ABSTRACT

The Calcium Integrin Binding protein (CIB) has been identified as interacting specifically with the cytoplasmic tail of the integrin α_IIb domain to induce receptor activation and integrin α_IIbβ₃ mediated cell adhesion to extracellular proteins. In K562 cells stably expressing mutated integrin α_Vβ₃, or chimeric α_Vβ₃ carrying α_IIb cytoplasmic tail, we report that the interaction of CIB with β₃ integrins is not α_IIbβ₃ specific but binds α_IIb as well as α_V cytoplasmic tail domains. A double mutation of two proline residues to alanine residues in the α_IIb cytoplasmic domain, previously shown to disturb its conformation, inhibits chimeric α_V/α_IIbβ₃-CIB interaction. This demonstrates that α_IIb cytoplasmic domain loop-like conformation is required for interaction with CIB. Moreover, mutations of β₃ cytoplasmic domain residues Tyr-747 and/or Tyr-759 to phenylalanine residues (Y747F, Y759F, and Y747,759F) as well as residues Ser-752 to proline or alanine (S752P and S752A), do not affect the α_IIbβ₃ or α_Vβ₃ interaction with CIB. Since tyrosine residues Tyr-747 and/or Tyr-759 are the sites of tyrosine phosphorylation of β₃ subunit, these results suggest that the β₃ integrin-CIB interaction occurs through a β₃-phosphorylation independent mechanism. Likewise, ablation of conformation-dependent affinity change in β₃ Ser752Pro mutation had no affect on CIB-β₃ interaction. In summary, our results demonstrate that the α_IIb-subunit integrin and CIB interaction is non-exclusive and requires the loop-like α_IIb-cytoplasmic domain conformation. An interaction of CIB with α_V-containing integrins provides an additional role for this molecule in keeping with its expression outside of platelets.

1. Introduction

The Calcium Integrin Binding (CIB) protein is a 22-kDa intracellular member of the family of regulatory calciumbinding proteins that includes calmodulin, calcineurin B and recoverin. It was originally detected through the use of yeast two-hybrid systems as interacting specifically with the integrin α_IIb-cytoplasmic tail in the presence of calcium [1]. Various methods have subsequently confirmed this interaction in vitro [2-4] and in vivo [5]. This CIB-α_IIb interaction has been shown to promote the affinity of the α_IIbβ₃ integrin to fibrinogen [5]. Moreover, it has been shown that the association of CIB with integrin α_IIbβ₃ during outside-in signaling is required for platelet spreading on fibrinogen [6] through regulation of focal adhesion kinase (FAK) activation [7]. Furthermore, it was reported that CIB binds to the GTPase Rac3 and that co-expression of active Rac3 and CIB in Chinese hamster ovary (CHO) cells also expressing α_IIbβ₃ results in enhanced α_IIbβ₃-mediated cell adhesion and spreading on fibrinogen [8]. In addition to its interaction with the α_IIbβ₃ integrin, FAK and Rac3 regulatory functions, CIB may have other functions because it interacts with several diverse cytosolic proteins involved in neuronal function (FnK and Snk kinase) [9] and Alzheimer’s disease (Presenilin 2) [10].

A previous model based on homology modeling and nuclear magnetic resonance (NMR) studies suggests that the N-terminal domain of CIB containing positively charged amino residues could interact with the acidic C-terminal tail of α_IIb whereas the C-terminal domain of CIB could bind the α_IIb membrane proximal α-helix structure carrying the highly conserved GFFKR motif [4]. In yeast two-hybrid assays using fragments of CIB as bait or in intrinsic tryptophan fluorescence assays, the C-terminus of CIB serves as a site of interaction of CIB with the α_IIb cytoplasmic tail [3]. This study localized the CIB binding site on α_IIb to within a 15-amino acid residue stretch including residues within the membrane-splanning region as well as several residues within the membrane proximal region of the α_IIb cytoplasmic domain (from L983 to R997). Because the membrane proximal GFFKR motif of α_IIb is highly conserved among α integrin subunits, the specificity of the CIB-α_IIb interaction suggests the presence of a supplementary determinant involved in this exclusive relationship. The α_IIb and β₃ subunit cytoplasmic domains form α-helices and exhibit two-stranded coiled-coil structures in which there are several electrostatic and hydrophobic interactions [11,12]. The inhibition of these interactions is emerging as the molecular mechanism leading to the receptor activation and, through competition with α_IIb subunit in binding the β₃ subunit; CIB may contribute to this process. The α_IIb subunit cytoplasmic domain is organized in a “closed” conformation where the highly conserved N-terminal and membrane proximal GFFKR motif form an α-helix followed by a turn, and the acidic C-terminal loop interacts with the N-terminal helix. The substitutions of proline residues 998 and 999 with alanine residues generate an “open” conformation where the interactions between the N-terminal helix and C-terminal moiety are abolished, inducing receptor activation [13].

