American Journal of Plant Sciences, 2012, 3, 1294-1303
http://dx.doi.org/10.4236/ajps.2012.39156 Published Online September 2012 (http://www.SciRP.org/journal/ajps)
Assessment of Genetic Diversity of Moroccan Cultivated
Almond (Prunus dulcis Mill. DA Webb) in Its Area of
Extreme Diffusion, Using Nuclear Microsatellites
Abdelali Elhamzaoui1,2, Ahmed Oukabli1, Jamal Charafi1, Mohiéddine Moumni2
1Research Unit of Plant Breeding and Genetic Resources, Regional Agricultural Research Centre of Meknes, National Agronomic
Research Institute, Meknes, Morocco; 2Moulay Ismaïl University, Faculty of Science, Department of Biology, Zitoune, Meknès,
Morocco.
Received May 8th, 2012; revised June 5th, 2012; accepted June 18th, 2012
ABSTRACT
Assessment of genetic diversity of Moroccan cultivated almond (Prunus dulcis Mill.) grown from seed and cultivated at
four eco-geographical regions was performed using 16 nuclear SSRs. 238 alleles were detected with an average of
14.88 alleles per locus, ranging from 4 (locus BPPCT027) to 24 (locus CPSCT018). The size of alleles ranged from 84
bp (locus UDP96-003) to 253 bp (locus UDP96-018). A high genetic diversity of the local almonds is apparent and
structured into three major clusters (Oasis cluster, High and Anti Atlas cluster, and Middle Atlas cluster). Compared to
the Mediterranean genetic pools, from the East to West, the genetic diversity tends to be limited in Morocco which is
the area of its extreme diffusion.
Keywords: Almond; Genetic Diversity; Polymorphism; Spatial Genetic Structure; Prunus dulcis; Microsatellites; SSR
1. Introduction
The almond [Prunus dulcis (Miller) DA Webb, syn.
Prunusamygdalus Batsch] is a widely grown fruit tree
that is commercially important th rougho ut the world . It is
native to mountainous regions of Central Asia [1,2] and
is probably the oldest domesticated fruit tree in the third
millennium BC [3]. The almond tree was spread from its
origin through the Mediterranean by the Phoenicians,
Greeks and Romans in three main dispersion routes: the
north route, the southern route and the route through the
seas [4,5].
The cultivated almond tree was introduced in the Me-
diterranean region during the second millennium BC [6,7]
with a broad exchange of almond in the fourth century
BC [8]. It led to the differentiation between two groups,
the Mediterranean species and species of Central Asia [2].
It evolved slowly by seeding to the nineteenth century [1]
and its culture, in the region, is often associated with
seedling populations with selection of local varieties in
some countries [9]. This mode of propagation by seed-
ing generated a great variability in local genotypes.
Therefore, the Mediterranean region is regarded as a se-
cond source of domestication of the almond [5,10,11].
Morocco is an area of extreme diffusion of the almond
tree. It was cultured by the Carthaginians in the fourth
century [12] as well as by the Arabs in the sixth century
[10]. Almond culture is currently about 146,000 ha [13]
of which less than half (about 4 to 5 million trees) con-
sists of populations grown from seed, localized mainly in
the south [14]. This sexual propagation has led to high
genetic diversity and the country is now considered as a
secondary center of almond diversity [15]. Several works
on collection and morphological characterization were
performed on these populations [16-19]. This traditional
plant material, resulting from many centuries of adapta-
tion, may provide a basis for an almond breeding pro-
gram. A collection that grouped individuals from differ-
ent regions of Morocco was installed at the experimental
field of INRA in Aïn Taoujdate [19] for evaluation ef-
forts. This collection possesses a genetic basis necessary
for any breeding program. Genetic characterization of
plant material is necessary for the id entification of poten-
tial genitors and their value in a breeding program. For
the optimization of crossing schemes, the molecular
characterization of this plant material is essential.
Morphological characters were used in phenotyp ic ob-
servations to characterize the genetic div ersity of almond
species, but their interactions with the environment and
the small number of characters [20-22] prompted the use
of other more discriminating techniques. Currently, DNA
markers are widely used in studies of genetic diversity

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites 1295
and the clarification of certain research questions, among
others, those concerning their genetic origin [9]. These
tools have evolved over time and the initial studies were
based on isozymes [23-28], RFLP [28], RAPD [29-34],
ISSR and AFLP [32,33]. The relatively recent use of
microsatellites (simple sequence repeat: SSR) in the cha-
racterization of Prunus species and other perennial fruit
species showed their power of discrimination [9,35-40].
These tools have proven well suited for a wide genetic
characterization [41]. They are multi-allelic, co -dominant
and highly repeatable and are therefore particularly suit-
able for phylogenetic studies because of their high poly-
morphism and abundance [42].
The objective of this work concerns the characteriza-
tion of genetic variation, using nuclear SSRs, of Moroc-
can almond plants, quantification of allelic richness, the
study of its genetic structure in Morocco and the selec-
tion of microsatellite markers develop ed recently adapted
to the characterization of th is plant material.
2. Material and Methods
2.1. Plant Material
Collection of plant materials, the object of the present
work, consisted of 127 accessions (Table 1) of almond
[Prunus dulcis (Miller) DA Webb, syn. Prunusamygda-
lus Batsch] from different regions of Morocco (Figure 1).
The areas sampledare grouped into four broad geogra-
phic regions (Figure 1, Table 1) based on climatic con-
ditions, including altitude and type of climate.
