantify miRNA abun-
dance using ImageJ [16]. tRNA was used for normaliza-
tion. Only those six miRNAs that showed a change in
expression level of 25% or more in at least one compari-
son between different genotypes and treatments were
included in our subsequent analyses and are shown;
miR172 was included as a representative example of a
miRNA that was not responsive to the stress treatment in
this study (Tab le 1). Due to the technique chosen, calcu-
lating statistically significant differences for miRNAs
was not possible here.
2.3. Real-Time Quantitative PCR Analysis of
miRNA Target Gene Expression
Aliquots of TRIzol-purified total RNA used for northern
blots were reverse transcribed using RETROscript kit
(Ambion). After DNase treatment, miRNA target gene
expression was determined by quantitative real-time PCR
on an ABI 7900HT real-time PCR system (Applied Bio-
systems) using Quantitect SYBR Green PCR kit (Qiagen).
To ensure quantification of only 3’ cleavage products of
microRNA target genes, primers for target genes were
designed such that they either span the miRNA cleavage
site or are downstream from it [17]. 18S rRNA served as
reference gene. Quantification of gene expression was
performed by 2-CT method [18]. All reactions were per-
formed in duplicates for three biological replicates. The
results are shown by their mean ± standard deviation
(S.D). Fisher’s exact test was used to test for statistical
significance in the statistical software package R. We
used the mRNA medium expression values of three bio-
logical replicates for control and treated tissue and used
the non-treated control tissue to determine the standard
expression value. The two-dimensional contingency ma-
trix consisted of conditional expression values and stan-
dard expression values. Using 0.05 as significance level
(FDR = 0.01), all testing pairs with a p-value less than
0.05 were considered significant (only statistically sig-
nificant comparisons within the same treatment group are
marked with an asterisk).
Table 1. Probes and forw ard and reverse primers used in northern blots and qrt-pcr.
miRNA Probe Target Gene Primer
miR156 TGTGCTCTCTCTCTTCTGTCA SPL5 TGATGAACTGATGCGGTGTCAGGAG
TTAATGCATCGCGAGCAAAGTCCAC
miR164 TGCACGTGCCCTGCTTCTCCA NAC1 TCGTGGACCTCAGCTACGACGACAT
GGAGACGCGAAGAGCGAGGAGTAGA
miR166 GGGGAATGAAGCCTGGTCCGA RLD1 ACCAAGCTGTAGCGTGGAAGGTGCT
TGCATGCAACATATGCCTTTTGTCA
miR168 GTCCCGATCTGCACCAAGCGA AGO1 TTGCTCCCATCTGCTACGCACATCT
CACGGCTCAGCAAAAGAACATCGAG
miR171 GATATTGGCACGGCTCAATCA SCL1 CAGTCAGCTTGTGCTTCTGCGAGGT
CACTAACGCGGATGCTGCCAGTAAG
miR172 ATGCAGCATCATCAAGATTCC GL15 AAGTGACGCGTCCTCTGTGCTTCTG
TAGCTCTGGGCATCGAAGTTGGTCA
miR319 GGGAGCACCCTTCAGTCCAA TCP1 AGGGCAGGAGCTGATTGCACATTCT
TCTGACAAGTCGTCACCGCAACAAA

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
71
3. Results
3.1. Effect of Salt and Drought Stress on Water
Content of Maize Seedlings is Different
between Parental Inbred and F1 Hybrid
Lines
The response of 14-d-old maize seedlings toward salt and
drought stress was determined by assaying the water
content of leaves of stress-treated and control seedlings.
In comparison to control plants, both salt and drought
treatments elicited a decrease in water content (Figure 1).
We found that while the water content of drought-
stressed plants continued to decrease over time, the water
content of salt-stressed plants increased after reaching a
minimum at 12 h. Furthermore, we observed a differential
response to salt and drought stress when parental inbred
lines B73 and Mo17 and their reciprocal hybrids B73 ×
Mo17 and Mo17 × B73 were compared.
Under both salt and drought stress, the hybrid lines
lost less water across all surveyed time points than their
inbred parental lines (Figure 1). Taken together, these
observations suggest that the chosen treatment regimen
elicited a significant stress response in both inbred and
hybrid lines and that the hybrid lines were more resilient
to salt and drought stress than their parental inbred lines.
3.2. miRNAs are Differentially Expressed in
Parental and Hybrid Lines in Response
to Abiotic Stress
To determine whether abiotic stress elicits differential
expression levels of miRNAs between inbred and hybrid
lines, we conducted northern blot analyses (Figure 2A).