In the present study using K562 cells expressing mutated integrins, we report that, in addition to the N-terminal membrane proximal GFFKR motif, the acidic C-terminal of the α_IIb subunit cytoplasmic domain as well as the α_IIb “closed” conformation are important for the α_IIb- CIB interaction. Furthermore, we show for the first time that CIB also interacts with the α_V cytoplasmic domain. Moreover, mutations of tyrosine or serine residues on the β₃ subunit cytoplasmic domain, previously shown to prevent β₃ tyrosine phosphorylation or receptor activation, failed to prevent interaction with CIB. Together these data indicate that in K562 cells, in addition to the N-terminal GFFKR motif, the binding of CIB to the cytoplasmic domain is α_IIb cytoplasmic domain conformation dependent and is not α_IIbβ₃ specific, providing a basis for understanding CIB-integrin interaction in vivo and providing an additional role for CIB in non-platelet cell types.

2. Materials and Methods

2.1. Construction of Chimeric and Mutant Integrins

The human erythroleukemic cell line K562 transfected with cDNA encoding various mutated β₃ or truncated α_V integrin subunits were derived and maintained as previously described [14]. In addition, K562 cells were transfected with cDNA encoding full-length β₃ and with cDNA encoding either truncated or double substituted proline residues to alanine residues of the α_IIb cytoplasmic domain fused with the α_V extracellular moiety. Transfected cells were selected for expression by fluorescent cell sorting flow cytometry using mAb to α_V and β₃ as previously described [14]. The recombinants α_V/α_IIb, in which α_V cytoplasmic sequence has been replaced with the corresponding α_IIb sequence were prepared in the following way: human wild type α_IIb cDNA (a kind gift of Dr Ulhas P. Naik of the University of Delaware) was subjected to PCR using the IHY009 primer
5’CGAGGGGAGGTTACCGTGTGGACACAGCTG3’
introducing a new BstEII site (underlined) at the 2933 position and the IHY010 primer
5’GGCGGATCCATCACTCCCCCTCTTCATC3’
introducing a new Bam-HI site (underlined) at the 3210 position. After BstEII-BamHI digestion, the PCR generated product was ligated into pcDNA3.1 zeo (-) α_V digested with BstEII-BamHI, creating pcDNA3.1 zeo (-) α_V/CTα_IIb construct. Similarly, using α_IIb cDNA as template and the same forward and reverse primers;
5’CCTCTGGATCCTCTTCTTACAGGGGTGGC3’,
5’CATCTGGATCCAGGGGTGGCCGTTACCGCTTG3’
and
5’CCGGATCCGCTTGAAGAAGCCTTGACGTTCC3’,
5’GGCCGGATCCGCTTGAAGAATTAGACCTTCC3’,
we generated PCR products with new stop codons and BamHI sites at 3087 and 3096, 3078 and 3090, 3063 and 3077 positions respectively. As shown previously, using α_IIb cDNA as template and IHY009 with 5’GCGGAACCGGGCAGCCCTGGAAGAAGATG3’
and IHY010 with
5’CATCTTCTTCCAGGGCTGCCCGGTTCCGC3’ in a first round PCR we made PCR products which were then used as a template for nested PCR using IHY009 and IHY010 primers. These final products were digested with BstEII and BamHI and ligated in to pcDNA3.1 zeo (-) α_V/CTα_IIb digested with the same enzymes. These products, with β₃ cDNA, were stably expressed in K562 cells to generate Kα_V/α_IIbWTβ₃, Kα_V/α_IIb999β₃, Kα_V/α_IIb995β₃, Kα_V/α_IIb990β₃ and Kα_V/α_IIbPP998/999AAβ₃ mutants expressing α_V/α_IIbβ₃ integrin receptors having the extracellular α_V domain fused to the α_IIb transmembrane and cytoplasmic lacking the 9, 13 or 18 last amino acids or with the proline residues 998 and 999 mutated to alanine residues respectively. The mutations were assessed and confirmed for each mutant by DNA sequence analysis of the recombinant cDNA using the forward IHY009 primer in automated DNA sequencing analysis ABI 3100 Genetic Analyzer (SUNY Upstate Medical University, NY) and are depicted in Figure 1.

