Advances in Microbiology, 2012, 2, 388-394
http://dx.doi.org/10.4236/aim.2012.23049 Published Online September 2012 (http://www.SciRP.org/journal/aim)
A Single Mutation in the Hepta-Peptide Active Site of
Aspergillus niger PhyA Phytase Leads to Myriad
Biochemical Changes
Abul H. J. Ullah*, Kandan Sethumadhavan, Stephanie Boone, Edward J. Mullaney
Southern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, New Orleans, USA
Received July 6, 2012; revised August 5, 2012; accepted August 13, 2012
ABSTRACT
The active site motif of proteins belonging to “Histidine Acid Phosphatase” (HAP) contains a hepta-peptide region,
RHGXRXP. A close comparison among fungal and yeast HAPs revealed the fourth residue of the hepta-peptide to be E
instead of A, which is the case with A. niger PhyA phytase. However, another phytase, PhyB, from the same microor-
ganism has a higher turnover number and it shows E in this position. We mutated A69 residue to E in the fungal PhyA
phytase. The mutant phytase shows a myriad of new kinetic properties. The pH profile shifted 0.5 pH unit in both 5.0
and 2.5 bi-hump peaks. The optimum temperature shifted down from 58˚C to 55˚C. However, the greatest difference
was observed in the mutant protein’s reaction to GuCl at a concentration of 0.1 to 0.2 M. The activity of the mutant
phytase jumped 100% while the wild type protein showed no activity enhancement in the same concentration range of
GuCl. The kinetics performed at higher concentration of GuCl also contrasted the difference between the wild type and
mutant phytase. While Km was least affected, the Vmax increased for the mutant and decreased for the wild type. The
sensitivity towards myo-inositol hexasulfate, a potent inhibitor, was decreased by the mutation. All in all, A69E muta-
tion has affected a multitude of enzymatic properties of the protein even though the residue was thought to be
non-critical for phytase’s catalytic function notwithstanding its location in the conserved hepta-peptide region of the
biocatalyst.
Keywords: Phytase; Histidine Acid Phosphatase; Aspergillus niger; Site-Directed Mutagenesis
1. Introduction
Aspergillus niger produces one of the most active phytate
degrading phosphomonoesterase (E.C.3.1.3.8) that hy-
drolyzes myo-inositol hexa-phosphate (phytic acid) at
acidic pH [1,2]. The enzyme was overexpressed by
cloning the phyA gene in the original host in early 1990s,
which led to the commercialization of the enzyme [3].
The recombinant phytase was marketed under the brand
name Natuphos™ to be used as a feed supplement in
plant-derived poultry and swine feed to degrade phytate
that are present in the soybean meal. Phytate is a known
antinutrient that binds minerals; therefore, when present
in high amounts, it robs the animals of divalent cations
[4].
One way to circumvent this problem is to add very
active phytase that could hydrolyze myo-inositol hexa-
phosphates in a stepwise fashion from hexa to penta to
tetra phosphate and so on to yield myo-inositol mono-
phosphate [5].
Of all the phytases reported, two microbial phytases
that had drawn the attention are PhyA phytase from
Aspergillus niger and AppA2 phytase from Escherichia
coli for their high catalytic efficiency [6,7]. Both of these
phytases belong to the ‘Histidine Acid Phosphatase’
(HAP) family of the acid phosphatase, which contains a
conserved hepta-peptide region in the active site with the
sequence RHGXRXP [8,9]. The fourth amino acid in the
hepta-peptide, which is represented by the letter X, is
seen to be extremely variable [8]. Both charged amino
acid such as D and E and amino acids with aliphatic side
chain such as A, V, L, and S could occupy this position.
Of particular interest to us were E, which was the case
with Aspergillus niger PhyB phytase that showed higher
turnover number [10]. In Saccharomyces cerevisiae both
acid phosphatase 3 (ACP3) and acid phosphatase 5
(ACP5), the sequence alignment had revealed E in this
spot. Therefore, we opined that E might have a role in
determining the higher catalytic turnover number in
microbial phosphomonoesterase. With this view, we
decided to mutate a single amino acid, viz., A to E to test
*Corresponding author.
