American Journal of Plant Sciences, 2012, 3, 1304-1310
http://dx.doi.org/10.4236/ajps.2012.39157 Published Online September 2012 (http://www.SciRP.org/journal/ajps)
DNA Barcoding of Ricinus communis from Different
Geographical Origin by Using Chloroplast matK and
Internal Transcribed Spacers
Mohamed Enan1,2, Nael Fawzi1,3, Mohammad Al-Deeb1, Khaled Amiri1
1Department of Biology, UAE University, Al-Ain, UAE; 2Agricultural Genetic Engineering Research Institute (AGERI), Agricul-
tural Research Center (ARC), Giza, Egypt; 3Flora and Phyto-Taxonomy Research Department, Horticultural Research Institute, Ag-
ricultural Research Center, Giza, Egypt.
Received June 27th, 2012; revised July 23rd, 2012; accepted August 1st, 2012
ABSTRACT
Ricinus communis have attracted considerable attention because of its specific industrial and pharmacological activities.
DNA barcodes can be used as reliable tools to facilitate the identification of medicinal plants for the safe use, quality
control and forensic investigation. In this study, the differential identification of eight accessions of R. communis was
investigated through DNA sequence analysis of two candidate DNA barcodes. The nucleotide sequence of internal
transcribed spacers (ITS2) and chloroplast maturase gene (matK) have been determined to construct the phylogenetic
tree. The phylogenetic relationships of accessions based on the nrITS2 region and partial matK region showed that all
accessions in this study were related to three geographical origins. Based on sequence alignment and phylogenetic ana-
lyses we concluded that the ITS2 sequences can distinguish R. communis accessions from different geographical distri-
butions.
Keywords: DNA Barcoding; Internal Transcribed Spacer; Maturase K; Ricinus communis
1. Introduction
The castor oil plant, Ricinus communis also known as
Palma(e) christi or wonder tree. It is a perennial scrub of
the family Euphorbiaceae. The plant can vary greatly in
its growth habit and morphology. The variability has
been increased by breeders who have selected a range of
cultivars for use as ornamental plants, and for commer-
cial production of castor oil [1]. The castor oil is a
wonderful universal remedy for a large number of health
concerns. The oil has been used as for warts, cold tumors,
indurations of the abdominal organs, lacteal tumors and
indurations of the mammary gland [2]. Seeds have high
oil content, with multiple industrial applications such as
paints, lubricants, cosmetics, polymers and biofuels [3].
DNA barcoding is a method of describing and identify-
ing species by analyzing sequence information from one
or a few short standardized loci amplified with universal
primers. To standardize the international use of DNA
barcodes, the scientific community has made consider-
able efforts searching for suitable DNA regions to bar-
code every species [4-8]. DNA barcoding provides a ra-
pid identification tool, utilizing only minute amount of
tissue from any stage of development of a plant or animal.
DNA barcodes can be used to identify specimens corre-
ctly, to expand the discovery of new species, in tackling
illegal trade of endangered species of both plant and ani-
mals and in forensic investigation to help detect poison-
ous materials in life-threatening cases [9,10]. DNA bar-
coding has been proposed as a novel and powerful taxo-
nomic tool [6,11], the mitochondrial cytochrome oxidase
subunit I (CO1) is a widely used barcode in a range of
animal groups [12-15] this locus is unsuitable for use in
plants due to its low mutation rate [4,14,15]. A variety of
loci have been suggested as DNA barcodes for plants,
including coding genes in plastid genome and the multi-
copy nuclear Internal Transcribed Spacer (ITS) are two
of the leading candidates [4]. Thus, this issue is add-
ressed in the present study by comparing the feasibility
of using each of these proposed DNA barcodes (matK,
ITS1, ITS2) to identify gen etic variations of R. communis
accessions from different geographical distributions.
2. Materials and Methods
2.1. Plant Materials
Eight accessions from R. communis were examined. The *Corresponding a uthor.