We calculated the fold change for each miRNA in re-
sponse to salt or drought stress relative to non-stressed
control plants (Figure 2B) and included only those
miRNAs in our subsequent analyses that showed a
change of at least 25% in one or more comparisons (see
Materials and Methods). We found that the miRNAs
surveyed can be either up- or downregulated in response
to salt or drought stress and that they showed the same
qualitative change in response to either abiotic stress.
The only exception was miR319, which was not respon-
sive to salt stress in Mo17 × B73 but was slightly
upregulated under drought. We found that miR156 and
miR166 displayed the strongest response to abiotic stress
in the inbred lines. Interestingly, miR156 only changed
expression in response to drought in B73, whereas
miR166 showed a 1.4-fold expression change in response
to both abiotic stresses in B73.
We detected distinct differences in the expression level
of miRNAs between inbred and hybrid lines. For exam-
ple, salt or drought stress induced only a modest upregu-
lation of miR156 and miR166 in B73 and Mo17, but led
Figure 1. Water content of maize inbred (B73, Mo17) and
hybrid lines (B73 × Mo17, B × M and Mo17 × B73, M × B)
at distinct time points in hours (h) after onset of salt or
drought stress and in non-stressed c o ntr ol plants.
to an almost 2.5-fold upregulation for miR156 and a
1.8-fold upregulation for miR166 under both salt and
drought stress in the Mo17 × B73 hybrid, which is out-
side of the parental range (Figure 3). Interestingly, Mo17
× B73 not only showed the strongest change in miRNA
expression in response to salt or drought stress, but was
also the most resilient line when under abiotic stress in

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
72
terms of water loss (Figure 1). In contrast, the reciprocal
hybrid B73 × Mo17 showed a modest increase that was
close to the range found in the parental inbred lines. Even
though miR164, miR171 and miR319 showed differen-
tial expression in the absence of abiotic stress (Figures
2(a), (b)), they only displayed modest differences be-
tween inbred and hybrid lines in the presence of salt or
drought stress (Figure 3). Interestingly, abiotic stress
induced downregulation of miR171 and miR319 in Mo17
and B73 × Mo17 when compared to B73 and Mo17 ×
B73, which might indicate parental effects. The other 14
miRNAs we examined were not responsive to salt or
drought stress or showed no differential stress response
between inbred parents and hybrid offspring.
Taken together, our results show that miRNAs in
maize respond differentially to abiotic stress depending
on whether they reside in an inbred or hybrid genome.
3.3. Expression Pattern of miRNA Target Genes
To determine the expression level of miRNA target
genes in maize, one bona fide target of each miRNA was
selected based on previously validated target genes in
maize or homology to validated targets in other plant
species. Previous studies confirmed that homologous
genes are targeted by the respective miRNAs in other
plant species such as Arabidop sis, including the squamosa
promoter binding protein-like transcription factor SPL4
(homologue of maize SPL5) for miR156 [19], NAM/
ATAF/CUC (NAC) domain-encoding gene NAC1 for
miR164 [20], the PHABULOSA gene (homologue of
maize rolled leaf1) for miR166 [21], ARGONAUTE 1
(AGO1) gene for miR168 [22], Scarecrow-like transcrip-
tion factor 1 (SCL1) for miR171 [23], the APETALA2-
like gene glossy15 (GL15) for miR172 [24], and the TCP
(TEOSINTE BRANCHED/CYCLOIDEA/PCF) transcrip-
tion factor 1 (TCP1) for miR319 [25].
As with miRNA accumulation, we determined the fold
change of the target genes in each line of stress-treated
plants relative to controls (Figure 3). Apart from a few
exceptions, we found that the expression changes of most
target genes were statistically significant when compared
to controls. Furthermore, we observed that most differ-
ences in expression levels between inbred and hybrid
lines under stress conditions were statistically significant,
as were a large number of comparisons among hybrid
lines (Figure 3). Some genes showed a more dramatic
response to abiotic stress than the miRNA targeting them.
For example, NAC1 was upregulated over five fold,
(a) (b)
Figure 2. Northern blots for miRNAs in response to salt and drought stress and non-stressed control plants in maize inbreds
B73, Mo17 and hybrids B73 × Mo17 (B × M), Mo17 × B73 (M × B). (b) Relative miRNA expression level in non-stressed con-
trol plants calculated from northern blot assays (a). miR172 is shown as an example for a miRNA that did not show a differ-
ential response to stress treatment.

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
73
Figure 3. miRNA expression change determined by northern blots (left panel) and miRNA target gene expression changes
determined by qRT-PCR (right two panels) in response to salt and drought stress relative to non-stressed control plants in
maize inbreds B73, Mo17 and hybrids B73 × Mo17 (B × M), Mo17 × B73 (M × B). p < 0.05 was considered significant and is
indicated by an asterisk. miR172 is shown as an example of a miRNA that did not respond differentially to stress.