C
opyright © 2012 SciRes. AiM

A. H. J. ULLAH ET AL. 389
out our hypothesis that a charged amino acid in this spot
in place of an aliphatic amino acid, A, might induce
chemical change(s) to effect higher catalytic efficiency.
However, the myriad changes affected by this single
mutation in the active site of Aspergillus niger PhyA
phytase were not expected. In this communication, we
report the biochemical characterization engendered by
mutation A69E. Both the optimum pH and optimum
temperature for activity was altered by the single muta-
tion. Also, catalytic activity in the mutant was boosted
100% when GuCl concentration was raised to 0.1 M. We
propose that the mutation has made the active site more
flexible to allow the substrate to enter and the product to
exit facilely. The fact that Km did not change while Vmax
was increased in the mutant is indicative of a new
chemical environment engendered by the side chain of
negatively charged amino acid, glutamic acid, which
replaced alanine, an amino acid with aliphatic side chain.
2. Materials and Methods
2.1. Strains, Growth Media, and Conditions
E. coli DH5α cells were used for plasmid construction
and were cultured at 37˚C in Luria Broth (LB) media.
Pichia pastoris strain X33 was obtained from Invitrogen
(Carlsbad, CA) grown at 30˚C as previously described
[11]. The antibiotic zeocin (Invitrogen, Carlsbad, CA)
was added at 100 μg·ml–1 to yeast extract peptone-dex-
trose (YPD) media for yeast, and at 25 μg·mL–1 to LB for
E. coli. The wild type PhyA gene was cloned and ex-
pressed in Pichia pastoris strain X33 as described earlier
[7].
2.2. DNA Sequencing
To confirm the mutation DNA sequencing was per-
formed with the dye terminator cycle sequencing Quick
Start Kit (Beckman Coulter, Fullerton, CA) using a CEQ
8000 Genetic analysis System (Beckman Coulter).
2.3. Site-Directed Mutagenesis and Recombinant
Protein Expression
A PGAPZα vector containing the phyA gene [12] was
utilized to produce the mutant phytase. The Quick-
Change II Site-Directed Mutagenesis Kit (Stratagene, La
Jolla, CA) used two oligonucleotide primers with the
forward sequence 5’CTCTCCCGTCATGGAGAGCGG-
TATCCGACCGAC3’ and reverse sequence 5’GTC-
GGTCGGATACCGCTCTCCATGACGGGAGAG‘3 to
generate the desired mutation employing thermocycler
cycling parameters of 1 cycle 95˚C (30 sec.), 56˚C (1
min.), and 68˚C (6 min.). P. pastoris X33 was utilized to
express the mutant protein. The PGAPZα vector contain-
ing the phyA gene was linearized by the restriction
enzyme AVRII and transformed in Pichia cells by elec-
troporation using an ECM 630 Electro Cell Manipulator
(Centronics, Inc., BTX Instrument Division, San Diego,
CA). The transformed cells were plated on YPD plus
zeocin and sorbitol, then incubated at 30˚C for 3 days.
Single colony transformants were then transferred into
liquid YPD plates in presence of zeocin and incubated at
30˚C for 3 days and then assayed for phytase activity.
2.4. Purification of Wild Type and A69E Mutant
Phytase
The phytase gene (phyA) fro m Aspergillus niger was
cloned and overproduced in Pichia pastoris [7,13]. The
cultures were centrifuged in a Sorvall SLA-1500 rotor
for 30 min at 13,000 rpm and 4˚C to get the supernatant
for further purification. The recombinant PhyA enzyme
was purified using sequential ion-exchange column chro-
matographies first using MacroPrep™ S column, a cation
exchanger at pH 3.5 and then MacroPrep™ DEAE col-
umn, an anion exchanger, at pH 7.0. The specific activity
of the purified phytase was about 3000 nkat/mg when
assayed at 58˚C and pH 5.0 [14]. PhyA mutant, A69E
was also purified following the same purification
regimen. Briefly, the culture supernatant containing the
expressed enzyme was precipitated using 45% to 90%
ammonium sulfate. The enriched fraction was purified on
MacroPrep™ S (2.5 × 2 cm) at pH 3.5 and MacroPrep™ Q
(1.5 × 2.3 cm) column at pH 7.0. In a final step, 1 mL
UNOsphere™ S column at pH 3.5 was used to obtain the
purified enzyme. The specific activity was about 2400
nkat/mg when assayed at 55˚C and pH 5.5.
