Advances in Microbiology, 2012, 2, 317-326
http://dx.doi.org/10.4236/aim.2012.23038 Published Online September 2012 (http://www.SciRP.org/journal/aim)
Molecular Profiling of Drug Resistant Isolates of
Mycobacterium tuberculosis in North India
Dinesh K. Tripathi1*, Kanchan Srivastava2*, Surya Kant2, Kishore K. Srivastava1#
1Department of Microbiology, Central Drug Research Institute, Lucknow, India
2Department of Pulmonary Medicine, Chhatrapati Shahuji Maharaj Medical University, Lucknow, India
Received May 9, 2012; revised June 7, 2012; accepted June 18, 2012
ABSTRACT
Multidrug-resistant tuberculosis (MDR-TB) is a major public health problem because treatment is complicated, cure
rates are well below those for drug susceptible tuberculosis (TB), and patients may remain infectious for months or
years despite receiving the best available therapy. To gain a better understanding of MDR-TB, we characterized isolates
recovered from 69 patients with MDR-TB, by use of IS6110 restriction fragment-length polymorphism (RFLP) analysis;
spacer oligonucleotide genotyping (i.e. spoligotyping). Clinical isolates from patients with tuberculosis have been con-
sidered to contain clonally expanded Mycobacterium tuberculosis (MTB) strain. Over the years, the identification
method based on IS6110 insertion sequences has been established as the standard for typing strains of MTB. IS6110
RFLP fingerprinting is very convincing when it is applied to classify MTB isolates harboring a large number of IS6110
in their chromosomes. Therefore, in the present study we have characterized the isolates from the patients suffering
from MDR TB, on the basis of conserved Variable Number Tandem Repeats (VNTR), Direct Repeats (DR) and Inser-
tion Sequences (IS) IS6110 elements. The polymorphic data showed significant level of dissimilarities among all the
MDR isolates of MTB. Comparative studies with the DR and VNTR data substantiate th at polymorphism occur among
MDR-TB cases as shown by the number of repeats present in different clinical isolates.
Keywords: Mycobacterium; Drug Resistance; IS6110; Polymorphism
1. Introduction
Although Tuberculosis (TB) is a preventable and treat-
able disease, it remains one of the leading infectious dis-
eases worldwide. As a result of inadequate treatment, the
proportion of patients with MDR-TB is constantly in-
creasing, and the extensively drug resistant TB (XDR-TB)
has become a new global threat. One important advance
in the field of tuberculosis research has been the devel-
opment of molecular techniques that allow the id entifica-
tion and tracking of individual strains of MTB. This new
discipline, the molecular epidemiology of tuberculosis,
began with the identification of IS6110, a novel myco-
bacterial insertion sequence which formed the basis of a
reproducible genotyping technique for MTB [1].
The spread of MDR-TB, due to emergence of MTB
isolates has increased worldwide and reached epidemic
proportion in many countries [2-4]. MDR-TB, which is
caused by MTB, isolates that are resistant to, at least,
Rifampicin (RIF) and Isoniazid (INH), is a serious public
health hazard [5,6]. Treating MDR-TB can be difficult
because loss of use of the 2 most potent anti-TB drugs
(i.e., INH and RIF) means that only less MDR-TB can be
cured by short-course chemotherapy [7-11], for other
patients, bacillary growth is merely suppressed as long as
treatment is continued [9,11]. Furthermore, 8% - 35% of
patients with MDR-TB have persistently active disease
that is refractory to multidrug therapy [12-16]. Conse-
quently, in most studies, the cure rates for MDR-TB re-
main well below those for drug-susceptible TB, and
mortality rates may be substantial, even among HIV-
neg ative patients [12]. In addition, patients with MDR-TB
those do not respond to treatmen t are a co nstan t so urce of
transmission of multidrug-resistant MTB [17-20]. In con-
trast to most bacteria, for MTB acquisition of drug resis-
tance does not occur as a result of horizontal transfer of
resistance-bearing genetic elements. Rather, acquisition
of drug resistance by MTB results from mutations (caused
by nucleotide substitutions, insertions, or deletions) in
specific resistance-determining regions of the genetic
targets (or their promoters) or activating enzymes of
anti-TB chemotherapeutic agents [21]. Inadequate ther-
apy or sub therapeutic drug level may provide a selective
growth advantage and, thus, may favor the growth of a
resistant phenotype that can ultimately predominate in
*Authors have equally contributed.
#Corresponding author.
C
opyright © 2012 SciRes. AiM

D. K. TRIPATHI ET AL. 318
persons in whom the disease was originally caused by
drug susceptible isolates [5]. Moreover, in patients with
MDR-TB, selection for additional mutations may be ac-
complished by adding a single drug to a failing regimen
[20]. In the human lung, selection of drug-resistan ce mu-
tations in MTB occurs predominantly within lung cavi-
ties for which high bacterial loads, active mycobacterial
replication, and reduced exposure to host defense mecha-
nisms have been reported [20-22]. Because MTB in spu-
tum samples obtained from patients originates from lung
cavities, molecular analysis of serially recovered sputum
isolates allowed us to study aspects of the genetic evolu-
tion of drug resistance in the human host.
RIF and INH are two crucial bactericidal drugs helps
in clearing nearly 80% MTB cells primarily in the cavi-
ties. Other drugs, Ethambutol (EMB) and Pyrazinamide
(PYZ) are supporting drugs during the initial phase [23,
24]. Therefore, immediate identification of these resistant
isolates is very important for adjustments in treatment
[25-27]. RIF were introduced in1972 as an anti TB drug
and has excellent sterilizing activity. It acts by bind ing to
the β-subunit of RNA polymerase (rpoB) [28], the en-
zyme responsible for transcription and expression of
mycobacterial genes, resulting in inhibition of the bacte-
rial transcription activity and thereby killing the organ-
ism. Mutations in the 81-bp core region of rpoB were
reported to be responsible for resistance in at least 95%
of the isolates [27,29,30]. This region is located between
codons 507 to 533 with the most common changes in
codons Ser531.eu, H is526Tyr and Asp16 Val [30,31].
The INH enters the bacterial cell as prodrug it is acti-
vated to a toxic substance in the cell by a catalase p erox-
ides encoded by a katG gene [32] and subsequently af-
fects intracellular targets such as mycolic acid biosynthe-
sis, an important component of the cell wall, which
eventually results in loss of cellular integrity and the
bacterial death.