2.2. Methods
2.2.1. DNA Extracti on
DNA was extracted from young leaves harvested after
flowering, following the method described by [43]. The
leaves (30 mg) were ground manually with mortar and
extracted with Cetyl-Trimethyl Ammonium Bromide
(CTAB) hot extraction buffer [100 mM Tris-HCl, pH 8.0,
1.4 M NaCl, 20 mM EDTA, 2% CTAB, 4% (w/v) PVP
(polyvinyl pyrrolidone), 10 mM β-mercaptoethanol and
sodium bisulfite (NaHSO3)]. The mixture was incubated
at 65˚C for 1 h, then mixed with 500 µl of chloroform/
isoamyl alcohol (24:1) and centrifuged at 13,000 rpm for
15 min. The supernatant was recovered and mixed with
2/3 volume of isopropanol at room temperature (30 min).
The resulting pellet was washed in 1 ml of ethanol (76%),
dried and then suspended in 100 µl of TE buffer [10 mM
Tris-HCl, pH 8.0, and 1 mM EDTA, pH 8.0]. The DNA
was quantified by spectro p hotometer and stored at 4˚C.
Table 1. Plant material collection grouped according to the geographical origin.
Regions (population) Main areas sampled Number of accessions collected Accession No.
Oasis Errachidia, Sakkoura, Draâ, Tiliwine, Ghris,
Goulmima, Tinghir, KelaâtMaggouna et Ouarzazate 72 from 1 to 72
High Atlas Imi-N-Tanoute, Aït Ourir et Asni 26 from 73 to 98
Middle Atlas Azilal 10 from 99 to 108
Anti Atlas Tafraout 9 from 109 to 117
Genotypes to local names 10 from 118 to 127
Figure 1. Location map of geographic regions sampled.

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites
1296
2.2.2. PCR Am pl i fi cation and Electroph o resi s
The extracted DNA was amplified by PCR. The sixteen-
pairs of primers flanking SSR sequences used in this
work were cloned and sequenced in peach [44-48]. The
multiplex PCR reactions were carried out with the Type I
Microsatellite PCR Kit® (Qiagen) in a final volume of
10 µl, containing 1× of Qiagen Master Mix, 2 µM of
each primer and 2 ng/µl of template DNA. The PCR pro-
gram included: an initial denaturation at 95˚C for 5 min,
35 cycles of 30 sec at 95˚C, 1 min at the annealing tem-
perature and 1 min 72˚C, followed by a terminal phase of
7 min at 72˚C. PCR reactions were carried out in an Ep-
pendrof Mastercycler Gradient thermocycler. Samples
were prepared by 3 µl diluted PCR products to 14.803 µl
formamide and 0.197 GeneScan™ 500 LIZ®Size Stan-
dard (Applied Biosystems, USA). The PCR products
were detected by ABI 3130 XL 16-capillary sequencer
(ABI Prism Applied Biosystems, Foster City, CA, USA).
2.2.3. Data Analysi s
Reading the sizes of alleles (bp) was accomplished using
Gene Mapper 4.0 software (Applied Biosystems). The
number of alleles per locus (Na), observed heterozygos-
ity (Ho) and expected heterozygosity (He) were calcu-
lated using the Genetix 4.03 software [49]. The level of
polymorphism was estimated by calculating the polymor-
phism information content (PIC) described by [50] and
modified by [51] using the formula 2
i
PIC 1p

,
where pi is the frequency of the ith allele, by the powerof
discrimination (PD, [52]), according to the formula
above, for which the allele frequency was replaced by the
frequency of the genotype and the probability of identity
(, where pi and pj are the

2
2
i
PI1p2p p 


ij
frequency of the ith and jth alleles, respectively)for
which two individuals sharing the same genetic profile
by chance [53], calculated using the identity 4.0 [54].
Genetic differentiation was assessed by calculation of
Wright’s fixation index (Fis) according to [55] and Fst
values between each pair of populations using the Gene-
pop 4.1 software [56]. The genetic relationships among
genotypes based on the similarity matrix using the pro-
portions of alleles [57] were studied. A dendrogram was
prepared based on the unweighted pair group method
with arithmetic averages (UPGMA) using the Ntsys-pc
2.02i program [58] (Rholf, 1998). A factorial correspon-
dence analysis (FCA) was carried out also in our work
using Ge netix 4.03 so ft w are [49].
3. Results
The use of 16 SSR loci in the almond trees revealed a
total of 238 different alleles, ranging from 4 to 24 alleles
per locus. The average number of alleles per locus was
14.88. The size of these alleles varied from 84bp to 253
bp. The observed heterozygosity (Ho) varied between
0.045 (Locus BPPCT027) and 0.916 (Locus CPSCT018)
with an average of 0.596. The expected heterozygosity
(He) ranged from 0.043 (Locus BPPCT027) to 0.884
(Locus CPSCT018) with an average of 0.699. The calcu -
lated values of the probability of identity (PI) and the
power of discrimination (PD) showed that the locus
CPSCT018 is the most informative with values of 0.012
and 0.979, respectively. This locus has the highest value
of polymorphism information content PIC (0.921) rela-
tive to other loci. Thus, the least informative locus is
BPPCT027 with (PI = 0.817, PD = 0.162 and PIC =
0.098). The averages of PI, PD and PIC for all loci were,
respectively, 0.119, 0.868 and 0.763 (Table 2).