2.5. Phytase Assay
Phytase assays were carried out in 1.0 mL volume at
optimum temperatures (55˚C for A69E and 58˚C for
PhyA) in 25 mM Glycine or 25 mM sodium acetate
buffers [2]. The liberated inorganic ortho-phosphate was
quantitated spectrophotometrically by following the
method of Heinonen and Lahti [15] using a freshly
prepared acetone-molybdate-acid (AMA) reagent consi-
sting of 2 parts anhydrous acetone, 1 part 10 mM
ammonium molybdate, and 1 part 2.5 M sulfuric acid.
Adding 2.0 mL of AAM per assay tube terminated the
enzyme assay. After 30 sec, 100 L of citric acid (1.0 M)
was added to each tube to fix the color. Absorbance was
read at 355 nm after blanking the spectrophotometer with
the appropriate control. Phytase activity was expressed as
nkat/mL (nmoles ortho-phosphate released per sec). The
pH used for PhyA and A69E mutant were 5.0 and 5.5,
respectively, during kinetic experiments, unfolding ex-
periments, and myo-inositol hexasulfate inhibition ex-
periments.

A. H. J. ULLAH ET AL. 390
2.6. Phytase Activity at Various pH Range
An aliquot containing the phytases were incubated in a
water bath with the following buffers: 25 mM gly-
cine-HCl (pH 1.0 to 3.5), 50 mM acetate (pH 4.0 to 5.5),
and 50 mM imidazole (pH 6.0 to 8.0), and 50 mM
Tris-maleate (pH 9.0). Phytase activity was measured
after addition of 10 mM phytate as described before.
2.7. Temperature Optima
Similar to the previous experiment, the activity measure-
ments were conducted in a water bath from 22˚C to 70˚C.
2.8. Unfolding in Presence of GuCl
Experiments were conducted in presence of 0 to 1 M
GuCl and phytase activity was measured during unfold-
ing of the phytases. For Km measurements, an aliquot of
the PhyA wild type (WT) and the mutant phytase were
incubated with varying concentrations (0 to 750 µM) of
phytate in presence of 880 mM GuCl for PhyA and 250
mM GuCl for A69E.
2.9. Myo-Inositol Hexasulfate Inhibition
Similarly, phytases were incubated with 0 to 500 µM
myo-inositol hexasulfate, MIHS, and activity measure-
ments were made. For Km determination, PhyA phytase
was carried out in presence and absence of 30 µM MIHS
and 0 to 1000 µM phytate concentration. With A69E
mutant phytase, experiments were performed with 300
µM MIHS. The Ki for MIHS was calculated for both the
phytases.
2.10. Stability of Phytase at 4˚C
The pH of the culture supernatants after collection were
adjusted to 2.5, 3.5, 5.2, 7.2 and 8.5 with 2 N sodium
hydroxide or 4N hydrochloric acid in 10 mL glass tubes
with cap. The volume after adjusting the pH was held at
5.0 mL in all tubes. The tubes were kept at 4˚C for up to
20 days. Phytase activity was measured at 0, 2, 7, 12, and
20 days. The activity observed before adjusting pH of the
supernatant was taken as 100 per cent.
3. Results
3.1. Effect of A69E Mutation on pH Optima
The pH versus activity profile for both the WT and A69E
mutant phytase are shown in Figure 1.
The usual bi-hump curve for pH profile, which is so
characteristics for fungal PhyA phytase, was retained by
the mutant phytase. However, it is not identical to the
profile obtained for the WT phytase. First, the pH profile
has become narrower in the mutant phytase as evidenced
Figure 1. The pH versus activity profile of the WT and
A69E mutant phytase.
by the width of the peak. Second, the mutant protein
could still hydrolyze phytic acid at pH 7.0 whereas, the
WT phytase failed to catalyze the phosphomonoesterase
activity at the neutral pH. Third, the mutant phytase
could hydrolyze phytase at pH 2.0 as opposed to the WT
that ceases to catalyze hydrolysis of phytate at this pH.