Genetic and biochemical studies have shown that re-
sistance to EMB is mediated by mutations in the embB
gene, which encodes arabinisyl transferase, an integral
membrane protein that is inhibited by the drug. Various
studies have identified five mutations in codo n 306 ATG
of the embB gene that alter its first or third base ATG to
GTG CTG/ATA ATC or to ATT, resulting in three dif-
ferent amino acid substitutions (Met to Val, Leu or Ile) in
the EMB resistant isolates. These five mutations are as-
sociated with 70% - 90% of all embB resistant isolates
[11,33,34]. The early and rapid detection of multidrug
resistance is essential for efficient treatment and control
of MTB. The culture based methods for detection of
MTB infection and drug susceptibility testing usually
take more than a month, due to the slow growth of this
bacterium. The use of molecular methods for the identi-
fication of mutations in the genes may offers means for
rapid screening of the drug resistance among the MTB
isolates and initiation of early treatment [27,28,30].
In the above context, we in the present study have
typed the drug resistant isolates on the basis of DR and
VNTR and compared those with the standard IS6110.
2. Materials and Methods
2.1. Collection of MTB Isolates
Three consecutive morning sputum samples from each
patient were collected in properly labeled screw cap dis-
posable plastic bottles after oral gurgling with normal
water. Sputum samples were processed and stained for
Acid Fast Bacilli (AFB). One sputum sample from each
smear positive patient was processed, inoculated on
Lowenstein Jensen (LJ) slants and incubated in auto-
mated culture system at 37˚C for six weeks (Table 1).
The preliminary identification of mycobacterium iso-
lates depends on their growth on LJ slants. Specific iden-
tification is accomplished by the performance of Ziehl-
Neelsen (Z-N) stain and battery of bioch emical tests. The
positive cultures include growth in LJ medium after de-
contamination of sputum samples and incubation at 37˚C
for 4 - 6 weeks .
MTB isolates recovered from 69 HIV-negative, and
smear positive cases of both sexes, age varied from 18 to
62 years with MDR-TB that was refractory to chemo-
therapy given for >12 months. All subjects were selected
from Department of Pulmonary Medicine, CSM Medical
University, Lucknow and residents from the peripheral
region of Uttar Pradesh attending OPD of CSMMU, UP.
Drug susceptibility was tested every 2 - 3 months. For all
patients, treatment regimens were adjusted on the basis
of the results of these evalu ation s, at month intervals. W e
performed a detailed microbiological analysis of MTB
isolates recovered from these patients. History relevant to
tuberculosis such as time and duration, AFB load, out-
come of Patients was recorded in predesigned data sheet
(Table 2).
2.2. Drug susceptibility Testing (DST)
The phenotypic resistance of all isolates was determined
at baseline. Resistance to RIF and INH was in LJ me-
dium that contained 2 µg/ml RIF or 0.1 µg /ml. INH.
Table 1. Results of culture of smear (AFB) positive sputum
specimen (n = 69).
S. No.Results of Culture Number Percentage (%)
1 Growth of Mycobacteria 69 87.34
2 Contamination 03 03.94
3 No growth of Myc obacteria 04 05.06
Total 76 100

D. K. TRIPATHI ET AL. 319
Table 2. Profile of selected tuberculosis (TB) patients.
S. No. Age Range (in Years) Total M/Fa Ratio Duration of Treatment
(in Months) Mean Sputum AFB Loadb Patients Outcome Status Alive/Deceasedc
1 19 - 30 12 8 /4 18 - 55 (36.5) 1.0 - 2.5 10/2
2 31 - 40 13 11/2 21 - 82 (51.5) 2.0 - 2.5 08/5
3 41 - 50 26 24/2 20 - 54 (37.0) 2.0 - 2.5 19/7
4 51 - 62 18 15/3 06 - 14 (10.0) 2.5 - 3.0 11/07
Note: aMale/Female: (M/F); bSputum smears were recorded as having 1 - 4, 4 - 40, or 140 bacilli/high power fields, and they were given a score of 1, 2, or 3;
cDuring the study.
Other anti tuberculosis agents were also determined on
LJ medium that contained critical concentration of 7.5
µg/ml EMB, 10 µg/ ml Streptomycin(SM), 5 µg/ml,
Kanamycin (KM), 2 µg/ml Ofloxacin (Ofx), 10 µg/ ml
Ethionamide (ETO). Phenotypic susceptib ility testing for
PZA was not performed. All inoculated LJ drug and con-
trol media were incubated at 37˚C for 3 weeks. The me-
dia were examined at 48 h then weekly. The reading for
drug susceptibility were taken at 3 weeks after that drug
deterioration and the growth on control and drug con-
taining media were recorded according to Kent and
Kubica [35]. Drug resistance was expressed in proportion
method, where a strain is considered to be drug resistant
if the number of colonies that grow on a drug containing
media is 1 % or more of colonies that grow on a drug
free media. The control media must show good grow th at
least 50 to 150 colonies MTB H37Rv strain has been
used as a control st rain (Tables 3 and 4).
2.3. DNA Isolation
The mycobacteria were cultured in LJ medium for 3
weeks. The cells were harvested, and chromosomal DNA
was extracted by an enzymatic lysis method [36,37]. The
bacteria were pelleted by centrifugation and resuspended
in a 10 mM Tris-HCl-1 mM EDTA buffer (pH 8.0) [36].
Cell walls were digested with Lysozyme (10 mg/ml),
Proteinase K (10 mg/ml), and 10% SDS. DNA was ex-
tracted using 0.3 M cetyltrimethylammonium bromide
(CTAB) and 5M NaCl, purified by Phenol chloroform
extraction. DNA was precipitated by adding 1 volume of
isopropanol to the aqueous supernatant. After 30 min
incubation at –20˚C the mixture was centrifuged for 15
min. at 10,000 × g, the pellet was washed once with 70%
ethanol, air-dried and finally suspended in Mili Q water
[38].
2.4. PCR Amplification
The primers (Table 5) were used to amplify the flanking
regions of the VNTR, DR and IS6110 insertion sequence
[38]. PCR was performed using an automated gradient
thermal cycler (Bio-Rad) and all reaction buffers con-
tained 10 m M Tris/HC 1 (p H 8.3), 50 mM KC1, 1 - 5 m M
Table 3. Drug resistance and susceptibility profile for 177
patients.
