American Journal of Plant Sciences, 2012, 3, 1520-1526
http://dx.doi.org/10.4236/ajps.2012.311183 Published Online November 2012 (http://www.SciRP.org/journal/ajps)
Molecular Cloning, Sequence Analysis and Expression
Analysis of an NtWRKY6 from Tobacco (Nicotiana
tabacum L.) in Abiotic Strsss
Liqin Li, Yubi Huang*, Wei Wang, Yaling Xu
College of Agronomy, Sichuan Agricultural University, Chengdu, China.
Received August 14th, 2012; revised September 17th, 2012; accepted October 8th, 2012
ABSTRACT
In higher plants, WRKY gene family plays a significant role in transcriptional regulation. They are widely involved in
biotic stress, abiotic stress, growth, development and metabolism regulation. In this study WRKY6 from tobacco is
cloned by homology cloning. 1647 nucleotide sequences were obtained. The deduced protein sequences show that this
protein belongs to the second group of WRKY family, only have one WRKY structure, and the zinc-finger structure is
C-X4-C-X23-H-X1-H. Phylogeny results show NtWRKY6 is much closer to NtWRKY1 generated 97% amino acids
similarity. RT-PCR analysis has revealed that expression levels of NtWRKY6 has increased rapidly at 3 h under NaCI
and PEG treatment. The results suggest that NtWRKY6 is an early responder and may be involved in NaCl and PEG
abiotic stress in tobacco.
Keywords: WRKY Protein; Molecular Cloning; Tobacco; RT-PCR; Expression Analysis
1. Introduction
WRKY protein was originally found in sweet potato and
named SPF1 [1], so far, this family protein was also
found in many plants such as Arabidopsis thaliana, po-
tato, Gossypium spp, Oryza sativa; Nicotiana tabacum
[2-6]. Until the 2005 year, WRKY homologues from two
non-plant eukaryotic species Giardia lamblia and Dic-
tyostelium discoideum were found [7]. WRKY proteins
have been reported to be involved in defense against
bacteria, fungi [8,9], wounding [10], senescence [11],
development [12] and abiotic stresses [13,14].
WRKY family proteins are characterized by one or
two highly conserved WRKYGQK domains, The WRKY
domain is about 60 amino acids in length and a Cys(2)
His(2) or Cys(2)HisCys zinc-binding motif [15]. The two
motifs of WRKY proteins are necessary for the high
binding affinity of WRKY proteins to DNA sequence
motif (W-boxes), which contain an invariant DNA se-
quence (T)(T)TGAC(C/T) [16].
Abiotic stress is an important factor which affects
plant growth, distribution, yield and quality in nature.
NtWRKY6 was identified in the native tobacco Nico-
tiana attenuate, whose wound responses was signifi-
cantly amplified when fatty acid amino acid conjugates
(FACs) in larval oral secretions was introduced into
wounds during feeding [17]. The report of NtWRKY6
involved in abiotic stresses had not been seen.
The tobacco Varieties K326 is the main cultivated
species in the world, our researches first reported that
WRKY6 gene was cloned from the species, 1647 nucleo-
tide sequences were obtained. The deduced protein se-
quence showed that this protein belonged to the second
group of WRKY family, only had one WRKY structure,
and the zinc-finger structure was C-X4-C-X23-H-X1-H.
RT-PCR analysis had revealed that expression levels of
NtWRKY6 had increased rapidly at 3 h under NaCI and
PEG abiotic stress treatment.
2. Materials and Methods
2.1. Plant Materials and Sample Preparation
Tobacco (Nicotiana tabacum L.) K326 was used in this
study. Seeding was sown on MS medium under a 16-h
light/8-h dark cycle at 28˚C. When the second leaves
were fully expanded, the tobacco tissues were collected
for investigation or frozen in liquid nitrogen immediately,
stored at −80˚C for further analysis. For NaCI and PEG
treatment, the seeding when had second leaves were
transferred to MS medium with 250 mM NaCI or 300 m
M PEG for 0, 3, 6, 12, 24 h treatment.
*Corresponding author.