The comparison of almonds belonging to 4 majo r geo-
graphic regions showed that the number of alleles ob-
served differ from one geographic area to another. The
almond trees in the oasis region is characterized by the
highest number of alleles (192 alleles) while the lowest
number characterized almond trees native to the Anti-
Atlas. Thus, the number of alleles per locus (NA) accord-
ing to geographical origin, follows the same order with
the highest value obtained at the oasis (NA = 12) and the
smallest value in the Anti Atlas (NA = 5.38). The ob-
served heterozygosity (Table 3) is similar in all four geo-
graphic areas studied (Ho = 0.600).
The comparison of pairwise Fst values of populations
shows that th e values vary b etween 0.00726 and 0 .04354
(Table 4). Genetic distances are low for the almond trees
that come from three geographic regions of the Atlas
(High, Middle and Anti Atlas). Fst values of these are not
significant. However, the difference is significant be-
tween the Oasis almonds and those of the Atlas. The
dendrogram was constructed using the UPGMA method
and is based on similarity data of 127 genotypes, reveal-
ing the existence of a very significant level of genetic
diversity among genotypes. Thus, positioning arbitrarily
at a level of 27% similarity, three homogeneous groups
are distinguished (Figure 2). The first group consists of
accessions from the region of the Oasis and most of the
accessions of the Middle Atlas, the second group is com-
posed mainly of those from the regions of High and Anti
Atlas and the third group includes, in addition to geno-
types to local names, a mixture of genotypes from re-
gions of the Oasis and High Atlas. A more advanced
structure was obtained by three-dimensional factorial
correspondence analysis (FCA). The three axes explain,
respectively, 48.49%, 32.22% and 19.29% of the vari-
ance and allow the distinction of three homogeneous
clusters (Figure 3). Cluster A contains mostly the acces-
sions of Oasis, cluster B consists of genotypes of High
and Anti Atlas and the last cluster C is composed only of

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites 1297
Table 2. Observed alleles and diversity parameters obtained with the 16 SSR loci among almond genotypes.
Locus Reference Motif Sequence (5' - 3') NSize (bp)Ho He PI PDPIC
BPPCT001 Dirlewanger
et al. (2002) (GA)27 AATTCCCAAAGGATGTGTATGAG 20122 - 1630.227 0.825 0.035 0.8980.858
CGAAACCGAGTAAGTGGAC
BPPCT007 Dirlewanger
et al. (2002) (AG)22(CG)2(AG)4 TCATTGCTCGTCATCAGC 15130 - 1640.810 0.818 0.024 0.9680.882
ATGGCGATTGAAGTCTTTAGAC
BPPCT017 Dirlewanger
et al. (2002) (GA)28 TTAAGAGTTTGTGATGGGAACC 12138 - 1770.788 0.789 0.031 0.9590.870
CGAACCAATACGATTTAATACGAA
BPPCT025 Dirlewanger
et al. (2002) (GA)29 TCCTGCGTAGAAGAAGGTAGC 19156 - 1950.729 0.802 0.034 0.9630.843
CGGTAAACCTGTAAATACAGC
BPPCT027 Dirlewanger
et al. (2002) (GA)11 CTCTCAAGCATCATGGGC 4238 - 2480.045 0.043 0.817 0.1620.098
CTATAATGTTGGCCCGTTGT
BPPCT036 Dirlewanger
et al. (2002) (AG)11 AAGCAAAGTCCATAAAAAACGC 5244 - 2520.238 0.391 0.291 0.6550.509
TTACCTCGCAGAAGCGGA
CPSCT018 Aranzana
et al. (2002) (GAA)2(GA)8 AGGACATGTGGTCCAACCTC 24130 - 1830.916 0.884 0.012 0.9790.921
TACTTTCATTGCCCCTTGGG
CPDCT045 Aranzana
et al. (2002) (GA)21 TGGGATCAAGAAAGAGAACCA 16143 - 1890.459 0.805 0.023 0.9440.888
TTTGTACACGTTCGTGTGGA
pchgms1 Sosinski
et al. (2000) (AC)12(AT)6 GGGTAAATATGCCCATTGTGCAATC17183 - 2290.630 0.790 0.029 0.9620.873
CTCCTAACTGCATCAAGTTACTAGG
pchgms3 Sosinski
et al. (2000) (CT)14 ACGGTATGTCCGTACACTCTC CATG18173 - 2190.774 0.797 0.051 0.9420.822
CAAATTATCCTCGTTAGTGTCCAAC
UDP96-001 Cipriani
et al. (1999) (CA)17 AGTTTGATTTTCTGATGCATCC 8100 - 1240.535 0.547 0.176 0.8910.652
GTTATGGCCAGGAATACCGT
UDP96-018 Cipriani
et al. (1999) (AC)21 TTCTAAT CTGGG CTATGGCG 7230 - 2530.460 0.469 0.237 0.7540.573
GGGACAGCATTTACACTTGAAG
UDP96-003 Cipriani
et al. (1999) (CT)11(CA)28 TTGCTCAAAAGTGTCGTTGC 1784 - 1290.809 0.811 0.038 0.9590.847
CGGTCACAACGTGATGCACA
UDP97-401 Cipriani
et al. (1999) (GA)19 TAAGAGGATCATTTTTGCCTTG 20106 - 1530.759 0.797 0.023 0.9680.884
TGGGAGTCAGGAGGTCCC
UDP98-408 Testolin
et al. (2000) (CT)14 ACAGGCTTGTTGAGCATGTG 1891 - 1370.836 0.832 0.031 0.9640.867
AGTTTAAAAGGGTGCTCCC
UDP98-409 Testolin
et al. (2000) (AG)19 GCTGATGGGTTTT AT GGTTTTC 18119 - 1730.521 0.791 0.048 0.9260.827
ACAACTATCTCCTATTCTCAGGC
N: number of alleles, Ho: observed heterozygosity, He: expected heterozygosity, PI: probability of identity, PD: power of discrimination, PIC: polymorphism
informat i o n content.