Name of drugs No. of sensitive
strains (%) No. of resistant strains (%)
Isoniazid (INH) 110 (62.14) 67 (37.85)
Rifampicin (RI F) 101 (57.06) 76 (42.93)
Streptomycin (SM) 155 (87.57) 22 (12.42)
Ethambutol (EMB) 163 (92.09) 14 (07.90)
Pyrazinamide (PZA) Not done --
Ethionamide (ETO) All (100) Nil
Kanamycin (KM) 174 (98.0) 03 (1.69)
Capriomycin (CM) 173 (97.74) 04 (2.26)
Amikacin (AM) All Nil
Ofloxacin (Ofx) All Nil
Cycloserine (CS) All Nil
p-amino salicylic acid (PAS) None --
Sensitive to all drugs None* --
Resistance to any drugs -- All Total-177
*MDR: Multi-drug resistant: Resistance to both Isoniazid and Rifampicin
with or without Resistance to other drug.
Table 4. Multidrug resistance pattern of clinical isolates to
anti tuberculosis drugs.
S. No.No. of
drugs Name of drug No. of resistant strains Total (%) 69:177
1 2 Drugs*RIF + INH 30 (43.47)
RIF + SM 21 (30.43)
RIF + EMB 05 (07.24) 81.15:31.63
2 3 Drugs*RIF + INH + SM 07 (10.14)
*RIF + INH + SM 04 (05.79) 15.93:06.21
3 4 Drugs*RIF + INH + EMB + SM 02 (02.89) 02.89:01.12
Rifampicin (RIF); Is oniazid (INH); Strepto mycin (SM); Ethambutol (EMB).

D. K. TRIPATHI ET AL. 320
Table 5. PCR primers used for gene amplification.
S. No. Primer Sequence
1 DR0272
F-5’AGCGATCCTGCTGGTGG3’
R-3’TGCTGTTAGGGTCAAACG5’
2 DR0642
F-5’CCACTAGCAGATGGCCGTT3’
R-3’GCTCCAAGCGTAGTGATCCT5’
3 DR2068
F-5’CACGACGTAGACGAATGC3’
R-3’ATGACACGCTTTCTGCCC5’
4 DR3074
F-5’GTCACGATTGACACGCGGT3’
R-3’CATGGCCTCCGTTGTACTC5’
5 DR3319
F-5’TGGTAGGTCTGGTTCCGC3’
R-3’ATGTGCATCCTCAACGGG5’
6 DR3991
F-5’CCAACCTAGGCGTGTTCG3’
R-3’GATGTTCACCCCGAATGG5’
7 DR4110
F-5’TTTAGACGATCGCACCGC3’
R-3’AACGGAATCGTGGTCAGC5’
8 VNTR4052
F-5’GAGCCAAATCAGGTCCGG3’
R-3’GAGGTATCAACGGGCTTGT5’
9 VNTR4120
F-5’GTTCACCGGAGCCAACC3’
R-3’GAGGTGGTTTCGTGGTCG5’
10 VNTR4156
F-5’ACCGCAAGGCTGATGATCC3’
R-3’GTGCATCTCGTCGACTTCC5’
11 VNTR4348
F-5’ACAAGGAGAGCGGTGTCG3’
R-3’CATCCTGTAGATGGCGGC5’
12 IS6110 F-5’CCTGCGAGCGTAGGCGTCGG3’
R-3’CTCGTCCAGCGCCGCTTCGG5’
MgCl2, 0.2 mM of each dNTP (Fermentas, USA), 2 - 5
units Taq polymerase (Fermentas, USA), l µM of each
primer, and 100 ng template DNA in a final volume of
100 µl. The amplification profile consisted of a denatura-
tion step at 95˚C for five minutes, followed by 30 cycles
with denaturation at 95˚C for one minute, primer anneal-
ing at 65˚C, 67˚C and 55˚C for one minute, and exten-
sion at 72˚C for one minute. The PCR products were
electrophoresed through 1.5% - 2% agarose gels and
stained with ethidium bromide. Visualization was done
on a UV light illuminator (Chemidoc) the copy number
of the amplified products was inferred from the differ-
ence between the molecular weights of the amplified
products of the samples and those of the H37Rv strain.
To estimate the length of the amplified products were
used to compare with standard molecular weight markers
(Fermentas, USA).
In the present study we have characterized 69 isolates
from the patients suffering from MDR TB, on the basis
of conserved VNTR, DR and IS6110 elements. The sets
of DNA primers (VNTR = #4, DR = #7 and IS6110 = #1)
were designed from the MTB genome and were used to
amplify the genomic DNAs of isolates. Sequences of
primers listed below were used for VNTR, DR, and IS
elements. The position of each locus is reported earlier
[39-41].
3. Results
3.1. Patients
A total of 177 sputum smear positive pulmonary tuber-
culosis patients were studied. Out of 177, 76 RIF resis-
tant cases were selected. Among 76 cases 58 were male
and remaining 18 were female (76.31% and 23.68%). All
of them were in the age group of 19 - 62 years (Table 2).
Of the 76 cases, 60 (78.94%) were in low income group
and only 16 (21.05%) from middle-income group. Ma-
jority, of the patients came from urban area. Of these 76
smear positive cases, culture for Mycobacteria were
positive in 69 (87.34%) cases, contaminatio n in 3 (3.97%)
and no growth of Mycobacteria in 4 (5.06%) cases (Ta-
ble 1). Some of the patients were mono drug resistant
initially but they converted into MDR cases. Study was
carried out on 69 RIF resistant and other drugs resistant
cases.
During the study period, sixty nine patients previously
had TB; none of the patients had extra pulmonary TB
and Diabetes mellitus. Most patients excreted large num-
bers of bacilli in sputum (median score, 2.0) (Table 2),
some patients died during the study, most likely as a re-
sult of cachexia and/or chronic respiratory failure. Pa-
tients who died had more extensive disease compared
with patients who survived. At the time that TB was
originally diagnosed, all patien ts were treated with World
Health Organization category I therapy (i.e., treatment
with INH, RIF, PZA and EMB for 2 months, followed by
treatment with either INH and RIF or INH, RIF, and
PZA for an additional 4 months) for varying lengths of
time [36]. Once MDR-TB was diagnosed, the patients
were switched to treatment regimens tailored to the phe-
notypic drug-susceptibility profile of their isolates. At
entry to the study, therapy was again adjusted according
to phenotypic drug susceptibility, treatment history, and
the side effect profile.