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6
from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss
1521
2.2. Isolation of the Tobacco WRKY6 Gene
The specific primers of NtWRKY6 were designed ac-
cording to the published sequences (Genebank accession
number: AY456272.1). The sequences of primers were
shown in Table 1. PCR product was purified and sub-
cloned into PMD-19T vector (Takara) for sequencing.
2.3. Bioinformatics Analysis
Sequence analysis was carried out by Blast software
(http://www.ncbi.nlm.gov/blast). Deduced anino acid se-
quences were aligned using Clustal W (http://npsa-pbil.
ibcp.fr) software [18]. A phylogenetic tree was construct-
ed based on full-length amino acid sequences using the
neighbor-joining method [19] and was drawn using
MEGA Version 4.1 [20].
2.4. RNA Extraction and Reverse Transcription
RT-PCR
Total RNA was extract from fresh or frozen samples of
tobacco using Trizol reagent (Invitrogen) according to
the standard protocol. In addition, total RNA was also
extracted from tobacco seeding at 0, 3, 6, 12, 24 h after
NaCI or PEG treatment. First-strand cDNA was synthe-
sized with the extracted RNA using M-MLV reverse
transcriptase (Promega) at 42˚C for 1 h and used as the
template for PCR [21]. Amplification was performed
using the following cycling parameters: 95˚C for 5 min
followed by 35 cycles of 95˚C for 30 S (denaturation),
55˚C for 30 S (annealing), 72˚C for 1 min and 40 S (elon-
gation). After the reaction, PCR products were analyzed
on 1.2% (w/v) agrose gels. Expression levels were as-
sessed using 18S rDNA as internal standards for normali-
zation of sample variation. The primers of NtWRKY6
and 18SrDNA for RT-PCR analysis are shown in Table 1.
3. Results
3.1. Amplification of Full Length cDNA of
NtWRKY6
To clone the full length cDNA of NtWRKY6. The full
Table 1. Primer sequence s and the ir uses.
Primer name Nucleotide sequence (5'  3') Purpose
NtWRKY6-F1 ATGAATTCTTTTACTAGCAA
NtWRKY6-R1 TCAGTTAAGGAAAGAGCTGA
Full length
cDNA
amplification
NtWRKY6-F2 TTCTTTTGGTGACGAGGACA
NtWRKY6-R2 CAAATCCTGA ATAACTTGAA
RT-PCR
expression
analysis
18SrDNA-F CCTACGCTCTGTATACATTA
18SrDNA-R GTGTTGAGTCAAATTAAGCC
RT-PCR
expression
analysis
length primers of NtWRKY6 were used to amplify this
gene, RT-PCR products were analyzed on 1.2% (w/v)
agarose gels, and obtained the expected size fragment
(Figure 1). PCR product was purified and subcloned into
PMD-19T vector (Takara) for sequencing using three
positive clones. The result of sequencing had revealed
the amplification product of PCR had 1647 base pairs
(bp).
3.2. Homologous Alignment and Phylogenetic
Analysis of NtWRKY6
To better understand the structure of the deduced amino
acid sequence encoded by tobacco WRKY6, a homolo-
gous alignment was carried out with Clustal W program
using the amino acid sequences of WRKY6 and 19 pro-
teins (Figure 2). Sequence alignment revealed that all
proteins discussed above appeared to be rather conserved
in structure. These proteins all had only one WRKY
structure (WRKYGQK) and the zinc-finger structure is
C-X4-C-X23-H-X1-H. Additionally, the NtWRKY6
shared a very high identity of NtWRKY1 (BAA82107.1)
with 97%, and lower identity of ZmWRKY53 (NP
001147949.1) and Gm WRKY2 (XP 003526383.1) with
41%.
In order to determine the relationship between
WRKY6 and 19 proteins, phylogenetic analysis was fur-
ther carried out by Clustal W program with default pa-
rameters using the amino acid sequences. The phyloge-
netic relationship among 20 WRKY Protein (Figure 3)
showed that the NtWRKY6, NtWRKY1, PcWRKY1 and
HaWRKY7 had relatively close relationship. Fourther-
more, the NtWRKY6, ZmWRKY53 and OsWRKY53
had a relatively far relationship.