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
74
whereas its cognate miR164 showed only modest
changes (Figure 3). In general, all miRNA-target gene
pairs studied showed opposite expression patterns in re-
sponse to abiotic stress, confirming the role of miRNAs
as negative regulators. However, miR172, which showed
no significant differential expression across inbred and
hybrid lines in the absence or presence of stress (Figure
2), displayed a remarkable contrast to its target gene,
GL15, which was strongly downregulated in response to
drought, but not salt (Figure 3).
Taken together, the target gene expression patterns we
observed in maize inbred and hybrid lines in response to
abiotic stress corroborate our finding that stress-respon-
sive miRNAs show differential expression in inbred and
hybrid lines.
4. Discussion
In addition to being key regulators in several develop-
mental pathways in plants, there is increasing evidence
that miRNAs are implicated in other mechanisms such as
plant adaptive response to stress or environmental
changes [9]. Besides specific miRNAs whose target
genes are involved directly in stress responses, such as
miR398, which targets Cu/Zn superoxide dismutases
important for oxidative stress tolerance [26], the expres-
sion of many highly conserved plant miRNAs has been
found to be responsive to various abiotic stresses such as
dehydration and ABA treatments in Arabidopsis [27],
cold stress in poplar [17], salt and drought stress in rice
[28,29], and salt stress in maize roots [30].
Here, we provide evidence that miRNAs show a dif-
ferential expression pattern in more stress-tolerant maize
hybrids compared to less stress-tolerant inbred lines.
Apart from miR168, which targets AGO1, the core
component of RISC [31], all other miRNAs surveyed
have highly conserved roles in important overlapping
plant developmental processes: miR156 [19], miR166
[20], and miR171 [23] are involved in leaf and shoot
development, miR172 in flower development [32], and
miR164 [21] and miR319 [25] in hormone signaling. It is
well-documented that abiotic stress elicits large-scale
transcriptome responses in maize of early acting genes
involved in the immediate sensing and responding to
stress, and of genes that produce long lasting effects by
targeting growth and developmental processes [33].
miRNAs and their regulation of plant development are an
important component of stress responses, because plants
not only have to respond to stress to survive, but also
undergo developmental reprogramming for continued
productivity [30,34].
miRNAs are generally considered as negative post-
transcriptional regulators of gene expression [1,2]. Our
findings corroborate this hypothesis, showing that direc-
tions of stress-induced change in specific miRNA accu-
mulation and target gene expression were opposite of
each other (Figure 3). The only exception among the
miRNAs studied here was miR168, which targets AGO1.
The expression level of miR168 and AGO1 showed a
parallel, and not an opposite pattern (Figure 3). This can
be explained by a previously described transcriptional/
translational feedback loop between miR168 and AGO1
expression [31], in which MIR168 and AGO1 are
co-regulated on a transcriptional level, and AGO1 aids in
posttranscriptional stabilization of miR168.
In addition, GL15, the target gene of miR172, dis-
played a uniform decrease in response to abiotic stress,
while miR172 was non-responsive to either salt or
drought stress. Prior studies have shown that miR172
acts at the translational level to suppress GL15 protein
production, instead of causing the cleavage of its mRNA
[32]. Therefore, the accumulation of miR172 and mRNA
of GL15, which is the maize homolog of APETALA2,
have no correlation with each other (Figure 3).
Even though our results largely confirm the findings of
recent studies aimed at characterizing the response of
miRNAs and their target genes to salt and drought stress
[28,30,35], our findings show that miRNA response to
abiotic stresses can differ dramatically between plant
species and inbred parental and their hybrid offspring
lines. For example, whereas miRNA156 has been shown
to be strongly downregulated upon drought and salt
stress in rice [28], Ding et al. [30] reported less dramatic
changes in response to salt in maize inbred lines NC286
and Huangzao4. We found that miR156 shows relatively
small changes in response to salt stress in the inbred lines
B73 and Mo17, but is dramatically upregulated in their
reciprocal hybrids (Figure 3). Furthermore, whereas
miR171 was downregulated under salt and drought stress
in rice [28], it was upregulated under similar conditions
in Arabidopsis [35]. Here, we observed that both miR171
and its target gene SCL1 can be either up- or downregu-
lated under salt and drought stress, depending on the
maize line used. These examples illustrate that the re-
sponses of individual miRNAs and their target genes to
stress cannot only differ among plant species, but also
between different genetic lines of the same species.