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites
1298
Table 3. Genetic diversity in the geographical areas.
Population Genotypes N NA Ho He Fis
Oasis 72 192 12.00 0.597 0.742 0.180
High Atlas 26 136 08.50 0.599 0.711 0.174
Middle Atlas 10 107 06.69 0.598 0.683 0.169
Anti Atlas 09 086 05.38 0.590 0.661 0.167
N: total number of alleles detected in each zone, NA: average number of alleles per locus, Ho: observed heterozygosity, He: expected heterozygosity, Fis: fixa-
tion index in tra-popul ation.
Table 4. Fst pairwise values between different geographical origins.
Pop Oasis High Atlas Middle Atlas
High Atlas 0.03899**
Middle Atlas 0.03843* 0.03239ns
Anti Atlas 0.04354** 0.00726ns 0.03823ns
ns: non-si gnificant; *P < 0.05; **P < 0.001.
genotypes from the Middle Atlas.
4. Discussion
The present work is the first study which characterizes
the diversity of almond grown in Morocco using mi-
crosatellite markers as molecular tools. The plant mate-
rial analyzed comes from seedlings carrying no specific
name but it is known locally, by farmers, under the
“Louzbeldi” name. Farmers continue to maintain these
almond accessions and to further exploit the germplasm
by traditional planting of seedlings to establish new or-
chards.
The SSR loci used in this study were selected, from a
set of primer pairs developed in peach, on the basis of
their rate of allelic polymorphism [44-48]. The results
obtained in our study are consistent with Sosinski et al.
[45] and Xie et al. [59] data, which confirmed the inter-
specific usefulness of microsatellite markers in Prunus
species. The three genetic parameters (PI, PD and PIC)
have shown therefore that all SSR loci may be recom-
mended for future studies of genetic diversity of almond
except BPPCT027locus, which is not very discriminat-
ing.
The number of alleles obtained for each locus is high
in general but with differences between sub-populations
located in the regions. The differences in the number of
alleles detected in the oasis population (192 alleles) and
that of the Anti-Atlas (86 alleles) could be due to the
number of genotypes analyzed at each site. The level of
genetic diversity is quite importan t because of traditional
multiplication mode (by seeds) for a crop formerly intro-
duced in Morocco [10,12]. A spatial genetic structure
appears to be demonstrated by the parameters of Fst.
This differentiation is most notable between the Oasis
genotypeson the one hand and the provenances from the
High Atlas, Middle Atlas and Anti Atlas on the other
hand. These latter are genetically similar and Fst values
are not significant (Table 4).
The three homogeneous clusters, emerged by FCA,
maybe the cause of an exchange of plant material as
seeds between regions of High Atlas and those of Middle
and Anti Atlas which constitute a geographical contin-
uum. This exchange seems to be limited (or non-existent)
with the Oasis probably because of the remoteness and
geographical isolation of the Oasis zones.
By comparing the Moroccan population with other
genetic pools, since the center of origin of this species in
the east to west through the different distribution centers
around the Mediterranean, the average number of alleles
per locus (14.88) found at the national level is high. This
number is higher than that of the almond trees from Iran;
countries belonging to the center of origin of the species
since the values reported by Shiran et al. [37] and by
Kadkhodaei et al. [60] are 6.64 and 12.86, respectively.
For those authors who have characterized a small number
of known cultivars (39 and 53, respectively), the average
value of observed heterozygosity (0.50) and (0.54) re-
mains low compared to the Moroccan population. This
result is due to the bursting of the species diversity fol-
lowing to its old propagation by seeds and the self-in-
compatibility characterization of the almond compared to
the other Prunus species. These high values may also be
due to differences of SSR primer pairs used, the large
number of genotypes analyzed in our study and that any
work on pre-selected genotypes (case of works of Shiran
et al. [37] and Kadkhodaei et al. [60]) may limit the ge-
netic diversity.
The average value of the polymorphism information
content PIC (0.76), which provides an estimate of the

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites 1299
Figure 2. Genetic relationships among genotypes of Moroccan almonds. The dendrogram is based on the Dice similar ity coef-
ficient and UPGMA algorithm.

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites
1300
Figure 3. Factorial Correspondence Analysis (FCA) of 127 genotypes belonging to four geographic regions. The analysis al-
lows the distinction of three homogeneous c l usters A, B and C.
power of a marker in the discrimination taking into ac-
count not only the number of alleles at a locus but also
the frequency on these alleles, is sufficiently high and is
slightly low compared to the value (0.89) reported by
Kadkhodaei et al. [60]. For the average value of power of
discrimination PD (0.87), it is superior to that obtained
by Shiran et al. ([37]; 0.78) in the characterization of 39
almond cultivars with 18 primer pairs of which 8 are
similar to those used in our work. These high values of
PIC and PD can be explained by the fact that we selected
microsatellite markers specific presenting the highest
values of these parameters rather than in the previous
similar studies.