3.3. Expression Levels of NtWRKY6 in
Different Tissues
In order to get an insight into the potential function of
NtWRKY6 in tobacco, tissue distribution of NtWRKY6
M 1
2000bp
1000bp
750bp
500bp
250bp
100bp
Figure 1. RT-PCR result of NtWRKY6. M DL2000 DNA
olecular marker, 1 product of RT-PCR. m

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6
from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss
1522
Figure 2. An Alignments of the NtWRKY6 conserved amino acid sequences with homologous 19 WRKY proteins. NtWRKY1
(GenBank accession no, BAA82107.1), DlWRKY17 (GenBank accession no, AEO31478.1), VvWRKY33 (GenBank accession
no, XP_002264974.1), GmWRKY33 (GenBank accession no, XP_003544908.1), PcWRKY1 (GenBank accession no,
AAC49527.1), NtWRKY7 (GenBank accession no, AEX49954.1), BnWRKY33 (GenBank accession no, ACI14397.1), At-
WRKY33 (GenBank accession no, AAM34736.1), NtWRKY2 (GenBank accession no, BAA77383.1), NtWRKY3 (GenBank
accession no, AAS13439.1), GmWRKY39 (GenBank accession no, ABS18436.1), OsWRKY8 (GenBank accession no,
BAB61266.1), TaWRKY27 (GenBank accession no, ACD80363.1), HaWRKY7 (GenBank accession no, AFL91071.1),
TaWRKY10 (GenBank accession no, AAQ57645.1), OsWRKY53 (GenBank accession no, DAA05118.1), ZmWRKY53 (Gen-
Bank accession no, NP_001147949.1), AsWRKY1 (GenBank accession no, AAD32677.1), GmWRKY2 (GenBank accession no,
XP_003526383.1), were aligned by Clustal program version 1.83. According to the degree of conservation, dark gray and
ight gray are indicated. l

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6
from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss
1523
Figure 3. Phylogenetic analysis of the deduced amino acid
sequence betw een NtWRKY6 and 19 WRKY protein.
was studied by semi-quantitative RT-PCR (Figure 4).
The results showed that NtWRKY6 was ubiquitously
expressed in tobacco tissues including root, stem, leaf,
and flower. NtWRKY6 transcripts seemed to be much
abundant in root, leaf, and flower. At the same time, the
lower expression level in stem.
3.4. Stress Induced Expression Patterns of
NtWRKY6
To further investigate whether the expression of
NtWRKY6 was induced by abiotic stresses, we first
monitored the mRNA transcript level of NtWRKY6 un-
der different abiotic stress treatments, including NaCl
and PEG by RT-PCR (Figures 5 and 6). As shown in
Figure 5, the expression level of NtWRKY6 transcripts
under NaCl stress reached the highest level at 3 h. It kept
at 6, 12 h and decreased at 24 h. As shown in Figure 6,
the expression level of NtWRKY6 transcripts under PEG
stress reached the highest level at 3 h. Then, decreased
gradually at 6, 12 h, and declined rapidly at 24 h. These
results revealed the expression level of the NtWRKY6
was increased rapidly at 3 h by the NaCl and PEG stress
treatment, suggesting NtWRKY6 was an early respond-
ers and may be involved in NaCl and PEG stress in to-
bacco. Clearly, this will be an important clue for future
investigation.
18S
NtWRKY6
1 2 3 4
Figure 4. RT-PCR analysis of expression level of NtWRKY6
in tobacco tissues using the specific primers of NtWRKY6.
18S was used for endogenous control. 1: root; 2: stem; 3:
leaf; 4: flower.
NtWRKY6
18S
0 3 6 12 2 4
Figure 5. RT-PCR analysis of expression level of NtWRKY6
in tobacco seeding at 0, 3, 6, 12 and 24 h after 250 mM
NaCI treatment. 18 S was use d for endoge nous c o ntr ol.