DNA Barcoding of Ricinus communis from Different Geographical Origin by Using Chloroplast matK
and Internal Transcribed Spacers 1305
eight accessions are as follows: R1 (Kadiogo), R3 (Sour),
R5 (Tunisia), R7 (Venezuela), R8 (Yemen, Hardamout),
and R9 (Yemen, Lawdar), were obtained from the
Millennium Seed Bank, Kew Royal Botanic Gardens,
however, R2 and R6 were collected from Egypt and
United Arab Emirates (UAE), respectively. The plant
specimens used in this study are summarized in Table 1.
2.2. DNA Isolation
Plant seeds are hard to lyse due to seed coat and hard
cotyledon inside, the seed coats mainly contain tannins
that inhibit PCR. The inner seed material contains star-
ches and lipids that can foam and make lysis difficult
[16]. The seeds of each accession were immersed in
liquid nitrogen and crushed using sterile mortar and
pestle to get a fine powder. An automatic DNA extra-
ction (Maxwell16, Promega) and DNeasy plant mini kit
(Qiagen) were used for DNA extraction. DNeasy plant
mini kit with slight modification in which 0.4% (v/v)
β-mercaptoethanol was added to AP1/E lysis buffer was
performed. Quality of the extracted DNA was deter-
mined using gel electrophoresis.
2.3. PCR Amplification
A total volume of 30 µL of PCR reaction mixture con-
tained the following : 15 µL of PCR Master Mix (Qiagen,
Germany), giving a final concentration of 200 mM each
deoxynucleotide and 1.5 mM MgCl2, 20 pM each primer
(Table 2), 2 µL of genomic DNA (50 ng) and the rest
was adjusted with sterile distilled water. PCR amplifica-
tion was performed with a thermal cycler (T100 , BIORAD)
as follows: one cycle at 95˚C for 5 min, followed by 35
cycles of 95˚C for 30 s, 55˚C for 30 s and 72˚C for 1 min,
followed by an elongation step at 72˚C for 5 min. All the
PCR conditions were the same for all the primer pairs.
2.4. Agarose Gel Electrophoresis
PCR products were examined using 1.5% agarose gel
electrophoresis in 1X TBE (Tris-Boric acid-EDTA)
buffer at 70 V for ∼45 min. Gel images were obtained
using Gel documentation (Major Bioscience, Taiwan)
imaging system. The size of PCR products resulting from
the primer pairs of the specific barcoding gene were
determined by using a 50 bp sharp mass (Euro Clone,
Italy) and 100 bp DNA ladder (Promega, Madison).
2.5. Sequencing and Alignment
PCR products sent to the Source Bioscience (Notting ham,
UK) for sequencing after simple purification and se-
quenced according to the method originally described by
Sanger [17]. ITS2 and matK products were sequenced
using the same primer pairs as used for the initial am-
plification. The sequences from each DNA region were
aligned by CLUSTALW and genetic distance was com-
puted using the MEGA 5.0 Kimura two-parameter (K2P)
model [18]. The nucleotide sequence data of the partial
matK sequence and ITS2 spacer were deposited in the
Genbank nucleotide sequence databases with the acce-
ssion numbers reported in Table 2. The phylogenetic
trees were constructed using maximum likelihood (ML)
in MEGA 5.0 software program. Bootstrap testing of
1000 replicates was performed to estimate the confidence
level of the topology of the cons ensus tree.
3. Results
Our study showed that DNA extraction using Plant
DNeasy minikit provided better yield and quality com-
pared with automatic DNA extraction method that failed
to produce higher quality and PCR amplification . For the
ITS and matK, all samples showed an equal size of the
PCR product. Excluding the primer flanking sites, the
sizes of the ITS1, ITS2 and matK of all accessions were
360 to 440 and 790 bp in length, resp ectiv ely as shown in
Figure 1. The ITS1, ITS2 spacers and matK gene of all
accessions were successfully amplified and only ITS2
and matK regions were successfully sequenced. For a
Table 1. Plant samples used in this study.
