Natural Resources, 2010, 1, 95-103
doi:10.4236/nr.2010.12010 Published Online December 2010 (http://www.SciRP.org/journal/nr)
95
Genetic Relationships between Cultivated and
Wild Olive Trees (Olea europaea L. var. europaea
and var. sylvestris) Based on Nuclear and
Chloroplast SSR Markers
Hédia Hannachi1*, Catherine Breton2, Monji Msallem3, Salem Ben El Hadj4, Mohamed El Gazzah1,
André Bervillé2
1Faculté des Sciences de Tunis, Département de Biologie, Campus Universitaire, Tunis, Tunisie; 2INRA, UMR1097, Bât. 33, 2 place
Viala, F-34060 Montpellier cedex 1, France; 3Institut de l’Olivier, Tunis, Tunisia; 4Institut National Agronomique de Tunisie, Tunis,
Mahrajène, Tunisia.
Received October 26th, 2010; revised November 29th, 2010; accepted November 30th, 2010.
ABSTRACT
The olive is widely cropped in Tunisia where also oleaster trees thrive all around orchards and in natural sites. Little is
known on the genetic relationships between the olive crop and oleaster trees in Tunisia. Fifty-two oleaster trees and
fifteen cultivars were sampled from Tunisia. SSR genotyping was performed in polyacrylamide gels after fluorescent
labeling. We used seven nuclear and two chloroplast SSR markers. AFC analyses showed close genetic relationships
between cultivated and oleaster trees. Genetic relationships were also displayed in a dendrogram based on Unweighted
Pair Group Method (UPGMA). Five clusters were defined mixing cultivar and oleaster trees suggesting close relation-
ship between some cultivar and some oleaster trees. One oleaster is single in a cluster. The chlorotype SSR markers
show probably three olive origins. Some cultivars have the CE chlorotype originates from the East of the Mediterra-
nean basin, the CCK haplotype originates from Maghreb and the COM chlorotype originates from West Mediterranean.
The cultivars were 1) introduced from the East; 2) selected in the West; 3) or selected in the North Africa region. The
Tunisian oleaster trees carry eastern and western Mediterranean chlorotype CCK, COM and CE.
Keywords: Cultivars, Oleaster, Genetic Relationship, SSR Markers, Haplotype, Origin
1. Introduction
Two olive (Olea europaea subsp. europaea var. euro-
paea) varieties are distinguished by botanists in the Me-
diterranean basin namely var. europaea which is the cul-
tivated form and var. sylvestris, the wild olive tree or
oleaster.
The olive is one of both of the oldest tree crops with
the fig tree and it is cultivated for oil and table olives.
The olive is the most important oil producing crop in the
Mediterranean region. Olive oil has traditionally been
used for pharmaceutical, industrial and consumer pur-
poses. Tunisia is formerly a major producer of olive oil
in North Africa. In Tunisia, about 60 million olive trees
are cultivated in third of cultivated areas, most of them
represented by two prevalent oil cultivars ‘Chétoui’ and
‘Chemlali’. The rest is represented by several minor cul-
tivars [1].
Little is known about the Tunisia oleaster trees and
about their genetic relationships with cultivars. Genetic
erosion and loss of biodiversity do not seem to be major
issues for olive germplasms due to absence of turnover of
new genotypes that do not occur as fast as in other
woody crops. Moreover, old olive trees survive for a long
time once abandoned [2,3].
Morphological traits in the olive do not enable differ-
entiation between oleasters and cultivars. Although, sev-
eral morphological descriptors show partial differentia-
tion of them [4,5].
Recently, molecular markers have been developed in
the olive [2,6-11] that enable cultivar differentiation and
identification due to their high intra species variability.
The use of nuclear microsatellite markers for genetic
analysis is well established in the olive [7,12-14]. The

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
96
principle has been extended to the chloroplast [15,16]
and mitochondrial genomes [3,17,18]. The utility of mo-
lecular tools for evolutionary studies arises from the in-
sensitivity of the genetic markers to environmental fac-
tors. Several markers based on DNA amplification tech-
nology have been used to look for genetic relationships
between the cultivated olive (cultivars) and the oleaster
trees as to structure its genetic diversity [3,8,15,16], in-
cluding DNA from nucleus, chloroplast (cpDNA) and
mitochondria (mtDNA). Simple Sequence Repeats (SSRs)
lead to multiallelic fragments and are easily amenable to
Polymerase Chain Reaction (PCR) based analysis. Mi-
crosatellite markers explore various independent portions
of the olive genome and they have been identified in
plants’ nuclear and mitochondrial genomes [3,15,19] as
well as in the chloroplast genome where they are mono-
nucleotide [20]. With SSRs, Restriction Fragment Length
Polymorphisms (RFLPs) are complementarily used to
define chloroplast and mitochondrial RFLP data, using
multiple pair wise combinations of probe and restriction
enzyme to recognize distinct genetic patterns, called
chlorotypes or mitotypes. Since the organelles are usu-
ally passed to offspring from the female parents, cyto-
plasm markers (mitochondria and chloroplast) trace ma-
ternal lineage only [21].