Compared to the Tunisiangene pools, genetic diversity
parameters (number of alleles per locus 15.9, Ho = 0.68,
PIC = 0.84 and PD = 0.84) reported by Gouta et al. [61]
are more important. This diversity is also higher in Spain
where Fernándezi Martí et al. [62] found a number of al-
leles per locus largest (17.21) and Ho = 0.72. The in-
crease in the diversification parameters of the almond
trees in these countries (Tunisia and Spain) is observed
compared to Morocco. This slight decrease in diversity
towards the West of the Mediterranean is co nsistent with
studies previously established on the species. Using the
RAPD method, Mir Ali and Nabulsi [63], found that ge-
netic diversity of Syrian almonds exceeds that found by
Bartolozzi et al. [31] who reported a low variability in
RAPD markers among California almond cultivars. In
the same direction, Martins et al. [32,33] found consi-
derable polymorphism in the Portuguese almond collec-
tion. Therefore, the genetic diversity of the almond trees
tends to be more restricted toward the Western Mediter-
ranean as compared to the East, as reported by Delplan-
cke et al. [5].
This work documented the existence of a wide diver-
sity of almond trees in different regions of Morocco as
revealed by SSRs, a powerful tool used to characterize
genetic diversity. This diversity provides a basis for a
national program of genetic improvement.
5. Acknowledgements
This study was made in the PRAD Project No. 10-06,
supported by “Centre d’Ecologie Fonctionnelle et Evo-
lutive”, UMR CEFE (Montpelier, France) and “Institut
National de la Recherche Agronomique Meknès”, INRA-
CRRMKS (Meknès, Maroc). DNA extraction was per-
formed in INRA and genotyping was done in “Service
Commun de Marqueurs Génétiques en Ecologie” of the
CEFE. We are very grateful to Mekaoui for his help dur-
ing sample collections and all members of the “Service
Commun de Marqueurs Génétiques en Ecologie” for
their technical assistance.
Authors would like to acknowledge the assistance of
Dr Craig Ledbetter (USA) and Dr Filali for their com-
ments on an earlier version of the manuscript.
REFERENCES
[1] C. Grasselly, “Origine et Evolution de l’Amandier
Cultivé,” CIHEAM-IAMZ, Options Méditerranéennes,
Vol. 32, 1976, pp. 45-49.
[2] R. Sociasi Company, “Fruit Tree Genetics at a Turning

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites 1301
Point: The Almond Example,” Theoretical and Applied
Genetics, Vol. 96, No. 5, 1998, pp. 588-601.
doi:10.1007/s001220050777
[3] P. Spiegel-Roy, “Domestication of Fruit Trees,” In: C.
Barigozzi, Ed., The Origin and Domestication of Culti-
vated Plants, Elsevier, Amsterdam, 1986, pp. 201-211.
[4] C. Grasselly and P. Crossa-Raynaud, “L’Amandier.
Techniques Agricoles et Productions Méditerranéennes,”
G. P. Maison Neuve et Larose, Paris, XII, 1980.
[5] M. Delplancke, “Histoire Evolutive de l’Amandier
Cultivé (Prunus dulcis) en Méditerranée: Regards Croisés
sur la Domestication, Dialogue Entre la Biologie et
l’Ethnobiologie, Biologie des Populations,” Université
Montpellier 2, Montpellier, 2011.
[6] N. I. Vavilov, “Wild Progenitors of the Fruit Trees of
Turkestan and the Caucasus and the Problem of the Ori-
gin of Fruit Trees,” Proceedings of the 9th International
Horticultural Congress, London, 1930, pp. 271-286.
[7] D. Zohary and M. Hopf, “Domestication of Plants in the
Old World,” Clarendon Press, Oxford, 1993.
[8] D. Cerdá, “Economía Antigua de Mallorca,” In: J.
Mascaró Pasarius, Ed., Historia de Mallorca, Vol. I,
Pasarius, Palma de Mallorca, Spain, 1973, pp. 417-448.
[9] M. Zeinalabedini, M. Khayam-Nekoui, V. Grigorian, T.
M. Gradziel and P. Martínez-Gómezd, “The Origin and
Dissemination of the Cultivated Almond as Determined
by Nuclear and Chloroplast SSR Marker Analysis,” Sci-
entia Horticulturae, Vol. 125, No. 4, 2010, pp. 593-601.
doi:10.1016/j.scienta.2010.05.007
[10] D. E. Kester, T. M. Gradziel and C. Grasselly, “Almonds
(Prunus),” In: J. N. Moore and H. J. Ballington, Eds.,
Genetic Resources of Temperate Fruit and Nut Crops,
International Society for Horticultural Science, The
Netherlands, 1991, pp. 701-758.
[11] A. J. Felipe,“Variedades de Almendro,” In: Integrum, Ed.,
El Almendro, Zaragoza, Spain, 2000, pp. 204-279.
[12] N. El-Khatib-Boujibar, “Le Maroc et Carthage,” Le
Mémorial du Maroc (I), Nord organizationEdition, 1983,
p. 140.
[13] DDFP, “Bilan Annuel des Rosacées Fruitières,” Direction
de Développement des Filières de Productions, Ministre
de l’Agriculture et de la Pêche Maritime, Maroc, 2011.
[14] A. Oukabli, A. Mamouni, M. Laghezali, A.Chahbar, A.