Accession number
Sample ID Geographical origin Date of collection Collector and MSB serial No.ITS2 matK
R1 BURKINA FAS O, Ka d io g o 1998 No.125723* JX084257 JX084265
R2 Egypt, Zagazig 2009 F. Nael JX084258 JX084266
R3 LEBANON, Sour 1998 No.129329* JX084259 JX084267
R5 TUNISIA, Tataouine 1997 No.119694* JX084260 JX084268
R6 UAE, Al-Ain 2009 F. Nael JX084261 JX084269
R7 VENEZUELA, Nueva Espart a 1994 No.103716* JX084262 JX084270
R8 YEMEN, Hadramout 1997 No.118664* JX084263 JX084271
R9 YEMEN, Lawdar 1997 No.118387* JX084264 JX084272
*The number is the se rial number in the Millennium Seed Bank (MBS), Kew Royal Botanic Gardens.

DNA Barcoding of Ricinus communis from Different Geographical Origin by Using Chloroplast matK
and Internal Transcribed Spacers
1306
Table 2. Universal primers for the amplification and sequencing of DNA barcodes.
Locus Primer name Primer s e q uence (5'-3') References
ITS1 5'-TCCGTAGGTGAACCTGCGG-3' White et al., 1990
ITS2 5'-GCTGCGTTCTTCATCGATGC-3' White et al., 1990
ITS3 5'-GCATCGATGAAGAACGCAGC-3' White et al., 1990
ITS
ITS4 5'-TCCTCCGCTTATTGATATGC-3' White et al., 1990
matK472F 5'-CCCRTYCATCTGGAAATCTTGGTTC-3' Yu et al., 2011
matK matK1248R 5'-GCTRTRATAATGAGAAAGATTTCTGC-3' Yu et al., 2011
ITS: Internal transcribed spacer; matK: Maturase K gene.
Figure 1. Agarose gel of electrophoresis of PCR products of
ITS1, ITS2 and matK genes show a single band in the elec-
trophoresis profiles, corresponding to 360, 440, and 790 bp
in length. M1: 50bp sharp mass ladder; M2: 100 bp DNA
ladder.
DNA-based identification of R. communis, two candidate
DNA barcode sequences were submitted to multiple se-
quence alignment (MSA).
The nucleotide sequ ence alignment of ITS2 barcode of
R1 (Kadiogo), R3 (Sour), R5 (Tunisia), R6 (UAE), R7
(Venezuela), R8 (Hadramout) and R9 (Lawdar) had 2, 2,
3, 3, 2, 3, and 3 base substitutions in comparison with
those R2 (Egypt), respectively as shown in Figure 2. The
matK sequences alignment of 8 accessions revealed that
the sequence of R1 (Kadiogo), R5 (Tunisia), R6 (UAE),
R7 (Venezuela), R8 (Hadramout), R9 (Lawdar) had only
one base substitutions. On the other hand, the sequence
of R3 (Lebanon, Sour) had 16 base substitutions com-
pared with the sequence of R2 (Egypt) as shown in Fig-
ure 3. The sequence divergence among eight accessions
of R. communis from different geographical origin varied
from 0.00% to 0.78% (Table 3). In contrast, matK se-
quence divergence among 8 accessions varied was from
0.13 % to 0.75% (Table 4). The phylogenetic tree con-
structed by the matK gene analysis suggested that the
eight accessions were divided into two clusters. R2
(Egypt) belong to the same cluster with R1 (Kadiogo),
R5 (Tunisia), R6 (UAE), R7 (Venezuela), R8 (Hadra-
mout), and R9 (Lawdar), while R3 (Lebanon, Sour)
separated into another cluster (Figure 4).This tree was
incompatible with that constructed by ITS2 analysis
suggested that R7 (Venezuela) and R2 (Egypt), and R1
(Kadiogo) were in one cluster, other accessions (R5, R8,
R9, R6 and R3) in the second clus ter which were divided
into two subclusters in the phylog enetic tree (Figure 5).
4. Discussion
The castor oil plant R. communis is on e of the oldest drugs
known to man. The first mention of it as a laxative can be
found in 3500 year-old Ancient Egyptian papyrus scrolls.