Many studies have shown the diversity of cultivars
using morphological descriptors [1,22], but little atten-
tion has been given to the Tunisian oleasters [4,5]. In
Tunisia a few studies have been made on cultivars using
SSRs markers [23].
In the present study, an analysis of polymorphisms
within and among the two olive taxa (cultivar and oleaster
trees) was undertaken using nuclear and cytoplasm SSR
markers. This will enable the determination of genetic
groups or clusters to establish breeding programs that
encompasses the genetic diversity of this species.
2. Materials and Methods
A total of 15 autochthonous Tunisian cultivars and 52
oleasters were sampled in the north of Tunisia (Table 1),
all are presently cropped in wide area. They were subject
to genotyping for chlorotypes previously described and
developed. We used two markers ccmp5 and ccmp7 re-
tained by authors [8,21,22] and seven nuclear microsatel-
lite markers, three ssrOeUA-DCA04, 05, 09 [11]; one
ssrOe-GAPU 101 [25] and three ssrOe-UD012, 017, 024
[9], chosen as used by Breton et al. [14], (Table 2).
2.1. DNA Amplifications
Total DNA preparation was performed using the method
described by Besnard et al. [21]. PCR reaction was per-
formed in 12.5 µl final volume, containing 40 ng ge-
nomic DNA, 0.75 mM MgCl2, 2.5 mM dNTP, 1.25 U
Taq polymerase and 0.19 mM M13-Fam. PCR amplify-
cation was conducted in a thermal cycler Gradient 96
Robocycler (Stratagene, Germany). The amplification
program was 94℃C for 1 min, 52℃ for 1 min, 72℃ for
1 min, followed by 35 cycles at 94℃ for 30 s, at 50℃ for
45 s and at 72℃ for 1 min, with a final elongation cycle
at 72℃ for 4 min.
Amplification products and ladders were labeled using
the tailing method with the Fam fluorochrome. They
were separated into 8% polyacrylamide gels enabling
reading with a Hitachi scanner system associated with
the FMBIO2 software [26].
The method used for chlorotype DNA-RFLP analysis
was described by Besnard et al. [21] and Breton [13].
Two restrictions enzyme/probe combinations (HindIII/
atp6 and XbaI/atp6) were used to identify the chlorotype
CE, COM and CCK previously determined by Besnard
et al. [21].
2.2. Statistical Analysis
Factorial Correspondence Analysis (FCA) was per-
formed using GENETIX. Dendrogram was constructed
with Unweighted Pair Group Method (UPGMA) algorithm
based on Nei’ genetic distances [27] and a neighbour-
joining tree was constructed with the nuclear SSR data
set using PHYLIP Version 3.5c [28].
3. Results
3.1. Factorial Correspondence Analysis
The plot of FCA coordinates for the first and the second
axes, which explain 8.69% and 6.23% of variance, re-
spectively and showed continuity in the distribution of
oleaster and cultivar trees. However, most of cultivars
clustered in the right of the cloud. Thus, we considered
two clusters of genotypes (Figure 1). The cultivars clus-
ter grouped three oleaster trees. In contrast, most oleaster
trees clustered on the left with the cultivar C1 (Sayali).
3.2. Clustering
Olive cultivar and oleaster trees were clustered with the
UPGMA method based on the Nei’s similarity coeffi-
cient using SSR data (Figure 2). The clustering analysis
showed five groups and one single oleaster (O11). Three
clusters (CL1, CL2 and CL3) contain cultivars and
oleaster trees and two other clusters (CL4 and CL5) con-
tain only oleaster trees.
Cluster_1 (CL1) aggregated 11 out of 15 cultivars (C1
Sayali, C6 Marsaline, C10 Meski, C30 Rajou, C29 Limi,
C26 Tounsi, C14 Gerboui, C20 Besbessi, C28 Zarras,
C13 Neb Jmel and C22 Chaïbi) and 12 oleasters from
several locations; six of them sampled from natural eco-

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
97
system (O6, O8, O9, O13, O22, O26) and six from agro-
ecosystem (O3, O32, O34, O35, O40 and O42). Some
cultivars were close to oleasters from natural ecosystem.
The cultivars C1 ‘Sayali’, C13 ‘Neb Jmel’, C14 ‘Ger-
boui’, C22 ‘Chaïbi’, C28 ‘Zarras’ and C29 ‘Limi’, were
close to oleasters from natural ecosystem O6, O22, O8,
O13, O26 and O9, respectively. Whereas, others cultivars
were related to oleasters from agro-ecosystem: the culti-
vars C6 ‘Marsaline’, C10 ‘Meski’, C20 ‘Besbessi’, C26
‘Tounsi’, C30 ‘Rajou’ related to oleasters O3, O32, O40,
O34 and O42, respectively.
Cluster_2 (CL2) aggregated nine oleasters (O61, O57,
O1, O23, O19, O20, O53, O30, and O21) and two culti-
vars (C8 Chemlali and C27 Roumi). Three oleasters
(O61, O19, and O20) were from natural ecosystem and
six from agro-ecosystem. The cultivars C8 ‘Chemlali’
and C27 ‘Roumi’ were close to two oleasters from agro-
ecosystem O1 and O21, respectively.