Mekkaoui, M. Lahlou and A. Bari, “Caractérisation de la
Diversité Genétique des Populations Locales d’Amandier
Cultivé [Prunus dulcis (Miller) D. A. Webb] au Maroc,”
Proceeding IV Journées Nationales de Biodiversité,
Tetouan, Maroc, 2008.
[15] N. I. Vavilov, “Studies on the Origin of Cultivated
Plants,” Leningrad, 1926, p. 248.
[16] G. Barbeau and A. Elbouami, “Les Hybrides Amandier x
Pêcher Naturels du sud Marocain,” Fruits, Vol. 35, No. 3,
1980, pp. 171-176.
[17] M. Laghezali, “L ’Amandier au Maroc,” Options Méditer-
ranéennes, Edition IAMZ, Vol. 85, No. 1, 1985, pp. 91-95.
[18] A. Lansari, A. F. Iezzoni and D. E. Kester, “Morphologi-
cal Variation within Collections of Moroccan Almond
Clones and Mediterranean and North American Culti-
vars,” Euphytica, Vol. 78, No. 1-2, 1994, pp. 27-41.
[19] A. Oukabli, “Almond Breeding in Morocco: A Chrono-
logical Perspective,” NUCIS FAO-CIHEAM, Vol. 15,
2011, pp. 4-7.
[20] K. Sorkheh, B. Shiran, T. M. Gradziel, B. K. Eppe rson, P.
Martínez-Gómez and E. Asadi, “Amplified Fragment
Length Polymorphism as a Tool for Molecular Charac-
terization of Almond Germplasm: Genetic Diversity
among Cultivated Genotypes and Related Wild Species of
Almond, and Its Relationships with Agronomic Traits,”
Euphytica, Vol. 156, No. 3, 2007, pp. 327-344.
doi:10.1007/s10681-007-9382-x
[21] K. Sorkheh, B. Shiran,V. Rouhi, E. Asadi, H. Jahanbazi,
H. Moradi, T. M. Gradziel and P. Martínez-Gómez,
“Phenotypic Diversity within Native Iranian Almond
Species and Their Breeding Potential,” Genetic Resources
and Crop Evolution, Vol. 56, No. 7, 2009, pp. 947-96.
doi:10.1007/s10722-009-9413-7
[22] M. Zeinalabedini, K. Majourhat, V. Grigorian, M. Torchi,
F. Dicenta, P. Martínez-Gómez, “Comparison of the Use
of Morphological, Protein and DNA Markers in the Ge-
netic Characterization of Iranian Wild Prunus Species,”
Scientia Horticulturae, Vol. 116, No. 1, 2008, pp. 80-88.
doi:10.1016/j.scienta.2007.10.022
[23] S. Arulsekar, D. E. Parfitt and D. E. Kester, “Comparison
of Isozyme Variability in Peach and Almond Cultivars,”
Journal of Heredity, Vol. 77, No. 4, 1986, pp. 272-274.
[24] R. Hauagge, D. E. Kester, S. Arulsekar, D. E. Parfitt and
L. Liu, “Isozyme Variation among California almond
Cultivars. II. Cultivar Characterization and Origins,”
Journal of the American Society for Horticultural Science,
Vol. 112, 1987, pp. 693-698.
[25] M. Cerezo, R. Sociasi Company and F. Vargas, “Identifi-
cation of almond Cultivars by Pollen Isoenzymes,” Jour-
nal of the American Society for Horticultural Science,
Vol. 114, 1989, pp. 164-169.
[26] J. F. Jackson and G. R. Clarke, “Gene Flow in an Almond
Orchard,” Theoretical and Applied Genetics, Vol. 82, No.
2, 1991, pp. 169-173. doi:10.1007/BF00226208
[27] P. Arús, C. Olarte, M. Romero and F. Vargas, “Linkage
Analysis of Ten Isozyme Genes in F1 Segregating Al-
mond Progenies,” Journal of the American Society for
Horticultural Science, Vol. 119, 1994, pp. 339-34.
[28] M. A. Viruel, R. Messeguer, M. C. de Vicente, J. Gar-
cia-Mas, P. Puigdomenech, F. J. Vargas and P. Arus, “A
Linkage Map with RFLP and Isozyme Markers for Al-
mond,” Theoretical and Applied Genetics, Vol. 91, No.
6-7, 1995, pp. 964-971. doi:10.1007/BF00223907
[29] P. Resta, M. G. Corona, G. Faniz za, M. Palasciano and A.
Godini, “Random Amplified DNA Polymorphisms in
Amygdaluscommunis L., A. Webbii Spach,” Acta Hor-
ticulturae, Vol. 470, 1997, pp. 82-90.
[30] T. Joobeur, M. A. Viruel, M. C. de Vicente, B. Jauregui, J.
Bellester, M. T. Dettori, I. Verde, M. J. Truco, R. Messe-
guer, J. Balester, R. Quarta, E. Dirlewanger and P. Arús,

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites
1302
“Construction of a Saturated Linkage Map for Prunus
Using an Almond × Peach F2 Progeny,” Theoretical and
Applied Genetics, Vol. 97, No. 7, 1998, pp. 1034-1041.
doi:10.1007/s001220050988
[31] F. Bartolozzi, M. L. Warburton, S. Arulsekar and T. M.
Gradziel, “Genetic Characterization and Relatedness
among California Almond Cultivars and Breeding Lines
Detected by Randomly Amplified Polymorphic DNA
(RAPD) Analysis,” Journal of the American Society for
Horticultural Science, Vol. 123, 1998, pp. 381-387.