Fourth, the mutant phytase had an additional minor peak
at pH 3.5 and two troughs at pH 3.0 and 4.0. Conversely,
the WT phytase has one trough at pH 3.5 (Figure 1).
3.2. Effect of A69E Mutation on Temperature
Optima
Temperature versus activity profile of A. niger phytase
was affected by A69E mutation. Both the WT and the
mutant phytase were assayed at various temperatures
starting from 20˚C to 70˚C. The profiles are shown in
Figure 2. The optimum temperature for WT phytase was
found to be 58˚C; however, the mutant phytase peaked at
55˚C. At 58˚C, the mutant phytase lost about 30%
activity as compared to the WT phytase. At 65˚C, the
WT phytase was completely inactivated whereas the
mutant phytase lost about 62% of the phytase activity.
Therefore, it appears that the mutation had enabled the
biocatalyst to resist thermal denaturation as compared to
the WT phytase.
3.3. Effect of A69E Mutation on Thermostability
Table 1 describes the results of the thermal studies
performed with both the WT and A69E mutant phytase.
The fungal PhyA phytase performs optimally at about
55˚C when the protein is expressed in Pichia pastoris.
The WT phytase loses activity progressively when
subjected to 5 minutes at 60˚C, 65˚C, and 70˚C. At 70˚C,
it lost about 63% activity as compared to losing about
11% at 60˚C. Conversely, the mutant did not lose any
activity at 60˚C and at the severest case of 70˚C, it lost
about 57% activity. A remarkable difference in thermal
stability was however exhibited at 65˚C. The WT lost

A. H. J. ULLAH ET AL. 391
Figure 2. The temperature versus activity profile of the WT
phytase at 58˚C and pH 5.0 and A69E mutant phytase at
55˚C and pH 5.5.
Table 1. Thermal stability of the WT and A69E mutant
phytase.
Phytase activity in percent after
exposure for 5 minute at
Phytase
0˚C 60˚C 65˚C 70˚C
WT 100* 89 42 37
A69E mutant 100** 102 76 43
*542 nkat/mL; **437 nkat/mL.
about 58% activity as compared to the A69E mutant,
which lost only 24%.
3.4. Effect of A69E Mutation on Protein
Unfolding in Response to GuCl
A differential response to increasing concentration of
protein denaturant, GuCl, was observed when both the
WT and A69E mutant phytase was subjected to the un-
folding reagent at the concentration rage of 0 to 1.0 M.
The results are shown in Figure 3. The WT phytase be-
haved similarly to the results published earlier [14] when
challenged with GuCl at its optimum pH, viz., at pH 5.0.
The enzyme activity was boosted 35% going from 0 to
0.55 M GuCl in a linear fashion and then the activity fell
to 0% at 1.0 M denaturant concentration. However, when
A69E mutant phytase was subjected to its optimum tem-
perature, pH and then challenged with increasing con-
centration of GuCl, the activity had risen sharply in an
exponential fashion with a final boost of 100% activity
going from 0 to 0.16 M of GuCl concentration. The ac-
tivity then fell 12% at 0.5 M denaturant concentration.
The activity of A69E mutant phytase remained at the
same level even at 1.0 GuCl. This dramatic resistance of
the mutant phytase to tolerate the denaturant concentra-
tion at 1.0 M level is the salient difference between the
WT phytase and the single mutation A69E.
3.5. Effect of A69E Mutation on Inhibition of
Activity by Myo-Inositol Hexasulfate
Myo-inositol hexasulfate (MIHS), a structural analog of
phytate, is a known inhibitor of fungal phytase [16]. Both
the WT and A69E mutant phytase was subjected to
varying concentrations of MIHS to assess whether the
single mutation has changed MIHS induced inhibition of
activity vis-à-vis the WT. The results are shown in Fig-
ure 4. Even though both phytases lost total activity at
500 μM concentration of MIHS, the mutant phytase
showed a greater resistance to inhibition by the substrate
analog. For example, while a 50% inhibition in PhyA
WT phytase was achieved at 25 μM, for A69E mutant
the same inhibition level was achieved at 375 μM of the
inhibitor. This was reflected in the Ki of the phytases for
MIHS. The mutant phytase exhibited 10 times higher Ki
for the substrate analog than the value obtained for the
wild type phytase.