Table 1. Origins of cultivated (cultivars) and wild (oleasters) olive trees used in the present study.
Code Cultivar/oleaster Location Ecosystem Governorate
C1 Sayali Slouguia Agro-ecosystem Béja
C2 Chétoui Slouguia Agro-ecosystem Béja
C6 Marsaline Slouguia Agro-ecosystem Béja
C8 Chemlali Slouguia Agro-ecosystem Béja
C10 Meski Slouguia Agro-ecosystem Béja
C13 Neb jmel Testour Agro-ecosystem Béja
C14 Gerboui Slouguia Agro-ecosystem Béja
C20 Besbessi Testour Agro-ecosystem Béja
C22 Chaïbi Téboursouk Agro-ecosystem Béja
C26 Tounsi Téboursouk Agro-ecosystem Béja
C27 Roumi Téboursouk Agro-ecosystem Béja
C28 Zarras Téboursouk Agro-ecosystem Béja
C29 Limi Téboursouk Agro-ecosystem Béja
C30 Rajou Ras jbel Agro-ecosystem Bizerte
C31 Nib Ras jbel Agro-ecosystem Bizerte
O1 Oleaster Slouguia Agro-ecosystem Béja
O3 Oleaster Testour Agro-ecosystem Béja
O4 Oleaster Testour Agro-ecosystem Béja
O5 Oleaster Téboursouk Agro-ecosystem Béja
O6 Oleaster Téboursouk Natural ecosystem Béja
O7 Oleaster Ichkeul Natural ecosystem Bizerte
O8 Oleaster Ichkeul Natural ecosystem Bizerte
O9 Oleaster Ichkeul Natural ecosystem Bizerte
O10 Oleaster Ichkeul Natural ecosystem Bizerte
O11 Oleaster Ichkeul Natural ecosystem Bizerte
O12 Oleaster Ichkeul Natural ecosystem Bizerte
O13 Oleaster Ichkeul Natural ecosystem Bizerte
O15 Oleaster Ras Jbel Agro-ecosystem Bizerte
O16 Oleaster Ras Jbel Agro-ecosystem Bizerte
O17 Oleaster Tunis Natural ecosystem Tunis
O18 Oleaster Tunis Natural ecosystem Tunis
O19 Oleaster Tunis Natural ecosystem Tunis
O20 Oleaster Tunis Natural ecosystem Tunis
O21 Oleaster Messaoudi Agro-ecosystem El Kef
O22 Oleaster Midian Natural ecosystem El Kef
O23 Oleaster Bahra Agro-ecosystem El Kef

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
98
Continued Table 1
Code Cultivar/oleaster Location Ecosystem Governorate
O25 Oleaster Ettouiref Natural ecosystem El Kef
O26 Oleaster Ettouiref Natural ecosystem El Kef
O27 Oleaster Jendouba Natural ecosystem Jendouba
O28 Oleaster Fernana Agro-ecosystem Jendouba
O29 Oleaster Jendouba Natural ecosystem Jendouba
O30 Oleaster Tbaba Agro-ecosystem Jendouba
O31 Oleaster Zouaraa Agro-ecosystem Béja
O32 Oleaster Zouaraa Agro-ecosystem Béja
O33 Oleaster Tamra Agro-ecosystem Béja
O34 Oleaster Sejnan Agro-ecosystem Bizerte
O35 Oleaster Sejnan Agro-ecosystem Bizerte
O37 Oleaster Aïn Ghlal Agro-ecosystem Bizerte
O38 Oleaster Jbel Elwesr Natural ecosystem Zaghouan
O39 Oleaster Zaghouan Agro-ecosystem Zaghouan
O40 Oleaster Zriba Agro-ecosystem Zaghouan
O42 Oleaster Jradou Agro-ecosystem Zaghouan
O43 Oleaster Jradou Agro-ecosystem Zaghouan
O44 Oleaster Oued Kenz Natural ecosystem Zaghouan
O45 Oleaster Batria Agro-ecosystem Zaghouan
O46 Oleaster Saouaf Agro-ecosystem Zaghouan
O47 Oleaster Oued Touil Agro-ecosystem Zaghouan
O48 Oleaster Saouaf Agro-ecosystem Zaghouan
O51 Oleaster Mjez El Bab Agro-ecosystem Béja
O52 Oleaster Kélibia Agro-ecosystem Nabeul
O53 Oleaster Kélibia Agro-ecosystem Nabeul
O55 Oleaster Kélibia Agro-ecosystem Nabeul
O56 Oleaster Kélibia Agro-ecosystem Nabeul
O57 Oleaster Kélibia Agro-ecosystem Nabeul
O59 Oleaster Echraf Agro-ecosystem Nabeul
O61 Oleaster Abderrahman Natural ecosystem Nabeul
O64 Oleaster Abderrahman Natural ecosystem Nabeul
Table 2. Characteristics of microsatellites markers used for the genotyping of cultivated and wild olive trees in the present
study.