2.2. Cell Transfection and Flow Cytometry Analysis

K562 cells, an erythroleukemic, promonocyte cell line were grown in Iscove’s Modified Eagle’s Medium (IMDM) plus 10% fetal calf serum (FCS). About 1 × 10⁷ cells were washed twice with IMDM, resuspended in 500 μl of HEPES Buffered Saline containing 25 μg of each purified recombinant α_V/α_IIb subunit cDNA (in pcDNA3.1 expression vector carrying a zeocin resistance gene) and β₃ integrin cDNA (in pRc/RSV expression vector carrying a geneticin resistance gene). After incubation on ice for 10 min, cells were electroporated twice at 225 volts, 500 μF capacitance and 500 ohms and then resuspended in 10 ml of IMDM plus 10% fetal calf and incubated for 24 hrs. The cells were transferred into 10 ml of the same medium supplemented with 1.2 μg/ml of geneticin, incubated for 10 days and then in the same medium described above and also containing 1mg/ml zeocin. Transfected cells and populations of transfectants expressing high levels of integrins were obtained by fluorescence cell sorting using a mouse monoclonal anti-β₃ subunit antibody (mAb 7G2). The expression level of the recombinant receptors was maintained by periodic sorting with magnetic beads linked to an anti-β₃ subunit (mAb AP3) and anti-α_V subunit (mAb L230) and monitored by flow cytometry using the same antibody. Flow cytometry was carried out using a Coulter Epics XL flow cytometer (Coulter, Miami, FL).

2.3. Analysis of β₃ Integrin-CIB Interaction

K562 cells (10 × 10⁶) expressing equivalent amounts of transfected integrins were washed twice and resuspended in 300 μl of IMDM containing 100 μM sodium vanadate (Na₃VO₄) with 2.0 mM MnCl for 15 min and lysed in 500 μl phosphate buffered saline (PBS) containing 0.5% NP40, 200 mM CaCl₂, 150 mM NaCl, 1.0 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 2.0 mM Na₃VO₄. The lysates were centrifuged at 15,000 rpm for 10 minutes at 4˚C and then precleared with gelatin-Sepharose for 1 hour at 4˚C. Precleared lysates were then immunoprecipitated with goat anti-mouse-Sepharose beads (ICN, Cosa Mesa, CA) coated with either anti-β₃ (mAb 7G2) and anti-α_V (mAb 3F12) or anti-CIB (mAb UN2-NH) monoclonal antibodies for 4 h at 4ºC. Immunoprecipitates were washed and separated on 7.5% (for β₃ detection) or 12% (for CIB detection) SDS-PAGE. Electrophoresed proteins were transferred to polyvinylidene difluoride membranes. Equivalence of immunoprecipitated β₃-integrin or CIB was verified by probing immunoprecipitated products with anti-β₃ (mAb 7G2) or anti-CIB (mAb UN2-NH) monoclonal antibodies and visualized by enhanced chemiluminescence (ECL, Amersham Biosciences) and compared with prestained molecular weight markers (Rainbow, Amersham Biosciences).