3.6. Effect of A69E Mutation on Long Term
Stability at Different pH
Both the wild type and A69E mutant phytase was
unstable at pH 8.5 immediately after subjecting to the
buffer at the start time; however, the proteins were
Figure 3. The effect of GuCl on the WT phytase and A69E
mutant phytase.
Figure 4. Inhibitory effect of myo-inositol hexasulfate (MIH S)
on the activity of the WT phytase and A69E mutant phy-
tase.

A. H. J. ULLAH ET AL. 392
remarkably stable at pH 7.2 and below down to pH 2.5
(Figure 5 panel A and panel B). For WT phytase the
activity stayed the same up to 7 days and then lost 60%
activity on day 12. The activity declined further until day
20 when the experiment was terminated. The mutant
phytase retained activity slightly better going from day
12 to day 20. In summary, both WT and A69E mutant
phytase showed loss of activity in the pH range 2.5 to
7.2.
4. Discussion
From structural standpoint phytases belonging to HAP
class of acid phosphomonoesterase have been studied
exhaustively. The first reporting of any three-dimen-
sional structure in phytase took place over a decade ago
when PhyA phytase’s structure was elucidated [17]. This
was followed by several reporting of X-ray deduced
tertiary structure elucidation in other HAP phytases [18-
20]. These revelations of structures set the stage for
knowledge-based protein engineering via point mutations
in the active center of phytases [21-23].
In this communication, we presented evidences in
support of the conclusion that a single mutation in the
active site of PhyA phytase had affected a host of bio-
chemical properties such as pH optima, temperature
optima, kinetic parameters, reaction to GuCl and MIHS
(Table 2). This is very similar to the concept of “pleio-
tropic effect” in single gene mutation where the mutation
of a gene leads to a host of phenotypic changes. In the
case of A69E mutation in the fungal PhyA phytase, a
single substitution of amino acid the substitution has
caused a myriad of changes in both physicochemical and
catalytic properties in A. niger phytase.
The original amino acid in the hepta-peptide amino
acid region, where the active site resides, an A (alanine)
residue is located (10). We mutated A to E (glutamic acid)
to incorporate an extra negative charge in the active site
of the protein which is based on the observation that
PhyB phytase, which has higher turnover number than
the phyA phytase, had E residue in the identical position
[10]. The newly incorporated negative charge in the
active site of phytase will have an unintended conse-
quence vis-à-vis the accommodation of the substrate,
phytate, which has six negatively charged phosphate
group. The newly acquired negative charge in the active
site should repel phytate as compared to the WT phytase;
therefore, the Km is expected to rise in the mutant phytase.
That is what is being observed in Table 1. By the same
token, the Vmax should improve somewhat because the
negative charge brought on by E into the active site
should facilitate the release of negatively charged phos-
phate group. The turnover number increased 6.6% in the
mutant phytase over the wild type phytase (Table 1). The
substrate analog, MIHS, has six negatively charged
sulfate groups, which should not bind as efficiently in the
mutant phytases’ active site as compared to the wild
Figure 5. The long-term stability of the WT phytase (panel A) and A69E mutant phytase (panel B).
Table 2. Kinetic properties of A. niger WT and A69E phytase.
Properties WT phytase A69E phytase
Km (μM) 50 170
Specific activity at Vma x (ηkat/mg) 1950 2116
Turnover number (sec–1) 120 128
Kinetic efficiency (mol–1·sec–1) 2.3 × 106 0.74 × 106
Ki for MIHS (μM) 8 83

A. H. J. ULLAH ET AL. 393
type phytase’s active site. This has been confirmed by
the Ki values for MIHS in the mutant phytase. It took
over 10 times concentration of MIHS in the mutant
phytase to effect the same inhibition done by the wild
type phytase. Therefore, incorporation of a negatively
charged amino acid into the hepta-peptide active site
region of the phytase has decreased the affinity for not
only the substrate but also the inhibitor. In X-ray
crystallographic studies with HAP type phytases re-
searches have shown that sulphate groups of MIHS bind
to the substrate-binding domain that is in the active
center of protein [20,24].