Locus Repeated motif Directed sequence (5’ – 3’) authors
ssrOeUA-DCA1 (GA)22 CCTCTGAAAATCTACACTCACATCC Sefc et al. [11];
ssrOeUA-DCA5 (GA)15 AACAAAATCCCATACGAACTGCC Sefc et al. [11]
ssrOeUA-DCA9 (GA)23 AATCAAAGTCTTCCTTCTCATTTCG Sefc et al. [11]
GapU101 (GA)8(G)3(AG)3 CATGAAAGGAGGGGGACATA Carriero et al. [25]
Udo012 (GT)10 TCACCATTCTTAACTTCACACCA Cipriani et al. [9],
Udo017 (TG)11 TCACCATTCTTAACTTCACACCA Cipriani et al. [9],
Udo024 (CA)11(TA)2(CA)4 GGATTTATTAAAAGCAAAACATACAAACipriani et al. [9],

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
99
Cultivars
Oleasters
■: olive cultivars; □: Oleaster olive trees
Figure 1. Factorial correspondence analysis on cultivar and oleaster olive trees based on SSR markers.
O11
C1
O6
C6
O3
C10
O32
C30
O42
C29
O9
C26
O34
C14
O8
C20
O40
C28
O26
C13
O22
O35
C22
O13
O61
O57
C8
O1
O23
O19
O20
O53
O30
C27
O21
O59
O28
O29
C2
O37
O33
C31
O46
O31
O51
O48
O12
O44
O56
O45
O10
O15
O16
O25
O17
O27
O4
O38
O55
O64
O43
O18
O47
O5
O39
O7
O52
0.1
C1
C2
C3
C4
C5
O11
Figure 2. Dendogram based on the SSR data of 15 cultivars and 52 oleasters genotypes generated by UPGMA algorithm. C1
– C5 indicate five clusters, O11 is a single oleaster tree; C: olive cultivar and O: olive oleaster.
Cluster_3 (CL3) contains two cultivars (C2 Chétoui
and C31 Nib) and six oleaster trees: O29 from natural
ecosystem and the others (O59, O28, O37, O33, and O46)
from agro-ecosystem. The two cultivars C2 ‘Chétoui’
and C31 ‘Nib’ were close to two oleaster trees from
agro-ecosystem O37 and O46, respectively.
Cluster_4 (CL4) and cluster_5 (CL5) aggregated only
oleaster trees. Cluster_4 contains five oleaster trees from

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
100
natural ecosystem (O12, O44, O10, O25, and O17) and
seven from agro-ecosystem (O31, O51, O48, O56, O45,
O15, and O16). Cluster_5 contains five oleaster trees
from natural-ecosystem (O27, O38, O64, O18, and O7)
and seven oleaster trees from agro-ecosystem (O4, O55,
O43, O47, O5, O39, and O62). However, the oleaster
O11 from natural ecosystem is single and represents a
cluster by itself.
These results showed tight relationships between some
oleaster trees and cultivars independently of locations
and ecosystem.
3.3. Chloroplast SSR
In this study, four chlorotypes CE1, CE2, COM and
CCK previously determined in olives were found in cul-
tivars and defined the olive origins (Table 3). Oleaster
trees from agro-ecosystem and natural sites carry CE1
(6/6), CE2 (0/0), CCK (9/5) and COM (10/7), respect-
tively, and the lattes do not reveal significant differences
for chlorotype frequencies. Whereas, for olive cultivars
six carry CE1, six CE2, one COM and six CCK chloro-
type.
4. Discussion
We used seven nuclear and two cytoplasmic microsatel-
lite markers over 15 cultivars and 52 oleasters that re-
vealed several clusters of cultivars, oleaster trees and
several chlorotypes. The morphological means showed a
continuous variation between cultivated and wild olive
trees [4]. In the present study, molecular markers show
also continuous variation, but most cultivars clustered
together. This genetic structure probably results from the
origin of the cultivars and oleaster trees.
Besnard et al. [18] and Besnard and Bervillé [15] have
shown that the CE1, COM, and CCK chlorotypes are
prevalent in oleaster trees from the East (CE1) and the
West (COM and CCK). In addition, Breton [13] and
Breton et al. [14] have shown that CE2 and COM
(COM1 and COM2 are variant of COM) originated in
Cyprus and Tunisia where they are prevalent in oleaster
trees. Consequently, the deep structure in chlorotypes
infers that cultivars carrying CE1 or CE2 have ancestors
in oleaster or in cultivars from the East. Whereas, culti-
vars carrying COM or CCK have ancestors in oleaster or
Table 3. Chlorotypes of cultivated (cultivars) and wild (oleasters) olive trees based on chloroplast SSR markers. (CE1, CE2:
East Mediterranean chlorotype; COM, COM2: West Mediterranean chlorotype; CCK: Maghreb chlorotype; C and O: cul-
tivars and oleasters codes, respectively, used in UPGMA analysis).