2.4. Antibodies and Reagents

The monoclonal anti-β₃ integrin antibody 7G2 used in immunoprecipitation and β₃ western blotting was a gift from Dr. Eric J. Brown of UCSF. Monoclonal antibodies AP3 (anti-β₃), M148 (anti-α_IIb) and L230 (anti-α_V) have been used to assess the surface expression on transfected K562 cells as previously described [15]. The monoclonal anti-CIB antibody UN2-NH was a gift from Dr. Ulhas P. Naik of the University of Delaware. All other reagents unless otherwise noted were purchased from Sigma.

3. Results and Discussion

3.1. Expression of Mutant and Chimeric Integrins in K562 Cells

We have previously demonstrated that the tyrosine residues 747 and the 759 of the integrin β₃ cytoplasmic domain as well as the integrin α_V cytoplasmic tail are involved in the phosphorylation of β₃ integrins [14,15]. Likewise, others have shown that serine residue 752 is involved in β₃ integrin activation [16] and in β₃ integrinmediated FAK phosphorylation [17]. Moreover, CIB is considered to bind specifically to the α_IIbβ₃ integrin through interaction with α_IIb cytoplasmic domain [1]. β₃ phosphorylation and the conformational change associated with increased affinity are critical to β₃ function. Further, while CIB association is reportedly specific to α_IIb, CIB expression is not restricted to platelets.

In this study we sought to establish the role of α-subunit structure and β₃ activation motifs in CIB association with β₃ integrins. To that end, K562 cells expressing stable recombinants of α_V or α_IIb wild type integrin subunits associated with β₃ subunit bearing either phenylalanine (phe) substitutions of Tyr-747 (Kα_Vβ₃Y747F, Kα_IIbβ₃Y747F), Tyr-759 (Kα_Vβ₃Y759F, Kα_IIbβ₃Y759F), or both (Kα_Vβ₃-Y747/759F, Kα_IIbβ₃Y747/759F), proline (pro) substitution of serine (ser) residue 752 (Kα_Vβ₃S752P, Kα_IIbβ₃ S752A) or conservative alanine (ala) substitution of Ser-752 (Kα_Vβ₃S752A, Kα_IIbβ₃

S752A). We also used K562 cells expressing stable recombinants of wild type β₃ subunits associated with an α_V subunit where the cytoplasmic domain has been deleted (Kα_VNTβ₃) or fused with α_IIb transmembrane and cytoplasmic lacking off the 9 (Kα_V/α_IIb999β₃), 13 (Kα_V/ α_IIb995β₃) or 18 (Kα_V/α_IIb990β₃) last amino acids or bearing pro residues 998 and 999 substitution to Ala residues (Kα_V/α_IIbPP998/999AAβ₃) as depicted in Figure 1. Surface expression of the β₃ integrins was detected on cells transfected with cDNA encoding for mutated α_V, α_IIb or β₃. After several rounds of cell sorting, the FACS profiles of recombinants or wild types were similar with the exception of the mutants carrying α_V or α_IIb subunits where the deletion includes the membrane-proximal GFFKR motif (Table 1). This suggests that there are no obvious differences in the expression stability of the wild-type and various mutants and also confirms the involvement of the membrane-proximal GFFKR motif in efficient cell surface expression which has been shown by several reports to prevent either the heterodimerization of the α and β subunits [18,19] or their cell surface expression [20]. Moreover, when expressed in lymphocytes [20] or K562 cells [21], the deletion of this motif does not induce constitutive activation of the receptor (data not shown) in contrast with previous data of the receptor expressed transiently in CHO cells [22-24]. This suggests that the mechanism of integrin activation is cell type dependent.