3.2. Phenotypic and Genotypic Resistance Profile
of M. tuberculosis
All 69 isolates displayed phenotypic resistance to RIF
and taken together the isolates from all 69 patients were
highly resistant to many of the most potent first and sec-
ond line agents. Identification tests for Mycobacterium
isolates were done in accordance with the standard pro-
cedures. Tables 3 and 4 show the sensitivity and resis-
tance pattern of 69 strains of MTB to 4 anti tuberculosis
drugs. All strains were resistant to one or more drugs.
Highest mono drug resistance (42.93%) was found in
RIF either alone or in combination with other drugs
[43.47%]. Our study identified 30 isolates were resistant
to both INH and RIF; the other 39 isolates were resistant
to all the three and four drugs tested (Tables 3 and 4).

D. K. TRIPATHI ET AL. 321
Genotypic results are adding power to this approach
that based on the detection of DNA po lymorphism within
the DR cluster and VNTR- PCR are gold standard tech-
niques for strain typing (Table 5 ) and for the stud y of the
global molecular epidemiology of MTB (Tables 6 and 7).
These tools provide information like latent infection,
Strain-specific patterns, and drug resistance in various
isolates. The Polymorphic data showed significant level
of dissimilarities among all the MDR isolates of MTB.
Out of 69 patients, a number of VNTR’s were detected,
without showin g any standard prof ile. The polymorphism
of each tandem repeat locus was found to be different;
they had moderate or high allelic diversity which are
useful for the differentiation of MTB strains. Molecular
genotyping based on VNTR-PCR analyses has several
advantages over standard IS6110 RFLP and other typing
methods. Five types of DR’s were amplified with each
other of the primer sets used. When compared the DR
and VNTR data, we could only observe that polymor-
phism occur among clinical isolates of MDR-TB and
there are number of fingerprints presen t (Figures 1 and 2,
Table 7).
4. Discussion
In 1993, the National Tuberculosis Program (NTP) in
India was strengthened in the form of Revised National
Tuberculosis Control Program (RNTCP). Like HIV-
AIDS, threat perception due to occurrence of multidrug
resistance has assumed considerable gravity in con-
structing the epidemic situation analysis and appropriate
intervention. In this study drug resistance of MTB to at
least one drug were found in all selected cases. This
situation is highly alarming. Resistances (37.85%) were
found in INH which is the most popular drug, followed
by RIF (42.9%) cases. Resistances to SM were found in
12.42% cases and to EMB 7.90% cases [42-44]. The
efficiency of current tuberculosis control program in any
Table 6. Grouping of clinical isolates on the basis of IS6110.
Groups No. of Patient Samples in Which IS6110 Positive No. of Patients Samples in Which IS6110 Negative
A 1, 2, 9, 10, 17, 19, 23, 34 -
B 3, 4, 20, 21, 22 -
C 5, 11, 13, 14, 15, 16, 18, 24, 25, 26, 27, 28 to33, 35, 38 to 46, 48 to 63, 65 to
71 -
D 6 -
E 7 -
F - 8, 36, 37, 47, 64
Table 7. Polymorphism in pulmonary isolates with various DRs and VNTRs.
S. No. Primers Name (DR/VNTR) Polymorphism Shows in Patients Samples
Direct Repeats (DR) Band Size of Primers
1 DR0272 305 kb 3 - 8, 18 - 22
2 DR0642 231 kb 1 - 6, All bands are of same size.
3 DR2068 336 kb 6 - 12, All bands are of same size.
4 DR3074 172 kb 6 - 12, All bands are of same size.
5 DR3319 574 kb 2 - 8, 2 - 5, 7 - 9.
6 DR3991 534 kb 2 - 9, All bands are of same size.
7 DR4110 531 kb 18 - 24
Variable Number Tandem Repeats (VNTR)
8 VNTR4052 879 kb 4 - 10
9 VNTR4120 447 kb 5 - 11
10 VNTR4156 704 kb 6 - 12
11 VNTR4348 516 kb 7 - 14

D. K. TRIPATHI ET AL. 322
Figure 1. Primer IS6110, M-DNA ladder, lane 1-70-clinical isolates ctrl-control.
Figure 2. Polymorphism in clinical isolates with various primers; A-P1 [DR0272]; B-P2 [DR0642]; C-P3 [DR2068]; D-P4
[DR3074]; E-P5 [DR3319]; F-P6 [DR3991]; G-P7 [DR4110]; H-P8 [VNTR4052]; I-P9 [VNTR4120]; J-P10 [VNTR4156];
K-P11 [VNTR4348].
country is assayed by drug resistant pattern [45-47].
ICDDR’B, Dhaka reported resistance to any drug was
48.4%, resistance to INH, RMP, SM and EMB was
17.4%, 7.4%, 45.3% and 9.9% respectively [48]. Lina et
al. [49] reported drug resistance to INH, RMP, SM, EMB
and MDR-TB was 30.41%, 58.55%, 46.95%, 3.67% and
25.25% respectively. A similar study from Haryana, In-
dia shows MDR-TB of the same order (24%). In a recent
review of the Indian situation [2] from the TRC, Chennai
has concluded that the magnitude of the drug resistance

D. K. TRIPATHI ET AL. 323
problem is principally due to acquired resistance (re-
placed in recent times by the term drug resistance among
previously treated cases). In New Delhi, a similar extent
of acquired drug resistance was reported. Institute of
Thoracic medicine in Chennai had shown acquired resis-
tance of about 63% among patients from District Tuber-
culosis Centers of Tamil Nadu. Resistance to INH and
RIF (MDR TB) was of the order of 20.3%. It was con-
sidered 53% that initial drug resistance in India (freshly
defined as, drug resistance among new cases) could be at
a lower order than similarly placed countries globally, as
distinct from the acquired drug resistance situation given
above. There could be 5% - 10% resistance to INH, [20,
29,50,51]. This could be reflecting the primary drug re-
sistance problem in the Indian context [2,52-54].
In this study 69 isolates resistant to two or more of the
tested drug was identified. This is comparable to what
has been reported in the neighboring countries, with re-
sistance to INH and RIF being more common than resis-
tance to EMB. The simultaneous resistance to INH and
EMB that was detected in (3%) of the isolates is in
agreement with previous reports [9,15,51], and the si-
multaneous resistance to RIF and EMB detected in
(7.24%) of the isolates is consistent with a previous study
[7-9]. Resistance to RIF is increasing because of wide-
spread application that results in selection of resistant
mutants, and is seen in cases noncompliant with TB
treatment [51,52]. In this context, resistance to RIF can
be assumed to be a surrogate marker for MDR-TB [11,
48]. Phenotypic susceptibility testing for PZA was not
performed, because the results of this test can be difficult
to reproduce and may not correlate well with drug sus-
ceptibility in vivo [12,13].