The most promising plastid candidate maturase K [15,19]
was tested, along with the nuclear locus internal trans-
cribed spacer (ITS2), which is also a most important
candidate for plant barcoding [4,20]. The ITS2 region
was selected as a barcode candidate because ITS2 se-
quences are potential general phylogenetic markers and
are widely used for phylogenetic constructions at both
the genus and species levels [21,22]. As the ITS2 region
is one of the most common regions used for phylogenetic
analyses [23]. In our study, nrITS1 regions were ampli-
fied cleanly in 8 accessions but sequencing was unsuc-
cessful. Chodon et al. [24] reported that one of poten-
tially negative factor for sequencing nrITS is the pre-
sence of ply-G, poly-C, and poly-A repeats. In general
the nrITS2 region is more length-conserved than nrITS1,
making it a more predictable amplicon to work with [7].
Our research shows that a single region matK or ITS2 a
portion, it was demonstrated that the seq uence nucleotide
variation can distinguish genetics divergence among R.
communis from different geographical origin; this was
supported by sequence alignment analyses. In previous
studies, ITS2 has already been suggested as a suitable
marker applicable for phylogenetic reconstruction in eu-
karyotes by many researchers [21,22,25]. The matK cod-
ing region is one of the most rapidly evolving regions in
chloroplasts and shows a high level of species discrimi-
nation among angiosperms, a fragment of 600 - 800 bp is

DNA Barcoding of Ricinus communis from Different Geographical Origin by Using Chloroplast matK
and Internal Transcribed Spacers 1307
Table 3. Pairwise genetic distance of matK barcode region.
matkR1 matkR2 matkR3 matkR5 matkR6 matkR7 matkR8 matkR9
- matkR9
- 0.67864 matkR8
- 0.72401 0.68620 matkR7
- 0.43289 0.71267 0.65595 matkR6
- 0.69943 0.72779 0.69376 0.72590 matkR5
- 0.75992 0.67297 0.69376 0.70132 0.13043 matkR3
- 0.72779 0.71456 0.70510 0.73724 0.69376 0.71456 matkR2
- 0.71645 0.69187 0.69565 0.21928 0.65217 0.68242 0.67675 matkR1
Table 4. Pairwise genetic distance of ITS2 barcode region.
ITS2R9 ITS2R8 ITS2R7 ITS2R5 ITS2R3 ITS2R2 ITS2R1 ITS2R6
- ITS2R6
- 0.00906 ITS2R1
- 0.71601 0.71299 ITS2R2
- 0.78852 0.73716 0.74018 ITS2R3
- 0.74018 0.71299 0.00906 0.00604 ITS2R5
- 0.72205 0.73716 0.71299 0.72508 0.72205 ITS2R7
- 0.72205 0.00000 0.74018 0.71299 0.00906 0.00604 ITS2R8
- 0.00000 0.72205 0.00000 0.74018 0.71299 0.00906 0.00604 ITS2R9
R2 Egypt 1 ATCTAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTCGGCCGAGGGCACGCCTGCCTGG 60
R6 UAE 1 ...G........................................................ 60
R1 Kadiogo 1 ...G........................................................ 60
R3 Sour 1 ...G........................................................ 60
R5 Tunisia 1 ...G........................................................ 60
R7 Venezuela 1 ...G........................................................ 60
R8 Hadramout 1 ...G........................................................ 60
R9 Lawdar 1 ...G........................................................ 60
R2 Egypt 62 GTGTCACGCAATCGTCGCCCCCAACCCTTTCGATACATCGAGAGGGGGGCGGATTATGTC 121
R6 UAE 62 ..........................................................G. 121
R1 Kadiogo 62 ............................................................ 121
R3 Sour 62 ..........................................................G. 121
R5 Tunisia 62 ............T.............................................G. 121
R7 Venezuela 62 ............................................................ 121
R8 Hadramout 62 ............T.............................................G. 121
R9 Lawdar 62 ............T.............................................G. 121
R2 Egypt 122 CTCCCGTGCGCCTCGTGCATGCGGTTGGCCTAAAAATTGAGTCCCCGGCGACTATCGCCA 181
R6 UAE 122 ............................................................ 181
R1 Kadiogo 122 ............................................T............... 181
R3 Sour 122 ............................................................ 181
R5 Tunisia 122 ............................................................ 181
R7 Venezuela 122 ............................................T............... 181
R8 Hadramout 122 ............................................................ 181
R9 Lawdar 122 ............................................................ 181
R2 Egypt 182 CGGCAATCGGTGGTTGTAAGACTCTCTGAAACTGCCGTGCGCGCTCGTCTGCCAAGAGGG 241
R6 UAE 182 ..A......................................................... 241
R1 Kadiogo 182 ............................................................ 241
R3 Sour 182 ............................................................ 241
R5 Tunisia 182 ............................................................ 241
R7 Venezuela 182 ............................................................ 241
R8 Hadramout 182 ............................................................ 241
R9 Lawdar 182 ............................................................ 241
Figure 2. Part aligned sequence of the ITS2 region of eight accessions of R. communis. The dots indicate that the base at that
position in the specifi ed s eq uence is the same as th e b ase in the seq uen ce written at the top of t he compilation.