3.2. Interaction of CIB with αβ₃-Integrin Cytoplasmic Domains

We previously showed that upon cell activation by a RGD peptide, the β₃ integrin becomes phosphorylated at Tyr747 in β₃ integrins associated either with α_IIb or α_V whereas the phosphorylation at Tyr759 residue occurs only when the β₃ integrin is associated with α_IIb suggesting a regulation of this critical biochemical event by the α subunits [15]. Manganese cation (Mn²⁺) can induce β₃ integrin activation and tyrosine phosphorylation [14]. Previous reports showed that the mutation of Ser752Pro limits β₃ integrin activation [16] and exposes a CIB binding site on α_IIb cytoplasmic domain [2]. To determine the involvement of β₃ cytoplasmic tyrosine and serine residues in the interaction of β₃ integrins with CIB, we used CIB blotting to examine immunoprecipitates from Mn²⁺ treated K562 cells expressing either α_V or α_IIb wild type subunits associated with wild type β₃ or β₃ bearing Phe substitutions at Tyr747 (Y747F) and Tyr759 (Y759F) both individually and concurrently (Y747,759F) or Pro (S752P) and Ala (S752A) substitution at Ser752. We show that CIB co-immunoprecipitates with all mutated β₃ subunits associated with α_V or α_IIb wild type (Figure 2). Therefore, in K562 cells, the CIB-β₃ integrin interaction is not α_IIbβ₃ specific, suggesting the ability of the α_V cytoplasmic domain to interact with CIB. To confirm this CIB-α_V interaction, we immunoprecipitated lysate from Mn²⁺ treated K562 cells expressing α_V in which the cytoplasmic domain had been deleted (Kα_VNTβ₃) in comparison with cells expressing wild type α_Vβ₃ (Kα_Vβ₃ WT) and α_IIbβ₃ (Kα_IIbβ₃ WT) as control. As shown in Figure 3(a), the deletion of the α_V cytoplasmic domain prevents the co-immunoprecipitation of CIB by anti-β₃ and anti-α_V antibodies, confirming that CIB interacts with a site in the α_V cytoplasmic domain.

Several reports have shown that CIB can interact with the α_IIb cytoplasmic domain by a calcium dependent mechanism and induce the activation of α_IIbβ₃ integrin; enabling α_IIbβ₃-mediated cell adhesion or spreading on fibrinogen [6,7]. The membrane proximal GFFKR motif of the α_IIb cytoplasmic domain has been shown to be a site of this interaction [3]. However, since this motif is highly conserved among α integrin subunits and since CIB is considered to interact specifically with the α_IIb

cytoplasmic domain, the CIB-α_IIbβ₃ interaction is probably mediated through a supplementary α_IIb cytoplasmic domain. As previously suggested by Hwang and Vogel [4], the α_IIb C-terminal LEEDDEEGE domain is suited to play this role. The current model of α_IIb cytoplasmic domain structure suggests a “closed” conformation where the highly conserved N-terminal membrane-proximal GFFKR motif forms a α-helix followed by a turn, and the C-terminal loop interacts with the N-terminal helix in an intramolecular interaction [11]. The substitution of α_IIb cytoplasmic domain residues Pro998 and Pro999 with alanine residues has been shown to convert this structure to an “open” conformation; inducing the α_IIbβ₃ activation [13]. To assess the involvement of those different α_IIb cytoplasmic domains or their conformation in the α_IIb-CIB interaction, we immunoprecipitated β₃ from Mn²⁺ treated K562 cells expressing α_IIbβ₃ (Kα_IIbβ₃) or chimeric α_V/α_IIbβ₃ integrin receptors bearing the extracellular α_V domain fused to the α_IIb transmembrane and cytoplasmic domain full length (WT) or lacking the final 9 (999), 13 (995) or 18 (990) last amino acids or with the residues Pro998 and Pro999 substituted by Ala residues (PP/AA). Blotting with anti-CIB antibody (UN2-HN) reveals that CIB can interact only with the full-length α_IIb cytoplasmic domain with the native conformation. Thus, the deletion of only last 9 last amino acids (LEEDDEEGE) forming the acid C-terminus (999) or with the conserved motif GFFKR prevents the interaction of the α_IIb cytoplasmic domain with CIB suggesting that both domains are involved in this interaction. Interestingly, the destruction of the α_IIb cytoplasmic domain conformation by the substitution of residues Pro-998 and Pro-999 by Ala residues (PP/AA) also inhibits this interaction (Figure 3(b)). Thus, more than the presence of LEEDDEEGE and GFFKR domains, the interaction of CIB with the α_IIb cytoplasmic domain requires its native conformation. Using the K562 cells expressing chimeric α_V/α_IIbβ₃ integrins with α_IIb cytoplasmic domain bearing the deletions or mutations mentioned above, we confirmed these observations by immunoprecipitating the cell lysates with beads coupled to anti-CIB (UN2-NH) and then blotted the transferred proteins with an anti-β₃ antibody. In these reverse immunoprecipitations, CIB association with β₃ required the entire cytoplasmic tail in native conformation (Figure 4).