NtWRKY6
18S
0 3 6 12 2 4
Figure 6. RT-PCR analysis of expression level of NtWRKY6
in tobacco seeding at 0, 3, 6, 12 and 24 h after 300 mM PEG
treatment. 18 S was used for endogenous co ntr o l.
4. Discussion
According to WRKY domain number and zinc-binding
motif type, WRKY protein were divided three groups,
group I members contained two WRKY domains and
contained a Cys2His2 zinc-finger motif. Group II and
group III contained one WRKY domain, the second
group zinc-binding motif type was same to the first,
group III zinc-binding motif was Cys2HisCys zinc-finger
motif [15]. Its amino acids sequence was different from
group I and group II. At the present, most of WRKY
proteins were the number of the group II, it was specu-
lated that the first group WRKY proteins were produced
because of WRKY domain lost and mutation, the third
group was produced, probably H was mutated to C in
zinc-binding motif type of the second group. So group I
was the most conservative and group III was the most
active in evolutionary history of WRKY family [22].
Previous studies about some WRKY proteins of tobacco
had indicated their roles in biotic stress. For instance, the
expression level of NtWIZZ (Wound-induced Leucine
Zipper Zinc finger) was rapid accumulation at ten min-
utes and arrived peak at 30 min upon wounding [10].
NtWRKY1 and NtWRKY2 had the same expression pat-
tern with NtWIZZ upon wounding [23].
NtTIZZ was an early responsive gene and hypersensi-
tive responders to tobacco mosaic virus, this protein

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6
from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss
1524
maybe play an important role in defense response [24].
NtWRKY3 and NtWRKY9 were induced by pathogen
and salicylic acid, this suggested they were participated
in pathogen and salicylic acid pathway [6]. NtWRKY3
was downstream genes of MAPK, silencing of tobacco
WRKY8 decreased the expression of defense-related
genes and increased disease susceptibility to the patho-
gens Phytophthora infestans and Colletotrichum orbicu-
lare [25]. Only one report about WRKY from tobacco
was involved in abiotic stress, which had showed a
WRKY gene expression was active by drought stress and
heat shock together, but not by only one factors [26].
We had cloned NtWRKY6 from tobacco Varieties
K326, NtWRKY6 encoded a protein of 549 amino acids.
Phylogenetic analysis showed that the NtWRKY6,
NtWRKY1, PcWRKY1 and HaWRKY7 had a relatively
close relationship. RT-PCR analysis had revealed that
NtWRKY6 was ubiquitously expressed in tobacco tis-
sues including root, stem, leaf, and flower. To further
explore the function of NtWRKY6, RT-PCR was also
used to examine the expression of NtWRKY6 under
NaCl and PEG treatments for 0, 3, 6, 12, 24 h. we had
observed that the expression of NtWRKY6 reached the
highest level at 3 h. It kept 6, 12 h and decreased at 24 h
under NaCl treatment, indicating that NtWRKY6 was a
rapidly responder to NaCl stress. Previous studies had
detected that transcript levels of BcWRKY46 (Brassica
campestrisssp Chinensis.) was induced after 2 h of 150
mM NaCl treatment with real-time RT-PCR [27].
Drought is one of the major factors to limit the plant
growth and development in China, the expression level
of NtWRKY6 transcripts under PEG stress reached the
highest level at 3 h. Then, decreased gradually at 6, 12 h,
and declined rapidly at 24 h. This result showed that
NtWRKY6 was participated in drought stress. Recently
there are many researches about WRKY genes involved
in PEG stress, such as Zhang have showed the transcrip-
tion of HbWRKY1 (Hevea brasiliensis Muell. Arg.) in
leaves was gradually up-regulated and came to its peak at
12 h after 20% PEG 6000 treatment [28]. So, we can
conclude NtWRKY6 might be upstream regulator in salt
and drought pathway. When tobacco faces this two stress,
the expression level of NtWRKY6 rising will increase or
decrease downstream target gene expression, some re-
searches had reported the expression of BcWRKY46
(Brassica campestrisssp Chinensis.) and LtWRKY21
(Larrea tridentata) were both enhanced by drought and
high salinity [27,29]. On the other hand, under drought
and salt stress, no obviously change of the GhWRKY3
expression was observed [30]. OsWRKY80 expression
was up-regulated by drought stress and there was no
change under 100 mM NaCl stress [31]. These results
suggested WRKY protein from different plants had many
different expression patterns and functions.