Both the pH optima and temperature versus activity
profile had changed in the mutant phytase. The me-
chanism for such changes is difficult to explain due to
the lack of X-ray crystallographic data; nonetheless, the
charged amino acid, E, replacing the aliphatic amino acid
A may allow new hydrogen bonding sites in the active
site area. Also, the domain flexibility in the active center
of the protein possibly brought on by the charged amino
acid may explain these far-reaching effects on pH optima
and temperature optima profiles.
The native phytases belonging to HAP family of pho-
sphatases have already been unfolded using GuCl and
then refolded by the removal of denaturant by dialysis
[14,25]. However, a differential response has been ob-
served when the WT and A69E mutant phytases were
treated with varying concentrations of GuCl. Initially, the
activity was boosted 35% when GuCl concentration was
raised to 0.55 M. We explained this phenomenon of rise
in the Vmax in the light of domain flexibility brought on
by GuCl. However, in case of the mutant phytase, the
activity had risen in exponential manner in response to
GuCl at the concentration of 0.16 M. This is in sharp
contrast to the WT phytase’s reaction to increasing
concentration of GuCl. At higher concentration of the
denaturant, when WT phytase had lost over 75% of the
activity, the mutant phytase was holding onto the 100%
activity gain it achieved earlier due to addition of small
amounts of GuCl. One possible reason for such discre-
pancy on the part of the mutant phytase could be that the
altered structure containing the flexible domain was
resistant to chemical denaturation.
The long-term stability of both the WT and A69E
phytases in various buffers were observed; there were no
discernible difference between the two phytases under
the conditions. The fungal phytase was very susceptible
to catalytic demise when subjected to pH 8.5 in contrast
to acidic pH where the proteins remain stable for days.
The biochemical basis of the vulnerability of fungal
phytase in alkaline pH is not understood at this time.
In summary, a single mutation in the hepta-peptide
region that constitutes the active site resulted a myriad
of both chemical and catalytic changes, which could not
have been predicted. The results presented in these stud-
ies have indicated that in this class of proteins a know-
ledge-based approach to structural change may offer a
better choice than random mutagenesis through error
prone PCR technique [26,27].
5. Conclusion
The results of the present communication had clearly
demonstrated the power of chemical probing of the ac-
tive site by site-directed mutagenesis. By mutating the
fourth residue A to E in the hepta-peptide active site of A.
niger PhyA the mutant protein exhibited a myriad of new
physico-chemical properties. Not only the pH optimum
shifted 0.5 pH unit, the temperature optimum also shifted
from 58˚C to 55˚C. Furthermore, the catalytic activity of
the mutant phytase doubled as compared to the wild type
phytase when subjected to 0.1 to 0.2 M GuCl. A single
mutation in the active site affecting so many parameters
of a biocatalyst gives insight into the complexity of pro-
tein’s three-dimensional structure.
REFERENCES
[1] T. R. Shieh and J. H. Ware, “Survey of Microorganisms
for the Production of Extracellular Phytase,” Applied Mi-
crobiology, Vol. 16, No. 9, 1968, pp. 1348-1351.
http://aem.asm.org/content/16/9/1348.full.pdf
[2] A. H. J. Ullah and D. M. Gibson, “Extracellular Phytase
(E.C. 3.1.3.8) from Aspergillus ficuum NRRL 3135: Puri-
fication and Characterization,” Preparative Biochemistry,
Vol. 17, No. 1, 1987, pp. 63-91.
doi:10.1080/00327488708062477
[3] S. Haefner, A. Knietsch, E. Scholten, J. Braun, M. Lohs-
cheidt and O. Zelder, “Biotechnological Production and
Applications of Phytases,” Applied Microbiology and Bio-
technology, Vol. 68, No. 5, 2005, pp. 588-997.
doi:10.1007/s00253-005-0005-y
[4] R. J. Wodzinski and A. H. J. Ullah, “Phytase,” Advances
in Applied Microbiology, Vol. 42, 1996, pp. 263-302.
doi:10.1016/S0065-2164(08)70375-7
[5] A. H. J. Ullah and B. Q. Phillippy, “Immobilization of
Aspergillus ficuum Phytase: Product Characterization of the
Bioreactor,” Preparative Biochemistry, Vol. 18, No. 4,
1988, pp. 483-489. doi:10.1080/00327488808062546
[6] A. H. J. Ullah, K. Sethumadhavan and E. J. Mullaney,
“Salt Effect on the pH Profile and Kinetic Parameters of
Microbial Phytases,” Journal of Agricultural and Food
Chemistry, Vol. 56, No. 9, 2008, pp. 3398-3402.
doi:10.1021/jf073137i
[7] J. D. Weaver, A. H. J. Ullah, K. Sethumadhavan, E. J.