In conclusion, our results of MDR-TB underline the
importance of strengthening classical case finding and
treatment of smear-positive patients according to the on-
going DOTS program. The introduction of the rapid,
specific and technically affordable molecular techniques
can be used and interpreted in conjunction with conven-
tional methods to detect more active cases of MDR-TB
cases. The Polymerase Chain Reaction (PCR) appears to
be a simple and accurate method that allows genotyping
to be undertaken more quickly and in a less costly man-
ner. It is applicable for direct detection in stained sputum
smear preparations, which help in reducing the time
needed for bacterial growth, and should facilitate the
adequate choice of anti tuberculosis therapy [1,14,40,]
that limits the extent and severity of MDR-TB transmis-
sion and infection.
INH and RIF’s resistance in MTB complex (MTC)
isolates are mainly based on mutations in a limited num-
ber of genes. However, mutation frequencies vary in dif-
ferent mycobacterial populations. In this work, we ana-
lyzed the distribution of resistance-associated mutations
in MTB. The application of DNA fingerprinting can pro-
vide valuable insights into the p athogenesis of tuberculo-
sis and may help in identifying strains of MTB with spe-
cific properties such as virulence and failure of drug re-
sponse. Most of the epidemiological applications of
RFLP analysis have used an insertion sequence known as
IS6110 [39,52-55]. It was initially described by Thierry
et al. [56] and has been shown to be distributed through-
out the MTB complex.
Spoligotyping, in addition to IS6110 RFLP, can be
useful in determining more distant relationships among
isolates. In our current study, the relative instability of
IS6110 RFLP was found in one of two MDR outbreak
strains; however, not fewer than four of nine of the
IS6110 RFLP patterns showed a minor and different al-
teration. Therefore, the transposition rate may be strongly
related to the M. tuberculosis genotype represented.
DNA fingerprinting of MTB has been shown to be a
powerful epidemiologic tool because it exploits variabil-
ity in both the no. and genomic position of insertion se-
quences and tandem repeats to generate strain specific
patterns [2,54,56].
The integration of VNTR-typing with conventional
approaches has the potential to be a powerful new tech-
nology, which provides a robust and high resolution tool
for the molecular epidemiology of the MTB complex.
The direct repeat (DR) locus is the characteristic of the
MTB complex. The DR locus consists of multiple tan-
dem 36-bp repeats interspersed with variable spacers of
about equal size. Polymorphism of the DR locus (ab-
sence or presence of single Direct variant repeat DVR),
has been exploited widely for distinguishing among
clinical isolates of the MTB by using spacer oligonucleo-
tide typing., In the present study we have used all the
three control group of genes and tried to d emonstrate the
differences among clinical isolates of MDR TB Isolates.
In the present study, polymorphic data showed signifi-
cant level of dissimilarities among all the MDR isolates
of MTB. Out of 69 patients, a number of VNTRs were
detected, without sh owing any standard profile. Similar ly
two types of DRs were amplified with each of the primer
sets used (Table 5). When we compared the DR and
VNTR data we could only claim that polymorphism oc-
cur among clinical isolates of MDR-TB and since there
are numb er of finger p rints pre se nt [53-55 ].
Over the past decade, much has been learned of the
drug targets and mechanisms of resistance to first-line
and several second-lines anti tuberculosis agents (Table
4) [42,43,53,54]. As mentioned above, MTB generally
acquires drug resistance via de novo nsSNP, small dele-
tions, or insertions in specific chromosomal loci, unlike
most other pathogenic bacteria, which often acquire drug
resistance via horizontal transfer. This attribute of MTB
drug resistance, coupled with fast and efficient DNA

D. K. TRIPATHI ET AL. 324
sequencing methods, makes studying drug resistance
highly amenable for molecular epidemiologic investiga-
tions [41,46,47,54,57]. Molecular epidemiologic studies
on drug resistance have generally sought to examine the
nature (e.g., genotype-specific mutations, association of
specific mutations with p henotypic resistance) and extent
(e.g., prevalence of specific mutations in a population) of
drug resistance and patient risk factors (e.g., HIV) for
acquiring resistance. The report by Bifani et al. [57,58]
provides an example of a study of the nature and evolu-
tion of drug resistance during a clonal MDR-TB out-
break.
5. Conclusions
MTB is an obligate pathogen that does not naturally rep-
licate outside of its host environment. As such, MTC
members are believed to have coevolved with hominids
for millions of years. Consequently, it is very possible
that, unlike other opportunistic patho gens, viable tube rcle
bacilli encode the minimum ensemble of virulen ce genes
required for successful infection, replication, and dis-
semination. Thus, the relative success of one clonal MTB
family over another might rely on the relationship be-
tween levels of gene expression and environmental fac-
tors and the host.
Strain analysis, together with virulence studies, will
help pinpointing isolates associated with higher morbid-
ity and mortality, with the aim of directing efforts to limit
the spread of those strains within th e region.
6. Acknowledgements
The work was supported by CSIR-CDRI SIP-0026 and
DST WOS-A LS-24/2008 to KS [WOS-A LS-24/2008].
This is CSIR-CDRI co mmunication #127/2012/KKS.
REFERENCES
[1] D. van Soolingen, P. E. W. de Hass, P. W. M. Hermans, P.
M. Groenen and J. D. van Embden, “Comparison of Vari-
ous Repetitive DNA Elements as Genetic Markers for
Strain Differentiation and Epidemiology of M. tuberculo-
sis,” Journal of Clinical Microbiology, Vol. 31, No. 8,
1993, pp. 1987-1995.
[2] P. Venkataraman and Paramasivan, “Drug Resistance in
Tuberculosis and Issues Related to Multidrug Resistance
in Planning for TB Control in India,” The Health Admin-
istrator, Special Issue on Tuberculosis, Vol. 15, 2002, pp.
127-136.
[3] Centers for Disease Control and Prevention (CDC), “Ex-
tensively Drug-Resistant Tuberculosis-United States,”
1993-2006.