DNA Barcoding of Ricinus communis from Different Geographical Origin by Using Chloroplast matK
and Internal Transcribed Spacers
1308
matKR2 Egypt 1 GACTCTTTCTTCATGAGTATTGGAATTGGAACAGTTTTATTATTCCGAAAGAAATCAATT 59
matKR6 UAE 1 ............................................................ 59
matKR1 Kadiogo 1 ............................................................ 59
matKR3 Sour 1 ..........G...............G..CC..T....T..............G...... 59
matKR5 Tunisia 1 ............................................................ 59
matKR7 Venezuela 1 ............................................................ 59
matKR8 Hadramout 1 ............................................................ 59
matKR9 Lawdar 1 ............................................................ 59
matKR2 Egypt 60 TCTATTTTTACAAAAAGTAATCCAAGATTTTTCGTGTTCCTATATAATTCTCATGTATAT 119
matKR6 UAE 60 ............................................................ 119
matKR1 Kadiogo 60 ............................................................ 119
matKR3 Sour 60 ..................................G..................A.A.... 119
matKR5 Tunisia 60 ............................................................ 119
matKR7 Venezuela 60 ............................................................ 119
matKR8 Hadramout 60 ............................................................ 119
matKR9 Lawdar 60 ............................................................ 119
matKR2 Egypt 120 GAATATGAATCCCTCTTCTTTTTTCTCCGTAACCAATCCTTTCATTTACGATCAACATTT 179
matKR6 UAE 120 ............................................................ 179
matKR1 Kadiogo 120 ............................................................ 179
matKR3 Sour 120 ...............G....G....C.................................. 179
matKR5 Tunisia 120 ............................................................ 179
matKR7 Venezuela 120 ............................................................ 179
matKR8 Hadramout 120 ............................................................ 179
matKR9 Lawdar 120 ............................................................ 179
matKR2 Egypt 360 AAATATTACCTTGTCCATTTATGTCAATGTCATTTTTATGTGTGGTTTCAACCGGAAAAG 419
matKR6 UAE 359 ............................................................ 418
matKR1 Kadiogo 360 ............................................................ 419
matKR3 Sour 360 .................................................C.......... 419
matKR5 Tunisia 360 ............................................................ 419
matKR7 Venezuela 360 ............................................................ 419
matKR8 Hadramout 360 ............................................................ 419
matKR9 Lawdar 360 ............................................................ 419
matKR2 Egypt 420 ATCTATATAAATTCATTATCTAAGCATTCTCTCAACTTTTTGGGCTATCTTTCAAATGTA 479
matKR6 UAE 420 ............................................................ 479
matKR1 Kadiogo 420 ............................................................ 479
matKR3 Sour 420 ....................................................G....... 479
matKR5 Tunisia 420 ............................................................ 479
matKR7 Venezuela 420 ............................................................ 479
matKR8 Hadramout 420 ............................................................ 479
matKR9 Lawdar 420 ............................................................ 479
matKR2 Egypt 480 CAATTTAATCCTTCGTTGGTACGGAGTCAAATGAAAGAAAAT 521
matKR6 UAE 480 ..................................T....... 521
matKR1 Kadiogo 480 ..................................T....... 521
matKR3 Sour 480 ..................................T....... 521
matKR5 Tunisia 480 ..................................T....... 521
matKR7 Venezuela 480 ..................................T....... 521
matKR8 Hadramout 480 ..................................T....... 521
matKR9 Lawdar 480 ..................................T....... 521
Figure 3. Part aligned se quenc e of the matK barcode region of eight accessions of R. communis. The dots indicate that the bas e
at that position in the s pecified sequence is the sam e as th e bas e in the s equ ence wr itten at the top of the compilation.