Mullaney and X. G. Lei, “Impact of Assay Conditions on
Activity Estimate and Kinetics Comparison of Aspergil-
lus niger PhyA and Escherichia coli AppA2 Phytases,”
Journal of Agricultural and Food Chemistry, Vol. 57, No.
12, 2009, pp. 5315-5320. doi:10.1021/jf900261n
[8] A. H. J. Ullah, B. J. Cummins and H. C. Dischinger, Jr.,

A. H. J. ULLAH ET AL. 394
“Cyclohexanedione Modification of Arginine at the Active
Site of Aspergillus ficuum Phytase,” Biochemical and Bio-
physical Research Communications, Vol. 178, No. 1, 1991,
pp. 45-53. doi:10.1016/0006-291X(91)91777-A
[9] R. L. Van Etten, R. Davidson, P. E. Stevis, H. MacArthur
and D. L. Moore, “Covalent Structure, Disulfide Bonding,
and Identification of Reactive Surface and Active Site
Residues of Human Prostatic Acid Phosphatase,” Journal
of Biological Chemistry, Vol. 266, No. 4, 1991, pp. 2313-
2319.
http://www.jbc.org/content/266/4/2313.full.pdf+html
[10] A. H. J. Ullah and H. C. Dischinger, Jr., “Identification of
Active Site Residues in Aspergillus ficuum Extracellular
pH 2.5 Optimum Acid Phosphatase,” Biochemical and Bio-
physical Research Communications, Vol. 192, No. 2, 1993,
pp. 754-759. doi:10.1006/bbrc.1993.1478
[11] W. Zhang, E. J. Mullaney and X. G. Lei, “Adopting Se-
lected Hydrogen Bonding and Ionic Interacttions from
Aspergillum fumigatus Phytase Structure Improves the
Thermostability of Aspergillus niger PhyA Phytase,” Ap-
plied and Environmental Microbiology, Vol. 73, No. 9,
2007, pp. 3069-3076. doi:10.1128/AEM.02970-06
[12] T. Kim, E. J. Mullaney, J. M. Porres, R. Roneker, S.
Crowe, S. Rice, T. Ko, A. H. J. Ullah, C. B. Daly, R.
Welch and X. G. Lei, “Shifting the pH Profile of Asper-
gillus niger PhyA Phytase to Match the Stomach pH En-
hances Its Effectiveness as an Animal Feed Additive,”
Applied and Environmental Microbiology, Vol. 72, No. 6,
2006, pp. 4397-4403. doi:10.1128/AEM.02612-05
[13] E. J. Mullaney, H. Locovare, K. Sethumadhavan, S.
Boone, X. G. Lei and A. H. J. Ullah, “Site-Directed
Mutagenesis of Disulfide Bridges in Aspergillus niger
NRRL 3135 Phytase (PhyA), Their Expression in Pichia
pastoris and Catalytic Characterization,” Applied Micro-
biology and Biotechnology, Vol. 87, No. 4, 2010, pp.
1367-1372. doi:10.1007/s00253-010-2542-2
[14] A. H. J. Ullah, K. Sethumadhavan and E. J. Mullaney,
“Monitoring of Unfolding and Refolding in Fungal Phy-
tase (PhyA) by Dynamic Light Scattering,” Biochemical
and Biophysical Research Communications, Vol. 327, No.