Chlorotype Cultivars
a Oleastersa Oleastersb
CE1
Sayali (C1)
Chemlali (C8)
Gerboui (C14)
Roumi (C27)
Zarras (C28)
Nib (C31)
O32
O37
O45
O48
O56
O57
O6
O9
O18
O22
O44
O64
CE2 Besbessi (C20)
COM Neb jmel (C13)
O31
O43
O59
O7
COM2
O1
O3
O4
O23
O34
O35
O51
O8
O10
O11
O12
O61
O25
CCK
Chétoui (C2)
Marsaline (C6)
Meski (C10)
Chaïbi (C22)
Limi (C29)
Rajou (C30)
O5
O15
O16
O20
O28
O40
O47
O52
O53
O19
O21
O26
O27
O29
a: agro-ecosystem; b: natural ecosystem

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
101
cultivars from the West. Tunisia offers a peculiar situa-
tion due to early colonization by Phoenicians, who have
probably introduced cultivars from the East into Carthage
colony and their further colonies in the West (Spain,
Portugal). We can therefore deduce that oleaster trees
carrying CE1 are feral trees (progenies of a cultivar by an
oleaster or vice versa) either in the agro-ecosystem or
natural sites (Table 3). Gene flow appears responsible
for the diffusion of the CE1 chlorotypes, but also for the
nuclear markers as shown by Breton et al. [14] using
Bayesian methods [29].
From these results, we can deduce that ‘Sayali’ carry-
ing CE1 that clustered with oleaster trees is probably of
feral origin. ‘Chemlali’, carrying also CE1 but aggre-
gated in the FCA intermediate between oleaster trees and
cultivars, has probably similar origin. In the Dendrogram
‘Chemlali’ and ‘Roumi’ are in the same clusters with
some oleaster trees suggesting that ‘Roumi’ could be a
progeny of ‘Chemlali’ with local oleaster trees. ‘Neb
Jmel’ characterized by the West chlorotype COM was
probably selected in the Maghreb region. Oleasters car-
rying western Mediterranean chlorotypes (CCK, COM)
may cluster with cultivars carrying the same chlorotypes
in different clusters. Consequently, the chlorotypes are
not correlated with the clusters (Figure 2).
Indeed, the UPGMA clustering revealed that each
cluster is independent of the chlorotypes which means
that kinship relationships by the chlorotypes have been
hindered by gene flow between cultivars and local
oleaster trees as well as between oleaster trees and culti-
vars. Obviously, we observed events that have occurred
through the female side due to the chlorotypes which is
maternally inherited in the olive [21]. The same events
are likely existing through pollen flow, but too difficult
to detect unless using Bayesian methods. However, in
this study, the sampled trees are too limited to study per
se gene flow events due to the absence of anchor refer-
ences for COM and CCK chlorotypes. We suspect that
the CCK chlorotype originated from Kabylia [7] where a
refuge zone for the olive has been revealed [14], but we
do not know whether it has been the only refuge for CCK
or if other refuge zones in North Africa or Sicily may
have preserved CCK. We also suspected that the COM
chlorotypes (COM, COM1, COM2) originate from Tuni-
sia where they are prevalent in natural sites and that cor-
respond to a refuge zone [13,14], but we cannot exclude
that, CCK chlorotypes, were kept in refuge zones from
Sicily-Corsica. Unfortunately, oleaster trees from central
and south Italy have not been genotyped for the chloro-
types [30].
Mixed stands of oleaster trees of natural sites in Tuni-
sia display a huge diversity based on the chlorotypes and
nuclear polymorphisms in comparison with other oleaster
trees in Mediterranean forests. Oleaster trees transformed
into new cultivars should be carefully examined since
they are the result into crosses not usually done between
genotypes from the East and West of the Mediterranean
regions. Seed gene flow is locally detected when in a
region where cultivars have been introduced and local
oleasters do not carry the same cytoplasm [12,15].
Distinction of a crop from its wild relatives is based on
several morphological traits and botanists have usually
made distinct species of two taxa [31]. For the cultivated
olive trees, it has been traditionally carried out by mor-
phological, agronomic and chemical traits [1,32-35].
Based on the morphology and molecular markers, it is
absolutely impossible to determine whether oleaster trees
from natural sites are genuine oleasters or not. The phy-
logeography of the oleaster and cultivars trees is due to
permanent and recurrent gene flow. Here, we clearly
show that oleaster trees carrying the eastern CE1 chloro-
type are present in natural sites of Tunisia. In the frame
of the hypothesis that CE1 was absent from refuge zones
in the west, it should have been introduced from the East
into the West 2500 years ago. In this work, it appeared
from the dendrogram (Figure 2) that the oleaster and cu-l
tivar trees clustered by similarities whatever their chloro-
types showing tight genetic relationships. The same re-
sults were obtained by Bayesian methods [14].
In Tunisia, many studies have shown the diversity of
the Tunisian cultivated olive trees [22,36] but little atten-
tion has been given to the Tunisian oleaster trees. Little is
known about molecular identification of Tunisian olive.
A close genetic proximity between Tunisian oleasters
and cultivars was showed by dendrogram based on nu-
clear SSR markers (Figure 2). This relationship has al-
ready been shown with isozymes [37,38], RAPD and
RFLP [3,7,14].