matKR8
matKR7
matKR6
matKR5
matKR1
matKR9
matKR2
matKR3
Figure 4. Maximum likelihood tree constructed by partial sequence of matK gene from eight R. communis accession.
usually sufficient [15,26]. The matK region varied suffi-
ciently to distinguish “Sanqi” (Panax notoginseng; Ar-
aliaceae) from different geographical origins [27], but it
failed to differentiate among Sanqi cultivars [28]. The
partial matK sequence of 7 accessions (R1, R5, R6, R7,
R8, and R9) shows only one nucleotide substations at

DNA Barcoding of Ricinus communis from Different Geographical Origin by Using Chloroplast matK
and Internal Transcribed Spacers 1309
ITS2R5
69 ITS2R8
26 ITS2R9
ITS2R3
ITS2R6
ITS2R2
ITS2R1
55 ITS2R7
73
Figure 5. Maximum likelihood tree constructed ITS2 sequence from eight R. communis accessions.
one position compared with accession R2 from Egypt.
However, R3 accession from Lebanon had 16 base sub-
stitutions. In this study access ions from Yemen, Kadiogo,
Venezuela, United Arab Emirates and Tunisia had the
same matK sequence which might be ascribed to the
same ancestor and different Environment. In the present
study, nrITS2 sequence was found to correlate with geo-
graphical distributions of the samples which matK gene
sequence was conserved than the ITS2.
5. Conclusion
Based on our own findings, we propose that ITS2 be
used as the desired barcode to study geographical dis-
tributions of Euphorbiaceae species.
REFERENCES
[1] B. Christopher, “The Royal Horticultural Society A-Z
Encyclopedia of Garden Plants,” Dorling Kindersley,
London, 1996, pp. 884-885.
[2] A. Scarpa and A. Guerci, “Various Uses of the Castor Oil
Plant (Ricinus communis L.): A Review,” Journal of
Ethnopharmacology, Vol. 5, No. 2, 1982, pp. 117-137.
doi:10.1016/0378-8741(82)90038-1
[3] M. F. Jose and V. Leonardo, “Castor,” In: S. K. Gupta,
Ed., Technological Innovations in Major World Oil Crops,
Volume 1: Breeding, Springer, 2012, pp. 237-265.
[4] W. J. Kress, K. J. Wurdack, E. A. Zimmer, L. A. Weigt
and D. H. Janzen, “Use of DNA Barcodes to Identify
Flowering Plants,” Proceedings of the National Academy
of Sciences of the USA, Vol. 102, 2005, pp. 8369-8374.
doi:10.1073/pnas.0503123102
[5] W. J. Kress and D. L. Erickson, “A Two-Locus Global
DNA Barcode for Land Plants: The Coding rbcL Gene
Complements the Non-Coding trnH-psbA Spacer Re-
gion,” PloS One, Vol. 2, 2007, p. e508.
doi:10.1371/journal.pone.0000508
[6] CBOL Plant Working Group, “A DNA Barcode for Land
Plants,” Proceedings of the National Academy of Sciences
of the USA, Vol. 106, 2009, pp. 12794-12797.