4, 2005, pp. 993-998. doi:10.1016/j.bbrc.2004.12.111
[15] J. K. Heinonen and R. J. Lahti, “A New and Convenient
Calorimetric Determination of Inorganic Orthophosphate
and Its Application to the Assay of Inorganic Pyrophos-
phatase,” Analytical Biochemistry, Vol. 113, No. 2, 1981,
pp. 313-317. doi:10.1016/0003-2697(81)90082-8
[16] A. H. J. Ullah and K. Sethumadhavan, “Myo-Inositol Hex-
asulfate Is a Potent Inhibitor of Aspergillus ficuum Phy-
tase,” Biochemical and Biophysical Research Communi-
cations, Vol. 251, No. 1, 1998, pp. 260-263.
doi:10.1006/bbrc.1998.9456
[17] D. Kostrewa, F. Grueninger-Leitch, A. D’Arcy, C. Broger,
D. Mitchell and A. P. G. M. Van Loon, “Crystal Structure
of Phytase from Aspergillus ficuum at 2.5 Å Resolution,”
Nature Structural Biology, Vol. 4, No. 3, 1997, pp. 185-
190. doi:10.1038/nsb0397-185
[18] D. Kostrewa, M. Wyss, A. D’Arcy and A. P. G. M. Van
Loon, “Crystal Structure of Aspergillus niger pH 2.5 Acid
Phosphatase at 2.4 Å Resolution,” Journal of Molecular
Biology, Vol. 288, No. 5, 1999, pp. 965-974.
doi:10.1006/jmbi.1999.2736
[19] D. Lim, S. Golova, C. W. Forsberg and Z. Jia,” Crystal
Structures of Escherichia coli Phytase and Its Complex
with Phytate,” Nature Structural Biology, Vol. 7, No. 2,
2000, pp. 108-113. doi:10.1038/72371
[20] K. Böhm, T. Herter, J. Müller, R. Borriss and U. Heine-
mann, “Crystal Structure of Klebsiella sp. ASR1 Phytase
Suggests Substrate Binding to a Preformed Active Site
that Meets the Requirements of a Plant Rhizosphere En-
zyme,” Federation of European Biochemical Societies Jour-
nal, Vol. 277, No. 5, 2000, pp. 1284-1296.
doi:10.1111/j.1742-4658.2010.07559.x
[21] E. J. Mullaney, C. B. Daly, T. Kim, J. M. Porres, X. G.
Lei, K. Sethumadhavan and A. H. J. Ullah, “Site-Directed
Mutagenesis of Aspergillus niger NRRL 3135 Phytase at
Residue 300 to Enhance Catalysis at pH 4.0,” Biochemi-
cal Biophysical Research Communications, Vol. 297, No.
4, 2002, pp. 1016-1020.
doi:10.1016/S0006-291X(02)02325-2
[22] Y. S. Tian, R. H. Peng, J. Xu, W. Zhao, F. Gao, X. Fu, A.
S. Xiong and Q. H. Yao, “Semi-Rational Site-Directed
Mutagenesis of phyi1s from Aspergillus niger 113 at Two
Residue to Improve Its Phytase Activity,” Molecular Bi-
ology Reports, Vol. 38, No. 2, 2011, pp. 977-982.
doi:10.1007/s11033-010-0192-1
[23] A. J. Oakley, “The Structure of Aspergillus niger Phytase
PhyA in Complex with a Phytate Mimetic,” Biochemical
and Biophysical Research Communications, Vol. 397, No.
4, 2010, pp. 745-749. doi:10.1016/j.bbrc.2010.06.024
[24] D. C.-C. Lim, “Bound for Catalysis. Crystal Structures of
Escherichia coli Phytase and Its Complex with Phytic
Acid,” M.S. Thesis, Queen’s University, Kingston, 1999.
[25] A. H. J. Ullah, K. Sethumadhavan and E. J. Mullaney,
“Unfolding and Refolding of Aspergillus niger PhyB
Phytase: Role of Disulfide Bridges,” Journal of Agricul-
tural and Food Chemistry, Vol. 56, No. 17, 2008, pp.
8179-8183. doi:10.1021/jf8013712
[26] M. S. Kim and X. G. Lei, “Enhancing Thermostability of
Escherichia coli Phytase AppA2 by Error-Prone PCR,”
Applied Microbiology and Biotechnology, Vol. 79, No. 1,
2008, pp. 69-75. doi:10.1007/s00253-008-1412-7
[27] W. Zhu, D. Qiao, M. Huang, G. Yang, H. Xu and Y. Cao,
“Modifying Thermostability of AppA from Escherichia
coli,” Current Microbiology, Vol. 61, No. 4, 2010, pp. 267-
273. doi:10.1007/s00284-010-9606-5