[32] M. Martins, A. Farinha, E. Ferreira, V. Cordeiro, A.
Monteiro, R. Tenreiro and M. M. Oliveira, “Molecular
Analysis of the Genetic Variability of Portuguese Almond
Collections,” Acta Horticulturae, Vol. 546, 2001, pp.
449-452.
[33] M. Martins, R. Tenreiro and M. M. Oliveira, “Genetic
Relatedness of Portuguese Almond Cultivars Assessed by
RAPD and ISSR Markers,” Plant Cell Reports, Vol. 22,
No. 1, 2003, pp. 71-78. doi:10.1007/s00299-003-0659-9
[34] F. J. Ryan, C. A. Ledbetter, D. W. Ramming, D. Palm-
quist, D. E. Bell and S. J. Peterson, “Challenges in De-
veloping Molecular Markers for Almond (Prunus) and
Grape (Vitis Species),”Acta Horticulturae, Vol. 546,
2001, pp. 629-639.
[35] P. Martínez-Gómez, S. Arulsekar, D. Potter and T. M.
Gradziel, “Relationships among Peach, Almond and Re-
lated Species as Detected by Simple Sequence Repeat
Markers,” Journal of the American Society for Horticul-
tural Science, Vol. 128, 2003, pp. 667-671.
[36] B. Khadari, J. Charafi, A. Moukhli and M. Ater, “Sub-
stantial Genetic Diversity in Cultivated Moroccan Olive
Despite a Single Major Cultivar: A Paradoxical Situation
Evidenced by the Use of SSR Loci,” Tree Genetics &
Genomes, Vol. 4, No. 2, 2007, pp. 213-221.
doi:10.1007/s11295-007-0102-4
[37] B. Shiran, N. Amirbakhtiar, S. Kiani, Sh. Mohammadi, B.
E. Sayed-Tabatabaei and H. Moradi, “Molecular Charac-
terization and Genetic Relationship among Almond Cul-
tivars Assessed by RAPD and SSR Markers,” Scientia
Horticulturae, Vol. 111, No. 3, 2007, pp. 280-292.
doi:10.1016/j.scienta.2006.10.024
[38] A. Fathi, B. Ghareyazi, A. Haghnazari, M. R. Ghaffari, S.
M. Pirseyedi, S. Kadkhodaei, M. R. Naghavi and M.
Mardi, “Assessment of the Genetic Diversity of Almond
(Prunus dulcis) Using Microsatellite Markers and Mor-
phological Traits,” Iranian Journal of Biotechnology, Vol.
6, No. 2, 2008, pp. 98-106.
[39] H. Achtak, A. Oukabli, M. Ater, S. Santoni, F. Kjellberg
and B. Khadari, “Microsatellite Markers as Reliable
Tools for Fig Cultivar Identification,” Journal of the
American Society for Horticultural Science, Vol. 134,
2009, pp. 624-631.
[40] H. Achtak, M. Ater, A. Oukabli, S. Santoni, F. Kjellberg
and B. Khadar, “Traditional Agroecosystems as Conser-
vatories and Incubators of Cultivated Plant Varietal Di-
versity: The Case of Fig (Ficuscarica L.) in Morocco,”
BMC Plant Biology, Vol. 10, 2010, pp. 1471-2229.
doi:10.1186/1471-2229-10-28
[41] P. Martínez-Gómez, R. Sánchez-Pérez, F. Dicenta, W.
Howad, P. Arus and T. M. Gradziel, “Almonds,” In: C. R.
Kole, Ed., Genome Mapping and Molecular Breeding,
Fruits & Nuts, Springer, Heidelberg, Berlin, New York,
Tokyo, Vol. 4, 2007, pp. 229-242.
[42] P. K. Gupta, H. S. Balyan, P. C. Sharma and B. Ramesh,
“Microsatellites in Plants: A New Class of Molecular
Markers,” Current Science, Vol. 70, 1996, pp. 45-54.
[43] J. J. Doyle and J. L. Doyle, “A Rapid DNA Isolation
Procedure for Small Quantities of Fresh Leaf Tissue,”
Phytochemical Bulletin, Vol. 19, 1987, pp. 11-15.
[44] G. Cipriani, G. Lot, H. G. Huang, M. T. Marrazzo, E.
Peterlunger and R. Testolin, “AC/GT and AG/CT Mi-
crosatellite Repeats in Peach (Prunuspersica (L) Basch):
Isolation, Characterization and Cross-Species Amplifica-
tion in Prunus,” Theoretical and Applied Genetics, Vol.
99, No. 1-2, 1999, pp. 65-72.
doi:10.1007/s001220051209
[45] B. Sosinski, M. Gannavarapu, L. D. Hager, L. E. Beck, G.
J. King, C. D. Ryder, S. Rajapakse, W. V. Baird, R. E.
Ballard and A. G. Abbott, “Characterisation of Microsa-
tellite Markers in Peach [Prunuspersica (L.) Batsch],”
Theoretical and Applied Genetics, Vol. 101, No. 3, 2000,
pp. 421-428. doi:10.1007/s001220051499
[46] R. Testolin, T. Marrazo, G. Cipriani, R. Quarta, I. Verde,
T. Dettori, M. Pancaldi and S. Sansavini, “Microsatellite
DNA in Peach (Prunuspersica L. Batsch), and Its Use in
Fingerprinting and Testing the Genetic Origin of Culti-
vars,” Genome, Vol. 43, 2000, pp. 512-520.