[4] D. A. Mitchison, “Drug Resistance in Tuberculosis ,” Euro-
pean Respiratory Journal, Vol. 25, No. 2, 2005, pp. 376-
379. doi:10.1183/09031936.05.00075704
[5] I. Mokrousov, O. Narvskaya, E. Limeschenko, T. Otten
and B. Vyshnevskiy, “Detection of Ethambutol Resistant
M. tuberculosis Isolates by Multiplex Allele Specific PCR
Assay Targeting embB 306 Mutations,” Journal of Clini-
cal Microbiology, Vol. 40, No. 5, 2002, pp. 1617-1620.
doi:10.1128/JCM.40.5.1617-1620.2002
[6] I. Mokrousov, T. Otten and M. Filipenko, “Detection of
Isoniazid Resistant M. tuberculosis Isolates by Multiplex
Allele Specific PCR Assay Targeting katG Codons 351
Variation,” Journal of Clinical Microbiology, V ol. 40, No.
7, 2002, pp. 2509-2512.
doi:10.1128/JCM.40.7.2509-2512.2002
[7] A. Van Rie, A. Warren and R. I. Mshanga, “Analysis for a
Limited Number of Gene Codons Can Predict Drug Re-
sistance of M. tuberculosis in a High-Incidence Commu-
nity,” Journal of Clinical Microbiology, Vol. 39, No. 2,
2001, pp. 636-641. doi:10.1128/JCM.39.2.636-641.2001
[8] L. M. Parsons, M. Salfinger and A. Coleridge, “Phenotypic
and Molecu lar Ch aracteriz ation of M. tuberculosis Isolates
to both Isoniazid and Ethambutol,” Antimicrobial Agents
and Chemotherapy, Vol. 49, No. 6, 2005, pp. 2218-2225.
doi:10.1128/AAC.49.6.2218-2225.2005
[9] Z. Yang, R. Durmaz and D. Yang, “Simultaneous Detec-
tion of Isoniazid, Rifampicin, and Ethambutol by a Single
Multiplex Allele Specific Polymerase Chain Reaction
(PCR) Assay,” Diagnostic Microbiology & Infectious Di-
sease, Vol. 53, No. 3, 2005, pp. 201-208.
doi:10.1016/j.diagmicrobio.2005.06.007
[10] A. Hristea, D. Otelea, S. Paraschiv, A. Macri, C. Baicus, O.
Moldovan, M. Tinischi, V. Arama and A. Streinu-Cercel,
“Detection of M. tuberculosis Resistance Mutations to
Rifampin and Isoniazid by Real-Time PCR,” Indian Jour-
nal of Medical Microbiology, Vol. 28, No. 3, 2010, pp.
211-216. doi:10.4103/0255-0857.66474
[11] I. Mokrousov, T. Otten, B. Vyshnevskiy and O. Narvskaya,
“Allele-Specific rpoB PCR Assays for Detection of Ri-
fampin-Resistant M. tuberculosis in Sputum Smear,” An-
timicrobial Agents and Chemotherapy, Vol. 47, No. 7,
2003, pp. 2231-2235.
doi:10.1128/AAC.47.7.2231-2235.2003
[12] G. Canetti, W. Fox, A. Khomenko, H. T. Mahler, N. K.
Menon, D. A. Mitchison, N. Rist and N. A. Smelev, “Ad-
vances in Techniques of Testing Mycobacterial Drug
Sensitivity and t he Use of Sensitivity Tests in Tuberculosis
Control Programmes,” Bulletin of the World Health Or-
ganization, Vol. 41, No. 1, 1969, pp. 21-43.
[13] T. H. Weniger, J. Krawczyk, P. H. Supply, S. Niemann
and D. Harmsen, “MIRU-VNTRplus: A Web Tool for
Polyphasic Genotyping of M. tuberculosis Complex Bac-
teria,” Nucleic Acids Research, Vol. 38, Suppl. 2, 2010, pp.
1-6. doi:10.1093/nar/gkq351
[14] R. Johnson, M. E. Streicher, E. G. Louw, R. M. Warren, P.
D. van Helden and T. C. Victor, “Drug Resistance in M.
tuberculosis,” Current Issues in Molecular Biology, Vol. 8,
No. 2, 2006, pp. 97-112.
[15] B. Madison, B. Robinson-Dunn and I. George, “Multi-
center Evaluation of Ethambutol Susceptibili ty Testing of
M. tuberculosis by Agar Proportion 15 and Radiometric
Methods,” Journal of Clinical Microbiology, Vol. 40, No.

D. K. TRIPATHI ET AL. 325
11, 2002, pp. 3976-3979.
doi:10.1128/JCM.40.11.3976-3979.2002
[16] H. Rinder, K. T. Mieskes and T. Loscher, “Heteroresis-
tance in Mycobacterium tuberculosis,” The International
Journal of Tuberculosis and Lung Disease, Vol. 5, No. 4,
2001, pp. 339-345.
[17] V. Nikolayevskyy, Y. Balabanova, T. Simak, N. Malo-
manova, I. Fedorin and F. Drobniewski, “Performance of
the Genotype(R) MTBDR Plus Assay in the Diagnosis of
Tuberculosis and Drug Resistance in Samara, Russian
Federation,” BMC Clinical Pathology, Vol. 10, 2009, pp.
2-22. doi:10.1186/1472-6890-9-2
[18] G. C. Baldeviano-Vidalon, N. Quispe-Torres and C.
Bonilla-Asald, “Multiple Infection with Resistant and
Sensitive M. tuberculosis Isolates during Treatment of
Pulmonary Tuberculosis Patients,” The International Jour-
nal of Tuberculosis and Lung Disease, Vol. 9, No. 10,
2005, pp. 1155-1160.
[19] S. A. Watterson, S. M. Wilson, M. D. Yates and F. A.
Drobniewski, “Comparison of Three 18 Molecular Assays
for Rapid Detection of Rifampin Resistance in M. tuber-
culosis,” Journal of Clinical Microbiology, Vol. 36, No. 7,
1998, pp. 1969-1973.
[20] C. Dye, S. Scheele, P. Dolin, V. Pathania and M. C.
Raviglione, “Global Burden of Tuberculosis: Estimated
Incidence, Prevalence and Mortality by Country,” Journal
of the American Medical Association, Vol. 282, No. 7,
1999, pp. 677-686.
[21] WHO, “Anti-Tuberculosis Drug Resistance WHO/IUALD
Global Project on Anti-Tuberculosis Drug Resistance Sur-
veillance,” Geneva, 1997, WHO/TB/97.229.