Several molecular studies, including AFLPs, RAPDs,
ISSRs, repetitive DNA sequence analysis, chloroplast
and mitochondrial DNA polymorphism, have also con-
tributed to elucidate the classification of the Olea com-
plex and the origin of cultivated olive [2,3,12,15,16,
39-41].
It has been reported that oil composition for oleaster
trees were in agreement with the olive oil norms [4].
Here, we show that those oleasters trees are unique to
Tunisia. Crossing the oleasters suggest that breeding the
olive and could be done in the country where cultivars
may have non-equilibrated oil composition. Indeed, to
improve the oil quality it should cutting olive oil with
others to satisfy European norms. Screening oleaster
trees from the agro-ecosystem and natural sites should
lead to new genotypes that could be compared for oil

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
102
composition and yield as it has been done in Australia by
Mekuria et al. [42] and Sedgley [43].
These trees are adapted to soil and climate found in
Tunisia and therefore they should been screened for their
behaviour in the agro-ecosystem to check the yield and
quality of the product.
5. Conclusions
Cultivars found in Tunisia are of diverse origins based on
their chlorotype and nuclear markers. Local genuine
oleaster trees are difficult to differentiate from feral trees,
and shown to share more or less kinship relationships
with autochtonous and introduced cultivars. Those
oleaster trees should offer opportunity to screen for new
genotypes producing oil with more equilibrated composi-
tion than ‘Chemlali’ as an example and acceptable agro-
nomic behavior to compete with local cultivars to ensure
direct selling of the products to the Europe.
REFERENCES
[1] A. Trigui and M. Msallem, “Oliviers de Tunisie, Catalogue
des Varietes Autochtones & Types Locaux, Identification
Varietale & Caracterisation Morpho-Pomologique des
Ressources Genetiques Oleicoles de Tunisie,” Vol. 1. (Fr)
Ministère de l’Agriculture, IRESA, Institut de l’Olivier,
Tunisia, 2002.
[2] A. Angiliollo, M. Mencuccini and L. Baldoni, “Olive
Genetic Diversity Assessed Using Amplified Fragment
Length Polymorphisms,” Theoretical and Applied Genet-
ics, Vol. 98, No. 3-4, 1999, pp. 411-421.
[3] G. Besnard and A. Bervillé, “Multiple Origins for Medi-
terranean Olive (Olea europaea L. subsp. europaea) Ba-
sed upon Mitochondrial DNA Polymorphisms,” Comptes
Rendus Biologie de l’Académie des Sciences, Vol. 323,
No. 2, 2000, pp. 173-181.
[4] H. Hannachi, C. Breton, M. Msallem, S. Ben El Hadj, M.
El Gazzah and A. Bervillé, “Differences between Native
and Introduced Olive Cultivars as Revealed by Morphol-
ogy of Drupes, Oil Composition and SSR Polymorphisms:
A Case Study in Tunisia,” Scientia Horticultural, Vol.
116, No. 3, 2008, pp. 280-290.
[5] H. Hannachi, C. Breton, M. Msallem, S. Ben El Hadj, M.
El Gazzah and A. Bervillé, “Are Olive Cultivars Distin-
guishable from Oleaster Trees Based on Morphology of
Drupes and Pits, Oil Composition and Microsatellite
Polymorphisms?” Acta Botanica Gallica, Vol. 155, No. 4,
2008, pp. 531-545.
[6] A. Fabbri, J. I. Hormaza and V. S. Polito, “Random Am-
plified Polymorphic DNA Analysis of Olive (Olea eu-
ropaea L.) Cultivars,” The Journal of the American Soci-
ety for Horticultural Science, Vol. 120, No. 3, 1995, pp.
538-542.
[7] G. Besnard, P. Baradat, D. Chevalier, A. Tagmount and A.
Bervillé, “Genetic Differentiation in the Olive Complex
(Olea europaea L.) Revealed by RAPDs and RFLPs in
the rRNA Genes,” Genetic Resources and Crop Evolution,
Vol. 48, No. 2, 2001, pp. 165-182.
[8] V. Bronzini de Caraffa, J. Maury, C. Gambotti, C. Breton,
A. Bervillé and J. Giannettini, “Mitochondrial DNA
Variation from Western an Eastern Mediterranean,”
Theoretical and Applied Genetics, Vol. 104, No. 6-7,
2002, pp. 1209-1216.
[9] G. Cipriani, M. T. Marrazzo, R. Marconi, A. Cimato and
R. Testolin, “Microsatellite Markers Isolated in Olive
(Olea europaea L.) are Suitable for Individual Finger-
Printing and Reveal Polymorphism within Ancient Culti-
vars,” Theoretical and Applied Genetics, Vol. 104, No. 2-
3, 2002, pp. 223-228.
[10] P. Rallo, G. Dorado and A. Martin, “Development of
Simple Sequence Repeats (SSR) in Olive Tree (Olea eu-
ropaea L.),” Theoretical and Applied Genetics, Vol. 101,
No. 5-6, 2000, pp. 984-989.