[47] M. J. Aranzana, J. García-Mas, J. Carbóand P. Arús,
“Development and Variability Analysis of Microsatellite
Markers in Peach,” Plant Breeding, Vol. 121, No. 1, 2002,
pp. 87-92. doi:10.1046/j.1439-0523.2002.00656.x
[48] E. Dirlewanger, A. Crosson, P. Tavaud, M.J. Aranzana, C.
Poizat, A. Zanetto, P. Arus and L. Laigret, “Development
of Microsatellite Markers in Peach and Their Use in Ge-
netic Diversity Analysis in Peach and Sweet Cherry,”
Theoretical and Applied Genetics, Vol. 105, No. 1, 2002,
pp. 127-138. doi:10.1007/s00122-002-0867-7
[49] K. Belkhir, P. Borsa, L. Chikhi, N. Raufaste and F.
Bonhomme, “GENETIX 4.03, Logiciel sous Windows
TM pour la Génétique des Populations,” Laboratoire
Génome, Populations, Interactions CNRS UMR 5000,
Université de Montpellier II, Montpellier (France), 2004.
[50] D. Botstein, R. L. White, M. Skolnick and R. W. Davis,
“Construction of Genetic Linkage Map in Man Using Re-
striction Fragment Length Polymorphisms,” The Ameri-
can Journal of Human Genetics, Vol. 32, 1980, pp. 314-
331.
[51] J. A. Anderson, G. A. Churchill, J. E. Sutrique, S. D.
Tanksley and M. E. Sorrels, “Optimizing Parental Elec-
tion for Genetic Linkage Maps,” Genome, Vol. 36, No. 1,
1993, pp. 181-186. doi:10.1139/g93-024
[52] A. D. Kloosterman, B. Budowle and M. Daselaar,
“PCR-Amplification and Detection of the Human DIS80
VNTR Locus. Amplification Conditions, Population Ge-
netics and Application in Forensic Analysis,” Interna-
tional Journal of Legal Medicine, Vol. 105, No. 5, 1993,

Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in
Its Area of Extreme Diffusion, Using Nuclear Microsatellites
1303
pp. 257-264. doi:10.1007/BF01370382
[53] D. Paetkau, W. Calvert, I. Stirling and C. Strobeck, “Mi-
crosatellite Analysis of Population Structure in Canadian
Polar Bears,” Molecular Ecology, Vol. 4, No. 3, 1995, pp.
347-354. doi:10.1111/j.1365-294X.1995.tb00227.x
[54] H. W. Wagner and K. M. Sefc, “IDENTITY 4.0. Centre
for Applied Genetics,” University of Agricultural Sci-
ences, Vienna, 1999.
[55] B. S. Weir and C. C. Cockerham, “Estimating F-Statistics
for the Analysis of Population Structure,” Evolution, Vol.
38, No. 6, 1984, pp. 1358-1370. doi:10.2307/2408641
[56] F. Rousset, “Genepop’007: A Complete Reimplementa-
tion of the Genepop Software for Windows and Linux,”
Molecular Ecology Resources, Vol. 8, No. 1, 2008, pp.
103-106. doi:10.1111/j.1471-8286.2007.01931.x
[57] M. Nei and W. H. Li, “Mathematical Model for Studying
Genetic Variation in Terms of Restriction Endonucle-
ases,” Proceedings of the National Academy of Sciences
of the USA, Vol. 76, 1979, pp. 5269-5273.
doi:10.1073/pnas.76.10.5269
[58] F. J. Rohlf, “NTSYS-pc: Numerical Taxonomy and Mul-
tivariate Analysis System, Version 2.02i,” Exeter Soft-
ware, New York, 1998.
[59] H. Xie, Y. Sui, F. Chang, Y. Xu and R. Ma, “SSR Allelic
Variation in Almond (Prunus dulcis Mill.),” Theoretical
and Applied Genetics, Vol. 112, No. 2, 2006, pp. 366-372.
doi:10.1007/s00122-005-0138-5
[60] S. Kadkhodaei, M. Shahnazari, M. Khayyam Nekouei, M.
Ghasemi, H. Etminani, A. Imani and A. B. Ariff, “A
Comparative Study of Morphological and Molecular Di-
versity Analysis among Cultivated Almonds (Prunus dul-
cis),”Australian Journal of Crop Science, Vol. 5, No. 1,
2011, pp. 82-91.
[61] H. Gouta, E. Ksia, T. Buhner, M. A. Moreno, M. Zarrouk,
A. Mliki and Y. Gogorcena, “Assessment of Genetic Di-
versity and Relatedness among Tunisian Almond Germ-
plasm Using SSR Markers,” Hereditas, Vol. 147, No. 6,
2010, pp. 283-292.
doi:10.1111/j.1601-5223.2009.02147.x
[62] A. FernándeziMartí, J. M. Alonso, M. J. Espiau, Rubio-
Cabetas and R. Sociasi Company, “Genetic Diversity in
Spanish and Foreign Almond Germplasm Assessed by
Molecular Characterization with Simple Sequence Re-
peats,” Journal of the American Society for Horticultural
Science, Vol. 134, No. 5, 2009, pp. 535-542.
[63] N. MirAli and I. Nabulsi, “Genetic Diversity of Almond s
(Prunus dulcis) Using RAPD Technique,” Scientia Hor-
ticulturae, Vol. 98, 2003, pp. 461-471.