In conclusion, we have isolated and characterized
NtWRKY6 from tobacco (Nicotiana tabacum L.), then
have examined the tissue distribution and expression
pattern of NtWRKY6 with RT-PCR. According to our
results, NtWRKY6 may play a vital role in the NaCl and
PEG stress of tobacco.
However, for further study, detailed investigations
should be carried out to clarify the function of NtWRKY6,
such as acquiring transgenic plants of over-expression
NtWRKY6 and prokaryotic expression NtWRKY6, these
experiments will be very important in our future work.
5. Acknowledgements
This work was supported by Natural Science Foundation
of China (No. 31070244).
REFERENCES
[1] S. Ishiguro and K. Nakamura, “Characterization of a
cDNA Encoding a Novel DNA-Binding Protein, SPF1,
That Recognizes 1SP8 Sequences in the 50 Upstream Re-
gions of Genes Coding for Sporamin and Beta-Amylase
from Sweet Potato,” Molecular Genetics and Genomics,
Vol. 244, No. 6, 1994, pp. 563-571.
doi:10.1007/BF00282746
[2] S. Robatzek and I. E. Somssich, “A New Member of the
Arabidopsis WRKY Transcription Factor Family, At-
WRKY6, Is Associated with Both Senescence- and De-
fense-Related Processes,” The Plant Journal, Vol. 28,
2001, pp. 123-133.
[3] M. Lagacé and D. P. Matton, “Characterization of a
WRKY Transcription Factor Expressed in Late Torpedo
Stage Embryos of Solanum chacoense,” Planta, Vol. 219,
No. 1, 2004, pp. 185-189.
doi:10.1007/s00425-004-1253-2
[4] Y. H. Xu, J. W. Wang, S. Wang, J. Y. Wang and X. Y.
Chen, “Characterization of GaWRKY1, a Cotton Tran-
scription Factor That Regulates the Sesquiterpene Syn-
thase Gene (+)-δ-Cadinene Synthase-A,” Plant Physiol-
ogy, Vol. 135, No. 1, 2004, pp. 507-515.
doi:10.1104/pp.104.038612
[5] Z. L. Zhang, Z. Xie, X. L. Zou, J. Casaretto, T. H. David
and Q. X. Shen, “A Rice WRKY Gene Encodes a Tran-
scriptional Repressor of the Gibberellin Signaling Path-
way in Aleurone Cells,” Plant Physiology, Vol. 134, No.
4, 2004, pp. 1500-1513.
[6] C. Chen and Z. Chen, “Isolation and Characterization of
Two Pathogen and Salicylic Acid-Induced Genes Encod-
ing WRKY DNA-Binding Proteins from Tobacco,” Plant
Molecular Biology, Vol. 42, No. 2, 2000, pp. 387-396.
doi:10.1023/A:1006399311615
[7] Y. Zhang and L. Wang, “The WRKY Transcription Fac-
tor Superfamily: Its Origin in Eukaryotes and Expansion
in Plants,” BMC Evolutionary Biology, Vol. 5, 2005, pp.
1-12. doi:10.1186/1471-2148-5-1

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6
from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss
1525
[8] P. Z. Yang, C. H. Chen, Z. P. Wang, B. F. Fan and Z. X.
Chen, “A Pathogen and Salicylic Acid-Induced WRKY
DNA-Binding Activity Recognizes the Elicitor Response
Element of the Tobacco Class I Chitinase Gene Pro-
moter,” The Plant Journal, Vol. 18, No. 2, 1999, pp. 141-
149.
[9] L. Du and Z. Chen, “Identification of Genes Encoding
Receptorlikeprotein Kinases as Possible Targets of Patho-
gen-Andsalicylic Acid-Induced WRKY DNA-Binding
Proteins in Arabidopsis,” The Plant Journal, Vol. 24, No.
6, 2000, pp. 837-847.