[11] K. M. Sefc, M. S. Lopes, A. D. Mendoc, M. Rodrigues
Dos Santos, M. L. da C. Machado and A. da C. Machado,
“Identification of Microsatellites Loci in Olive (Olea eu-
ropaea) and Their Characterization in Italian and Iberian
Trees,” Molecular Ecology, Vol. 9, No. 8, 2000, pp.
1171-1173.
[12] C. Breton, G. Besnard and A. Bervillé, “Using Multiple
Types of Molecular Markers to Understand Olive Phy-
logeography,” In: M. A. Zeder, D. Decker-Walters, D.
Bradley, B. Smith, Eds., Documenting Domestication:
New Genetic and Archaeological Paradigms, University
of California Press, California, 2005.
[13] C. Breton, “Reconstruction de l’Histoire De L’Olivier
(Olea europaea subsp. europaea) et de son Processus de
Domestication en Region Mediterraneenne, Etudies sur
des Bases Moleculaires,” Ph.D. Biologie des Populations
et Ecologie, Paul Cézanne France, 2006.
[14] C. Breton, M. Tersac and A. Bervillé, “SSR Genetic Di-
versity in Wild Olive (Oleaster, Olea europaea L.) Sug-
gests Several Plio-Pleistocene Refuge Zones in the Medi-
terranean Basin and Gene Flow with Olive,” Journal of
Biogeography, Vol. 33, No. 11, 2006, pp. 1916-1928.
[15] G. Besnard and A. Bervillé, “On Chloroplast DNA Varia-
tions in the Olive (Olea europaea L.) Complex: Com-
pareson of RFLP and PCR Polymorphisms,” Theoretical
and Applied Genetics, Vol. 104, No. 8, 2002, pp. 1157-
1163.
[16] G. Besnard, B. Khadari, P. Baradat and A. Bervillé, “Olea
europaea (Oleaceae) Phylogeography Based on Chloro-
plast DNA Polymorphism,” Theoretical and Applied Ge-
netics, Vol. 104, No. 8, 2002, pp. 1353-1361.
[17] G. Besnard, P. Baradat, C. Breton, B. Khadari and A.
Bervillé, “Olive Domestication from Structure of Oleas-
ters and Cultivars Using Nuvlear RAPDs and Mitochon-
drial RFLPs,” Genetics Selection Evolution, Vol. 33,
Special Issue, 2001, pp. S251-S268.
[18] G. Besnard, P. Baradat and A. Bervillé, “Genetic Rela-
tionship in the Olive (Ole europaea L.) Reflect Multilocal
Selection of Cultivars,” Theoretical and Applied Genetics,

Genetic Relationships between Cultivated and Wild Olive Trees
(Olea europaea L. var. europaea and var. sylvestris) Based on Nuclear and Chloroplast SSR Markers
103
Vol. 102, No. 2-3, 2001, pp. 251-258.
[19] C. Sperisen, U. Büchler, F. Gugerli, G. Matyas, T. Gebu-
rek and G. G. Vendramin, “Tandem Repeat on Plant Mi-
tochondrial Genomes: Application to the Analysis of
Population Differentiation in the Conofer Norway
Spruce,” Molecular Ecology, Vol. 10, No. 1, 2001, pp.
257-263.
[20] W. Powell, M. Morgante, C. Andre, J. W. McNicol, G. C.
Machray, J. J. Doyle, S. V. Tingey and J. A. Rafalski,
“hypervariable Chloroplast Microsatellites Provide a
General Source of Polymorphic DNA Markers for the
Chloroplast Genome,” Current Biology, Vol. 5, No. 9,
1995, pp. 1023-1029.
[21] G. Besnard, B. Khadari, P. Villemur and A. Bervillé, “A
Cytoplasmic Male Sterility in Olive Cultivars (Olea eu-
ropaea L.): Phenotypic, Genetic and Molecular Ap-
proaches,” Theoretical and Applied Genetics, Vol. 100,
No. 7, 2000, pp. 1018-1024.
[22] N. Minangoin, “L’olivier en Tunisie,” Direction de
l’Agriculture et du Commerce Imprimerie Rapide,
Nicolas L., 1901.
[23] W. Taamalli, F. Geuna, S. B. Temime, D. Bassi, D.
Daoud and M. Zarrouk, “Using Microsatellite Markers to
Characterise the Main Tunisian Olive Cultivars ‘Chem-
lali’ and ‘Chétoui’,” Journal of Horticultural Science and
Biotechnology, Vol. 82, No. 1, 2007, pp. 25-28.
[24] B. Khadari, C. Breton, N. Moutier, J. P. Roger, G.
Besnard and A. Bervillé, “The Use of Molecular Markers
for Germplasm Management in a French Olive Collec-
tion,” Theoretical and Applied Genetics, Vol. 106, No. 3,
2003, pp. 521-529.
[25] F. Carriero, G. Fontanazza, F. Cellini and G. Giorio,
“Identification of Simple Sequence Repeats SSRs (GAPU)
in Olive Olea europaea L,” Theoretical and Applied Ge-
netics, Vol. 104, No. 2-3, 2002, pp. 301-307.