[22] C. Dye, Z. Fengzeng, S. Scheele and B. Williams, “Ev al u-
ating the Impact of Tuberculosis Control: Number of
Deaths Prevented by Short-Course Chemotherapy in
China,” International Journal of Epidemiology, Vol. 29,
No. 3, 2000, pp. 558-564. doi:10.1093/ije/29.3.558
[23] WHO, “Global Tuberculosis Control Surveillance: Plan-
ning, Financing,” Geneva, 2009, pp. 1-303.
[24] WHO, “Global Tuberculosis Control,” Geneva, Switzer-
land, 2003.
[25] WHO, “Anti Tuberculosis Drug Resistance in the World,
Prevalence and Trends,” Geneva, Switzerland, 2000.
[26] WHO, “Drug-Resistant Isolates of TB Increasing World-
wide,” WHO 19, Geneva, 2000.
[27] L. Herrera-León, T. Molina, P. Saíz, J. A. Sáez-Nieto and
M. S. Jimenez, “New Multiplex PCR for Rapid Detection
of Isoniazid-Resistant M. tuberculosis Clinical Isolates,”
Antimicrobial Agents and Chemotherapy, Vol. 49, No. 1,
2005, pp. 144-147.
doi:10.1128/AAC.49.1.144-147.2005
[28] C. Abe, I. Kobayashi and S. Mitarai, “Biological and
Molecular Characteristics of M. tuberculosis Clinical Iso-
lates with Low-Level Resistance to Isoniazid in Japan,”
Journal of Clinical Microbiology, Vol. 46, No. 7, 2008, pp.
2263-2268. doi:10.1128/JCM.00561-08
[29] S. V. Ramaswamy and J. M. Musser, “Molec ular Genetic
Basis of Antimicrobial Agent Resistance in M. tuberculo-
sis: 1998 Update,” Tubercle and Lung Disease, Vol. 79,
No. 1, 1998, pp. 3-29. doi:10.1054/tuld.1998.0002
[30] C. Plinke, H. S. Cox, S. Kalon, D. Doshetov. Rüsch-
Gerdes and S. Niemann, “Tuberculosis Ethambutol Re-
sistance: Concordance between Phenotypic and Geno-
typic Test Results,” Tuberculosis, Vol. 89, No. 6, 2009,
pp. 448-452. doi:10.1016/j.tube.2009.09.001
[31] J. I. Sekig uchi, T. Mi yoshi-Aki yama and E. Augustynowicz-
Kopec, “Detection of Multidrug Resistance in Mycobac-
terium tuberculosis,” Journal of Clinical Microbiology,
Vol. 45, No. 1, 2007, pp. 179-192.
doi:10.1128/JCM.00750-06
[32] N. Gonzalez, M. J. Torres, J. Aznar and J. C. Palomares,
“Molecular Analysis of Rifampin and Ison iazid Res istance
of M. tuberculosis Clinical Isolates in Seville, Spain,”
Tubercle and Lung Disease, Vol. 79, No. 3, 1999, pp.
187-190. doi:10.1054/tuld.1998.0195
[33] J. Wang, R. M. Burger and K. Drlica, “Role of Superoxide
in Catalase-Peroxidase-Mediated Isoniazid Action against
Mycobacteria,” Antimicrobial Agents and Chemotherapy,
Vol, 42, No. 3, 1998, pp. 709-711.
[34] S. V. Ramaswamy, A. G. Amin, S. Goksel, C. E. Stager, S.
J. Dou and H. L. Sahli, “Molecular Genetic Analysis of
Nucleotide Polymorphisms Associated with Ethambutol
Resistance in Human Isolates of M. tuberculosis,” Antim-
icrobial Agents and Chemotherapy, Vol. 44, No. 2, 2000,
pp. 326-336. doi:10.1128/AAC.44.2.326-336.2000
[35] P. T. Kent and G. P. Kubica, “Public Health Mycobacte-
riology: A Guide for the Level III Laboratory. US De-
partment of Health and Drug Resistance Pattern of M. tu-
berculosis Isolated from Patients Attending a Referral
Hospital Wadud et al. Bangladesh,” Journal of Medical
Microbiology, Vol. 17, 2000, pp. 1132-1140
[36] J. P. Hosek, P. Svastova, M. Moravkova, I. Pavlik and M.
Bartos, “Methods of Mycobacterial DNA Isolation from
Different Biological Materia l: A Review,” Veterinary Me-
dicine, Vol. 51, No. 5, 2006, pp. 180-192.
[37] E. Mazars, S. Lesjean, A. L. Banuls, M. Gilbert, V. Vin-
cent, B. Gicquel, M. Tibayrenc, C. Locht and P. H. Supply,
“High-Resolution Minisatellite-Based Typing as a Port-
able Approach to Global Analysis of M. tuberculosis
Molecular Epidemiology,” Proceedings of the National
Academy of Sciences, Vol. 98, No. 4, 2001, pp. 1901-1906.
doi:10.1073/pnas.98.4.1901
[38] E. B. Hill, L. G. Wayne and M. Gross, “Purification of
Mycobacterial Deoxyribonucleic Acid,” Journal of Bac-
teriology, Vol. 112, No. 3, 1972, pp. 1033-1039.
[39] N. Smittipat and P. Palittapongarnpim, “Identification of
Possible Loci of Variable Number of Tandem Repeats in
M tuberculosis,” Tubercle and Lung Disease, Vol. 80, No.
2, 2000, pp. 69-74. doi:10.1054/tuld.2000.0236
[40] I. J. Wiid, C. Werely, N. Beyers, P. Donald, P. D. van
Helden, “Oligonucleotide (GTG)5 as a Marker for M. tu-
berculosis Strain Identification.” Journal of Clinical Mi-
crobiology, Vol. 32, No. 5, 1994, pp. 1318-1321.
[41] P. Palittapongampim, S. Chomyc, A. Fanning and D.
Kunimoto, “DNA Fragment Length Polymorphism Analy-
sis of M. tuberculosis Isolates by Arbitrarily Primed Po-
lymerase Chain Reaction,” The Journal of Infectious

D. K. TRIPATHI ET AL. 326
Diseases, Vol. 167, No. 4, 1993, pp. 975-978.
doi:10.1093/infdis/167.4.975
[42] R. C. Chan, M. M. M. Hui, E. W. Chan, et al., “Geneti c
and Phenotypic Characterization of Drug-Resistant M.
tuberculosis Isolates in Hong Kong,” Journal of Antim-
icrobial Chemotherapy, Vol. 59, No. 5, 2007, pp. 866-
873.