[10] K. Hara, M. Yagi, T. Kusano and H. Sano, “Rapid Sys-
temic Accumulation of Transcripts Encoding a Tobacco
WRKY Transcription Factor upon Wounding,” Molecu-
lar Genetics and Genomics, Vol. 263, No. 1, 2000, pp.
30-37. doi:10.1007/PL00008673
[11] S. Robatzek and I. E. Somssich, “Targets of AtWRKY6
Regulation during Plant Senescence and Pathogen De-
fense,” Genes & Development, Vol. 16, 2002, pp. 1139-
1149. doi:10.1101/gad.222702
[12] M. Luo, E. S. Dennis, F. Berger, W. J. Peacock and A.
Chaudhury, “A MINI SEED3 (MINI3), a WRKY Family
Gene, and HAIKU2 (IKU2), a Leucine-Rich Repeat
(LRR) Kinase Gene, Are Regulators of Seed Size in
Arabidopsis,” Proceedings of the National Academy of
Sciences of the USA, Vol. 102, No. 48, 2005, pp. 17531-
17536. doi:10.1073/pnas.0508418102
[13] B. N. Devaiah, A. S. Karthikeyan and K. G. Raghothama,
“WRKY75 Transcription Factor Is a Modulator of Phos-
phate Acquisition and Root Development in Arabidop-
sis,” Plant Physiology, Vol. 143, No. 4, 2007, pp. 1789-
1801.
[14] Y. F. Chen, L. Q. Li, Q. Xu, Y. H. Kong, H. Wang and W.
H. Wu, “The WRKY6 Transcription Factor Modulates
PHOSPHATE1 Expression in Response to Low Pi Stress
in Arabidopsis,” The Plant Cell, Vol. 21, No. 11, 2009,
pp. 3554-3566. doi:10.1105/tpc.108.064980
[15] T. Eulgem, P. J. Rushton, S. Robatzek and I. E. Somssich,
“The WRKY Superfamily of Plant Transcription Fac-
tors,” Trends in Plant Science, Vol. 5, No. 5, 2000, pp.
199-206. doi:10.1016/S1360-1385(00)01600-9
[16] P. J. Rushton, H. Macdonald, A. K. Huttly, C. M. Lazarus
and R. Hooley, “Members of a New Family of DNA-
Binding Proteins Bind to a Conserved cis-Element in the
Promoters of Alpha-Amy2 Genes,” Plant Molecular Bi-
ology, Vol. 29, No. 4, 1995, pp. 691-702.
[17] M. Skibbe, N. Qu, I. Galis and I. T. Baldwin, “Induced
Plant Defenses in the Natural Environment: Nicotiana
Attenuata WRKY3 and WRKY6 Coordinate Responses
to Herbivory,” The Plant Cell, Vol. 20, No. 7, 2008, pp.
1984-2000. doi:10.1105/tpc.108.058594
[18] Y. L. Zhuang, G. J. Ren, C. M. He, X. Y. Li, Q. M. Meng,
C. F. Zhu, R. C. Wang and J. Zhang, “Cloning and Char-
acterization of a Maize cDNA Encoding Glutamate De-
carboxylase,” Plant Molecular Biology Reporter, Vol. 28,
No. 4, 2010, pp. 620-626.
[19] X. M. Liu, J. M. Anderson and P. M. Pijut, “Cloning and
Characterization of Prunus serotina AGAMOUS, a Puta-
tive Flower Homeotic Gene,” Plant Molecular Biology
Reporter, Vol. 28, No. 2, 2010, pp. 193-203.
doi:10.1007/s11105-009-0140-1
[20] K. Tamura, J. Dudley, M. Nei and S. Kumar, “MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA)
Software Version 4.0,” Molecular Biology and Evolution,
Vol. 24, No. 8, 2007, pp. 1596-1599.
[21] L. J. Wu, X. T. Wang, L. C. Wu, P. G. Wang and Y. H.
Chen, “Molecular Cloning and Expression Analysis of an
HINT1Homologue from Maize (Zea mays L.),” Plant
Molecular Biology Reporter, Vol. 29, 2011, pp. 1006-
1012.