doi:10.1073/pnas.0905845106
[7] S. Chen, H. Yao, J. Han, C. Liu, J. Song, L. Shi, Y. Zhu,
X. Ma, T. Gao, X. Pang, K. Luo, Y. Li, X. Li, X. Jia, Y.
Lin and C. Leon, “Validation of ITS2 Region as a Novel
DNA Barcode for Identifying Medicinal Plant Species,”
PLoS One, Vol. 5, 2010, p. e8613.
doi:10.1371/journal.pone.0008613
[8] H. Yao, J. Song, C. Liu, K. Luo, J. Han, Y. Li, X. Pang,
H. Xu, Y. Zhu, P. Xiao and S. Chen, “Use of ITS2 Re-
gion as the Universal DNA Barcode for Plants and Ani-
mals,” PLoS One, Vol. 5, No. 10, 2010, p. e13102.
doi:10.1371/journal.pone.0013102
[9] E. M. Soininen, A. Valentini, E. Coissac, C. Miquel, L.
Gielly, C. Brochmann, A. K. Brysting, J. H Sonstebo, R.
A. Ims , N. G. Yoc co z an d P. Taberlet, “Analyzing Diet of
Small Herbivores: The Efficiency of DNA Barcoding
Coupled with High-Throughput Pyrosequencing for De-
ciphering the Composition of Complex Plant Mixtures,”
Frontier in Zoology, Vol. 6, 2009, p. 16.
doi:10.1186/1742-9994-6-16
[10] M. Stech, E. Kolvoort, M. J. J. E Loonen, K. Verieling
and J. D. Kruijer, “Bryophyte DNA Sequences from Fae-
ces of an Arctic Herbivore, Barnacle Goose (Branta leu-
copsis),” Molecular Ecology Resources, Vol. 11, No. 2,
2011, pp. 404-408.
doi:10.1111/j.1755-0998.2010.02938.x
[11] K. M. Evans, A. H. Wortley and D. G. Mann, “An As-
sessment of Potential Diatom ‘Barcode’ Genes (cox1,
rbcL, 18S and ITS rDNA) and Their Effectiveness in De-
termining Relationships in Sellaphora (Bacillariophyta),”
Protist, Vol. 158, No. 3, 2007, pp. 349-364.
doi:10.1016/j.protis.2007.04.001
[12] P. D. Hebert, S. Ratnasingham and J. R. deWaard, “Bar-
coding Animal Life: Cytochrome c Oxidase Subunit 1
Divergences among Closely Related Species,” Proceed-
ings of the Royal Society B: Biological Sciences, Vol. 270,
2003, pp. 95-99.
[13] M. Hajibabaei, G. A. C. Singer, P. D. N. Hebert and D. A.
Hickey, “DNA Barcoding: How It Complements Tax-
onomy, Molecular Phylogenetics and Population Genet-
ics,” Trends in Genetics, Vol. 23, No. 4, 2007, pp. 167-
172. doi:10.1016/j.tig.2007.02.001
[14] R. S. Cowan, M. W. Chase, W. J. Kress and V. Savolai-
nen, “300,000 Species to Identify: Problems, Progress,
and Prospects in DNA Barcoding of Land Plants,” Taxon,
Vol. 55, No. 3, 2006, pp. 611-616.
doi:10.2307/25065638
[15] A. J. Fazekas, K. S. Burgess, P. R. Kesanakurti, S. W.
Graham and S. G. Newmaster, “Multiple Multilocus

DNA Barcoding of Ricinus communis from Different Geographical Origin by Using Chloroplast matK
and Internal Transcribed Spacers
1310
DNA Barcodes from the Plastid Genome Discriminate
Plant Species Equally Well,” PLoS One, Vol. 3, No. 7,
2008, p. e2802. doi:10.1371/journal.pone.0002802
[16] D. A. Eisenbarth and A. R. Weig, “Dynamics of Aquapo-
rins and Water Relations during Hypocotyl Elongation in
Ricinus communis L. Seedlings,” Journal of Experimental
Botany, Vol. 56, No. 417, 2005, pp. 1831-1842.
doi:10.1093/jxb/eri173
[17] F. Sanger, S. Nicklen and A. R. Coulson, “DNA Se-
quencing with Chain-Terminating Inhibitors,” Proceed-
ings of the National Academy of Sciences of the USA, Vol.