In summary, we found that miRNAs show differential
responses to abiotic stress in maize inbred and hybrid
lines, which opens the tantalizing possibility that miRNAs
might be involved in the superior performance of hybrid
lines. This would have a significant impact on recent
approaches aimed at using miRNAs to increase crop
yields [36].
5. Acknowledgements
This research was supported by grants to X. W. D. from

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
75
the National Institutes of Health (GM047850), the Na-
tional Science Foundation Plant Genome Program
(DBI0421675), and the National Science Foundation
2010 program (MCB-0929100). A. A. E. was supported
by a Yale University Brown-Coxe Postdoctoral Fellow-
ship.
REFERENCES
[1] M. W. Jones-Rhoades, D. P. Bartel and B. Bartel, “Mi-
croRNAs and Their regulatory Roles in Plants,” Annual
Review of Plant Biology, Vol. 57, January 2006, pp.
19-53.
[2] D. H. Jeong, M. A. German, L. A. Rymarquis, S. R.
Thatcher and P. J. Green, “Abiotic Stress-Associated
miRNAs: Detection and Functional Analysis,” Methods in
Molecular Bi ology, Vol. 592, January 2009, pp. 203-230.
[3] D. P. Bartel, “MicroRNAs: Genomics, Biogenesis,
Mechanism, and Function,” Cell, Vol. 116, January 2004,
pp. 281-297.
[4] S. Griffiths-Jones, H. K. Saini, S. van Dongen and A. J.
Enright, “miRBase: Tools for microRNA Genomics,”
Nucleic Acids Research, Vol. 36, January 2008, D154-
D158.
[5] E. Mica, L. Gianfranceschi and M. E. Pe, “Characteriza-
tion of Five microRNA Families in Maize,” Journal of
Experimental Botany, Vol. 57, July 2006, pp. 2601-2612.
[6] L. Zhang, J-M. Chia, S. Kumari, J.C. Stein, Z. Liu, et al.,
“A Genome-Wide Characterization of microRNA Genes
in Maize,” PLoS Genetics, Vol. 5, November 2009, e716.
[7] X. Chen, “MicroRNA Biogenesis and Function in Plants,”
FEBS Letters, Vol. 579, August 2005, pp. 5923-5931.
[8] A.C. Mallory and H. Vaucheret, “Functions of microR-
NAs and Related Small RNAs in Plants,” Nature Genet-
ics, Vol. 38, May 2006, S31-S36.
[9] L.I. Shukla, V. Chinnusamy and R. Sunkar, “The Role of
microRNAs and Other Endogenous Small RNAs in Plant
Stress Responses,” Biochimica et Biophysica Acta, Vol.
1779, November 2008, pp. 743-748.
[10] G. H. Shull, “The Composition of a Field of Maize,”
American Breeders Association, Vol. 4, January 1908, pp.
296-301.
[11] K. P. Kollipara, I. N. Saab, R. D. Wych, M. J. Lauer and
G. W. Singletary, “Expression Profiling of Reciprocal
Maize Hybrids Divergent for Cold Germination and Des-
iccation Tolerance,” Plant Physiology, Vol. 129, June
2002, pp. 974-992.
[12] P. Rhode, D. K. Hincha and A. G. Heyer “Heterosis in the
Freezing Tolerance of Crosses between Two Arabidopsis
Thaliana Accessions (Columbia-0 and C24) that Show
Differences in Non-Acclimated and Acclimated Freezing
Tolerance,” Plant Journal, Vol. 38, June 2004, pp. 790-
799.
[13] K. Yamaguchi-Shinozaki and K. Shinozaki, “A Novel
Cis-Acting Element in an Arabidopsis Gene is Involved
in Responsiveness to Drought, Low-Temperature, or
High-Salt stress,” Plant Cell, Vol. 6, February 1994, pp.
251-264.
[14] C. Zhu, D. Schraut, W. Hartung and A. R. Schäffner,
“Differential Responses of Maize MIP Genes to Salt
Stress and ABA,” Journal of Experimental Botany, Vol.
56, November 2005, pp. 2971-2981.
[15] E. Varallyay, J. Burgyan and Z. Havelda, “MicroRNA
Detection by Northern Blotting Using Locked Nucleic
Acid Probes,” Nature Protocol, Vol. 3, January 2008, pp.
190- 196.
[16] M. D. Abramoff, P. J. Magelhaes and S. J. Ram, “Image
Processing with ImageJ,” Biophotonics International, Vol.
11, 2004, pp. 26-42.
[17] S. Lu, Y. H. Sun and V. L. Chiang, “Stress-Responsive
microRNAs in Populus,” Plant Journal, Vol. 55, July
2008, pp. 131-151.