[26] W. S. Oetting, H. K. Lee, D. J. Flanders, G. L. Wiesner, T.
A. Sellers and R. A. King, “Linkage Analysis with Multi-
plexed Short Tandem Repeat Polymorphisms Using In-
frared Fluorescence and M13 Tailed Primers,” Genomics,
Vol. 30, No. 3, 1995, pp. 450-458.
[27] M. Nei, “Genetic Distance between Populations,” The
American Naturalist, Vol. 106, No. 949, 1972, pp. 283-
292.
[28] J. Felsenstein, “PHYLIP (Phylogeny Inference Package),”
Version 3.5c. Department of Genetics, University of
Washington, Seattle, 1993.
[29] C. Breton, C. Pinatel, F. Médail, F. Bonhomme and A.
Bervillé, “Comparison between Classical and Bayesian
Methods to Investigate the History of Olive Cultivars
Using SSR – Polymorphisms,” Plant Science, Vol. 175,
No. 4, 2008, pp. 524-532.
[30] L. Baldoni, N. Tosti, C. Ricciolini, A. Belaj, S. Arcioni, S,
G. Pannelli, M. A. Germana, M. Mulas and A. Porceddu,
“Genetic Structure of Wild and Cultivated Olives in the
Central Mediterranean Basin,” Annals of Botany, Vol. 98,
No. 5, 2006, pp. 935-942.
[31] J. Gressel, “Crop Ferality and Volunteerism,” Taylor and
Francis Boca Raton, 2005.
[32] J. Ruby, “Recherche Morphologique et Biologique sur
l’Olivier et sur ses Variétés Cultivées en France,” Annales
des Sciences Naturelles Botanique, 1918, pp. 1-286.
[33] G. Valdeyron and P. Crossa-Raynaud, “Les Fruits de
Tunisie,” Annales de Services Botanique et Agronomique
de Tunisie, 1950, pp. 23-44.
[34] A. Koutsaftakis, F. Kotsifakis, E. Stefanoudaki and A.
Cert, “Etude Triennale sur les Variations de Plusieurs
Caractéristiques Chimiques et de Divers Composants
Mineurs des Huiles d’olive Vierges Obtenues à Partir
d’Olives Cueillies à Différents Degrés de Maturité,”
Olivae, Vol. 80, 2000, pp. 22-27.
[35] H. Hannachi, M. Msallem, M. El Gazzah and S. Ben
Elhadj, “Etude de la Variabilité Pomologique des Olives
et de la Composition en Acides Gras des Huiles de 15
Variétés d’Olivier Tunisiens (Olea europaea L.),” Revue
des Régions Arides, Vol. 17, No. 1, 2006, pp. 43-64.
[36] H. Camps-Fabrer, “L’Olivier 1ère Partie, L’Olivier et
l’Huile dans l’Afrique Romaine,” Gouvernement Général
de l’Algérie, Direction de l’Intérieur et des Beaux Arts,
Service des Antiquités, Imp. Off., Alger, 1953.
[37] R. Lumaret, N. Ouazzani, H. Michaud and P. Villemur,
“Cultivated Olive and Oleaster, Two Very Closely Con-
nected Partners of the Same Species (Olea europaea).
Evidence from Enzyme Polymorphism,” Bocconea, Vol.
7, 1997, pp. 39-42.
[38] R. Lumaret and N. Ouazzani, “Ancient Wild Olives in
Mediterranean Forests,” Nature, Vol. 413, No. 6857,
2001, p. 700.
[39] M. Amane, N. Ouazzani, R. Lumaret and C. Debain,
“Chloroplast-DNA Variation in the Wild and Cultivated
Olives (Olea europae L.) of Morocco,” Euphytica, Vol.
116, No. 1. 2000, pp. 59-64.
[40] J. Hess, J. W. Kadereit and P. Vargas, “The Colonization
History of L. in Macaronesia Based on Internal Tran-
scribed Spacer 1 (ITS-1) Sequences, Randomly Ampli-
fied Polymorphic DNAs (RAPD) and Intersimple Se-
quence Repeats (ISSR),” Molecular Ecology, Vol. 9, No
7, 2000, pp. 857-868.
[41] A. Contento, M. Ceccarelli, M. T. Gelati, F. Maggini, L.
Baldoni and P. G. Cionini, “Diversity of Olea Genotypes
and the Origin of Cultivated Olives,” Theoretical and Ap-
plied Genetics, Vol. 104, No. 8, 2002, pp. 1229-1238.
[42] G. T. Mekuria, G. Collins and M. Sedgley, “Genetic Di-
versity within an Isolated Olive Olea Europaea L Popula-
tion in Relation to Feral Spread,” Scientia Horticulturae,
Vol. 94, No. 1, 2002, pp. 91-105.
[43] M. Sedgley, “Wild Olive Selection for Quality Oil Pro-
duction,” A Report for the Rural Industries Research and
Development Corporation, RIRDC Publication No 04/
101, 2004.