74, 1977, pp. 5463-5467. doi:10.1073/pnas.74.12.5463
[18] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei
and S. Kumar, “MEGA5: Molecular Evolutionary Genet-
ics Analysis Using Maximum Likelihood, Evolutionary
Distance, and Maximum Parsimony Methods,” Molecular
Biology and Evolution, Vol. 28, No. 10, 2011, pp. 2731-
2739. doi:10.1093/molbev/msr121
[19] P. M. Hollingsworth, S. W. Graham and D. P. Little,
“Choosing and Using a Plant DNA Barcode,” PLoS One,
Vol. 6, No. 5, 2011, p. e19254.
doi:10.1371/journal.pone.0019254
[20] M. W. Chase, N. Salamin, M. Wilkinson, J. M. Dunwell,
R. P. Kesanakurthi, N. Haidar and V. Savolainen, “Land
Plants and DNA Barcodes: Short-Term and Long-Term
Goals,” Philosophical Transactions of the Royal Society
B: Biological Sciences, Vol. 360, 2005, pp. 1889-1895.
doi:10.1098/rstb.2005.1720
[21] J. Schultz, S. Maisel, D. Gerlach, T. Müller and M. Wolf,
“A Common Core of Secondary Structure of the Internal
Transcribed Spacer 2 (ITS2) throughout the Eukaryota,”
RNA, Vol. 11, 2005, pp. 361-364.
doi:10.1261/rna.7204505
[22] M. Miao, A. Warren, W. B. Song, S. Wang and H. M.
Shang, “Analysis of the Internal Transcribed Spacer 2
(ITS2) Region of Scuticociliates and Related Accessions
(Ciliophora, Oligohymenophorea) to Infer Their Evolu-
tion and Phylogeny,” Protist, Vol. 159, No. 4, 2008, pp.
519-533. doi:10.1016/j.protis.2008.05.002
[23] P. B. Pelser, B. Nordenstam, J. W. Kadereit and L. E.
Watson, “An ITS Phylogeny of Tribe Senecioneae (As-
teraceae) and a New Delimitation of Senecio L.,” Taxon,
Vol. 5694, 2007, pp. 1062-1077.
[24] S. Chodon, D. P. Little, D. W. Stevenson and C. D.
Specht, “DNA Barcoding in the Cycadales: Testing the
Potential of Proposed Barcoding Markers for Species
Identification of Cycads,” PLoS One, Vol. 11, 2007, p.
e1154.
[25] A. W. Coleman, “Pan-Eukaryote ITS2 Homologies Re-
vealed by RNA Secondary Structure,” Nucleic Acid Re-
search, Vol. 35, No. 10, 2007, pp. 3322-3329.
doi:10.1093/nar/gkm233
[26] F. W. Li, L. Y. Kuo, C. J. Rothfels, A. Ebihara, W. L.
Chiou, M. D. Windham and K. M. Pryer, “rbcL and matK
Earn Two Thumbs Up as the Core DNA Barcode for
Ferns,” PLoS One, Vol. 6, No. 10, 2011, p. e26597.
doi:10.1371/journal.pone.0026597
[27] H. Fushimi, K. Komatsu, T. Namba and M. Isobe, “Ge-
netic Heterogeneity of Ribosomal RNA Gene and matK
Gene in Panax Notoginseng,” Planta Medica, Vol. 66, N o .
7, 2000, pp. 659-661. doi:10.1055/s-2000-8636
[28] Y. Zhang, J. C. Zhang, M. H. Huang, M. S. Yang and H.
Cao, “Detection of Genetic Homogeneity of Panax Noto-
ginseng Cultivars by Sequencing Nuclear 18S rRNA and
Plastid matK Genes,” Planta Medica, Vol. 72, 2006, pp.
860-862. doi:10.1055/s-2006-946685