[18] K. J. Livak and T. D. Schmittgen, “Analysis of Relative
Gene Expression Data Using Real-Time Quantitative
PCR and the 2-C
T Method,” Methods, Vol. 25, Decem-
ber 2001, pp. 402-408.
[19] G. Wu and R. S. Poethig, “Temporal Regulation of Shoot
Development in Arabidopsis thaliana by miR156 and Its
Target SPL3,” Development, Vol. 133, August 2006, pp.
3539-3547.
[20] A. C. Mallory, B. J. Reinhart, M. W. Jones-Rhoades, G.
Tang, P. D. Zamore, M. K. Barton and D. P. Bartel, “Mi-
croRNA Control of PHABULOSA in Leaf Development:
Importance of Pairing to the microRNA 5′ Region,”
EMBO Journal, Vol. 23, July 2004, pp. 3356-3364.
[21] H. S. Guo, Q. Xie, J. F. Fei, and N. H. Chua, “MicroRNA
Directs mRNA Cleavage of the Transcription Factor
NAC1 to Downregulate Auxin Signals for Arabidopsis
Lateral Root Development,” Plant Cell, Vol. 17, April
2005, pp. 1376- 1386.
[22] H. Vaucheret, A. C. Mallory and D. P. Bartel, “AGO1
Homeostasis Entails Coexpression of MIR168 and AGO1
and Preferential Stabilization of miR168 by AGO1,” Mo-
lecular Cell, Vol. 22, April 2006, pp. 129-136.
[23] C. Llave, Z. Xie, K. D. Kasschau and J.C. Carrington,
“Cleavage of Scarecrow-Like mRNA Targets Directed by
a Class of Arabidopsis miRNA,” Science, Vol. 297, Sep-
tember 2002, pp. 2053-2056.
[24] N. Lauter, A. Kampani, S. Carlson, M. Goebel and S.
Moose, “MicroRNA172 Down-Regulates Glossy15 to
Promote Vegetative Phase Change in Maize,” Proceedings
of the National Academies of Science USA, Vol. 102,
May 2005, pp. 9412-9417.
[25] C. Schommer, J. F. Palatnik, P. Aggarwal, A. Chételat, P.
Cubas, E.E. Farmer, U. Nath and D. Weigel, “Control of
Jasmonate Biosynthesis and Senescence by miR319 Tar-
gets,” PLoS Biology, Vol. 6, September 2008, p. e230.
[26] R. Sunkar, A. Kapoor and J.K. Zhu, “Posttranscriptional
Induction of Two Cu/Zn Superoxide Dismutase Genes in
Arabidopsis is Mediated by Downregulation of miR398
and Important for Oxidative Stress Tolerance,” Plant Cell,
Vol. 18, July 2006, pp. 2051-2065.

Differential Expression of microRNAs in Maize Inbred and Hybrid Lines during Salt and Drought Stress
76
[27] R. Sunkar and J.K. Zhu, “Novel and Stress-Regulated
microRNAs and Other Small RNAs from Arabidopsis,”
Plant Cell, vol. 16, August 2004, pp. 2001-2019.
[28] R. Sunkar, X, Zhou, Y. Zheng, W. Zhang and J.K. Zhu,
“Identification of Novel and Candidate miRNAs in Rice
by High Throughput Sequencing,” BMC Plant Biology,
Vol. 8, February 2008, 25.
[29] B. Zhao, R. Liang, L. Ge,W. Li, H. Xiao, H. Lin, K. Ruan
and Y. Jin, “Identification of Drought-Induced microR-
NAs in Rice,” Biochemical and Biophysical Research
Communications, Vol. 354, March 2007, pp. 585-590.
[30] D. Ding, L. Zhang, H. Wang, Z. Liu, Z. Zhang and Y.
Zheng, “Differential Expression of miRNAs in Response
to Salt Stress in Maize Roots,” Annals of Botany, Vol.
103, January 2009, pp. 29-38.
[31] H. Vaucheret, “Plant ARGONAUTES,” Trends in Plant
Science, Vol. 13, July 2008, pp. 350-358.
[32] X.M. Chen, “A microRNA as a Translational Repressor
of APETALA2 in Arabidopsis Flower Development,”
Science, Vol. 303, March 2004, pp. 2022-2025.
[33] J. Fernandes, D. J. Morrow,P. Casati and V. Walbot,
“Distinctive Transcriptome Responses to Adverse Envi-
ronmental Conditions in Zea mays L.” Plant Biotech-
nology Journal, Vol. 6, October 2008, pp. 782-798.