[43] P. M. Gronen, A. E. Bunschoten, D. Van Soolingen and J.
D. A. van Embden, “Nature of DNA Polymorphism in the
Direct Repeat Cluster of M. tuberculosis: Application for
Strain Differentiation by a Novel Typing Method,” Mo-
lecular Microbiology, Vol. 10, No. 5, 1993 pp. 1057-1065.
doi:10.1111/j.1365-2958.1993.tb00976.x
[44] R. M. Warren, N. C. Gey van Pittius, M. Barnard, A.
Hesseling, E. Engelke, M. de Kock, M. C. Gutierrez, G. K.
Chege, T. C. Victor, E. G. Hoal and P. D. van Helden
“Differentiation of M. tuberculosis Complex by PCR
Amplification of Genomic Regions of Difference,” The
International Journal of Tuberculosis and Lung Disease,
Vol. 10, No. 7, 2006, pp. 818-822.
[45] WHO, TB Country Profile-Jordan, 2010.
www.who.int/tb/data
[46] H. Van Deutekom, P. H. Supply, P. E. W. Haas, E. Wil-
lery, S. P. Hoijng, C. Locht, R. A. Coutinho and D. van
Soolingen, “Molecular Typing of M. tuberculosis by My-
cobacterial Interspersed Repetitive Unit Variable-Number
Tandem Repeat Analysis, a More Accurate Method for
Identifying Epidemiological Links between Patients with
Tuberculosis,” Journal of Clinical Microbiology, Vol. 43,
No. 9, 2005, pp. 4473-4479.
doi:10.1128/JCM.43.9.4473-4479.2005
[47] N. Thorne, A. Underwood, S. Gharbia and C. Arnold,
“Evolutionary Clues from Comparative Analysis of M.
tuberculosis Variable-Number Tandem Repeat Sequences
within Genetic Families,” Infection, Genetics and Evolu-
tion, Vol. 7, No. 2, 2005, pp. 239-246.
doi:10.1016/j.meegid.2006.09.006
[48] ICDDR’B, Health and Science Bulletin, Vol. 1, 2002, pp.
6-10.
[49] D. Lina and P. M. Sweta, “Drug Resista nce in Tuberculo-
sis,” Bombey Hospital Journal, 1999.
www.bhj.org/journal/1999.4103.july99/original.253.htm
[50] L. Sandman, N. W. Schluger, A. L. Davidow and S. Bonk,
“Risk Factors for Rifampin-Monoresistant Tuberculosis:
A Case-Control Study,” American Journal of Respiratory
and Critical Care Medicine, Vol. 159, No. 2, 1999, pp.
468-472.
[51] A. Hristea, D. Otelea, S. Paraschiv, A. Macri, C. Baicus, O.
Moldovan, M. Tinischi, V. Arama and A. Streinu-Cercel,
“Detection of M. tuberculosis Resistance Mutations to
Rifampin and Isoniazid by Real-Time PCR,” Indian As-
sociation of Medical Microbiologists, Vol. 28, No. 3, 2010,
pp. 211-216. doi:10.4103/0255-0857.66474
[52] F. A. Post, P. A. Willcox, B. Mathema, L. M. Steyn, K.
Shean, S. V. Ram as w am y, E. A. Gravis s , E. Shashkina, B.
N. Kreiswirth and G. Kaplan, “Genetic Polymorphism in
M. tuberculosis Isolates from Patients with Chronic Mul-
tidrug-Resistant Tuberculosis,” The Journal of Infectious
Diseases, Vol. 190, No. 1, 2004, pp. 99-106.
doi:10.1086/421501
[53] D. Van Soolingen, P. W. M. Hermans, P. E. W. de Haas,
D. R. Soll and J. D. van Embden, “Occurrence and Sta-
bility of Insertion Sequences in Mycobacterium Tubercu-
losis Complex Strains: Evaluation of an Insertion Se-
quence-Dependent Polymorphism as a Tool in the Epi-
demiology of Tuberculosis,” Journal of Clinical Micro-
biology, Vol. 29, No. 11, 1991, pp. 2578-2586.
[54] S. M. M. Roring, D. Brittain, A. E. Bunschoten, M. S.
Hughes, R. A. Skuce, J. D. A. Van Embden and S. D.
Neil, “Spacer Oligotyping of Mycobacterium bovis Iso-
lates Compared to Ty ping by Restriction Fragment Length
Polymorphism Analysis Using PGRS, DR and IS6110,”
Veterinary Microbiology, Vol. 61, No. 1-2, 1998, pp. 111-
120. doi:10.1016/S0378-1135(98)00178-3
[55] K. L. Horan, R. Freeman., K. Weigel, M. Semret, S.
Pfaller, T. C. Covert, D. Van Soolingen, S. C. Leao, M. A.
Behr and G. A. Cangelosi, “Novel Genetic Polymor-
phisms That Further Delineate the Phylogeny of the My-
cobacterium tuberculosis Complex,” Journal of Bacteri-
ology, Vol. 188, No. 12, 2006, pp. 4271-4287.
[56] D. Thierry, M. D. Cave, K . D. Eis enach, J . T. Craw ford, J.
H. Bates and B. Gicquel, “IS6110, and IS-like Element of
M. tuberculosis Complex,” Nucleic Acids Research, Vol.
18, No. 1, 1990, pp.188-192. doi:10.1093/nar/18.1.188
[57] P. B. Bifani, M. Mathema, S. Campo, B. Moghazeh, E.
Nivin, J. Shashkina, S. S. Driscoll, R. Munsiff, R. Froth-
ingham and B. N. Kreiswirth, “Molecular Identification of
Streptomycin Monoresistant M. tuberculosis Related to
Multidrug-Resistant W Strain,” Emerging Infectious Dis-
eases, Vol. 7, No. 5, 2001, pp. 842-848.
doi:10.3201/eid0705.010512
[58] P. Miotto, F. Piana, V. Penati, F. Canducci, G. B. Migliri
and D. M. Cirillo, “Use of Genotype MTBDR Assay for
Molecular Detection of Rifampicin and Isoniazid Resis-
tance in M. tuberculosis Clinical Isolates Isolated in It-
aly,” Journal of Clinical Microbiology, Vol. 44, No. 7,
2006, pp. 2485-2491. doi:10.1128/JCM.00083-06