[22] B. Ulker and I. E. Somssich, “WRKY Transcription Fac-
tors: From DNA Binding towards Biological Function,”
Current Opinion in Plant Biology, Vol. 263, No. 5, 2004,
pp. 491-498. doi:10.1016/j.pbi.2004.07.012
[23] T. Nishiuchi, H. Shinshi and K. Suzuki, “Rapid and Tran-
sient Activation of Transcription of the ERF3 Gene by
Wounding in Tobacco Leaves Possible Involvement of
NtWRKYs and Auto Repression,” Journal of Biological
Chemistry, Vol. 279, No. 53, 2011, pp. 55355-55361.
doi:10.1074/jbc.M409674200
[24] H. Yoda, M. Ogawa, Y. Yamaguchi, N. Koizumi, T. Ku-
sano and H. Sano, “Identification of Early-Responsive
Genes Associated with the Hypersensitive Response to
Tobacco Mosaic Virus and Characterization of a WRKY-
Type Transcription Factor in Tobacco Plants,” Molecular
Genetics and Genomics, Vol. 267, No. 2, 2002, pp. 154-
161. doi:10.1007/s00438-002-0651-z
[25] N. Ishihama, R. Yamada, M. Yoshioka, S. Katou and H.
Yoshioka, “Phosphorylation of the Nicotiana Bentha-
miana WRKY8 Transcription Factor by MAPK Functions
in the Defense Response,” The Plant Cell, Vol. 23, No. 3,
2011, pp. 1153-1170.
[26] L. Rizhsky, H. Liang and R. Mittler, “The Combined
Effect of Drought Stress and Heat Shock on Gene Ex-
pression in Tobacco,” Plant Physiology, Vol. 130, No. 3,
2012, pp.1143-1151. doi:10.1104/pp.006858
[27] F. Wang, X. L. Hou, J. Tang, Z. Wang, S. M. Wang, F.
Jiang and Y. Li, “A Novel Cold-Inducible Gene from
Pak-Choi (Brassica campestrisssp. chinensis), BcWRKY46,
Enhances the Cold, Salt and Dehydration Stress Toler-
ance in Transgenic Tobacco,” Molecular Biology Reports,
Vol. 39, No. 4, 2012, pp. 4553-4564.
doi:10.1007/s11033-011-1245-9
[28] Q. Q. Zhang, J. H. Zhu, Y. M. Ni, Y. B. Cai and Z. L.
Zhang, “Expression Profiling of HbWRKY1, an Ethe-
phon-Induced WRKY Gene in Latex from Hevea brasil-
iensis in Responding to Wounding and Drought,” Trees,
Vol. 26, No. 2, 2012, pp. 587-595.
doi:10.1007/s00468-011-0623-1
[29] X. L. Zou, Q. Shen and D. Neuman, “An ABA Inducible
WRKYgene Integrates Responses of Creosote Bush (Lar-
rea tridentata) to Elevated CO2 and Abiotic Stresses,”
Plant Science, Vol. 172, No. 5, 2004, pp. 997-1004.
doi:10.1016/j.plantsci.2007.02.003
[30] R. Y. Guo, F. F. Yu, Z. Gao, H. L. An, X. C. Cao and X.
Q. Guo, “GhWRKY3, a Novel Cotton (Gossypium hirsu-

Molecular Cloning, Sequence Analysis and Expression Analysis of an NtWRKY6
from Tobacco (Nicotiana tabacum L.) in Abiotic Strsss
1526
tum L.) WRKY Gene, Is Involved in Diverse Stress Re-
sponses,” Molecular Biology Reports, Vol. 38, No. 1,
2011, pp. 49-58. doi:10.1007/s11033-010-0076-4
[31] K. Felipe, R. Ricachenevsky, S. Antonio, K. Paloma, J.
Menguer and F. Palma, “Identification of Fe-Excess-In-
duced Genes in Rice Shoots Reveals a WRKY Transcrip-
tion Factor Responsive to Fe, Drought and Senescence,”
Molecular Biology Reports, Vol. 37, No. 8, 2010, pp.
3735-3745.