Previous evidence suggests that CIB induces the activation of the α_IIbβ₃ integrin by interacting specifically with the α_IIb cytoplasmic tail. In the present work, we show that CIB can be co-immunoprecipitated with β₃ integrin associated with α_V or α_IIb, suggesting a non-exclusive interaction. This observation has been confirmed by the inhibition of the CIB interaction by the deletion of α_V cytoplasmic domain. The comparison of the α_IIb and α_V cytoplasmic tail sequences reveals a few similarities. Both α subunits retain the WKxGFFKR motif that is thought to be CIB binding site [2,4]. In addition, both α subunits contain a PP motif and a very acidic sequence. These two features distinguish α_V and α_IIb from all other α subunits. Although the WKxGFFKR motif of α_IIb cytoplasmic domain is considered as necessary for the CIB binding, it is unlikely to be the unique factor determining this interaction since this motif is common to all α subunits. We show here that the deletion of the distal domain LEEDDEEGE (mutant 999), previously considered as a potential site for interaction with the N-terminus of CIB [4], prevents the co-immunoprecipitation with the dimeric integrin. As expected, the deletion of the membrane proximal domain GFFKR (mutant 995) also prevents this coimmunoprecipitation. Our data suggest a simultaneous participation of these two α_IIb cytoplasmic domains in the interaction with CIB. Moreover, we show here that, even in the presence of these domains, this interaction requires the native α_IIb cytoplasmic domain conformation suggesting that the spatial disposition of the α_IIb binding sites of CIB is also a determinant of this interaction.

It has been shown that α_IIb-CIB interaction is calcium dependent [1] and a model suggests that the α_IIb cytoplasmic domain contains a high affinity cation binding site [25]. Additionally, Vinogradova et al. have proposed that calcium binding to α_IIb cytoplasmic domains is determined by intramolecular interaction between the residues Arg997, Glu1001, Asp1003, and Asp1004 of the native conformation [26]. Since the substitution of residues Pro-998 and Pro-999 by Ala residues (PP/AA) inducing the “open” conformation provokes the destruction of these intramolecular interactions, the inhibition of the CIB-α_IIb interaction could be due to inability of the PP/AA mutant to bind calcium cations. The α_IIb-β₃ interaction is thought to maintain the receptor in a low affinity state through a transmembrane subunit contact domain and GFFKR juxta-transmembrane region and to be calcium dependent [25]. A structural study suggests that

the calcium cation is likely to enhance and stabilize the intramolecular interactions of the α_IIb cytoplasmic domain but is not essential for the α_IIb-β₃ interaction. However calcium stabilizes the αβ complex in low-affinity states [27] by decreasing the dissociation rate [2].

We previously showed that β₃-tyrosine phosphorylation requires the α_V cytoplasmic domain [14] and can be regulated differentially when the β₃ subunit is associated with α_IIb or α_V [15]. This clearly indicates that this critical biochemical process is regulated by the α subunit cytoplasmic domain; probably through steric hindrance determining the access of β₃ subunit cytoplasmic sites for its protein binding partners required for post-ligand events. The incomplete homology between α_IIb and α_V cytoplasmic domain suggests two different conformations generating two different steric hindrances. Therefore, the PP/AA mutation of α_IIb cytoplasmic domain gives a new tool to explore the influence of the steric access to β₃ cytoplasmic domain interacting proteins. Regardless, the previously reported selective association of CIB with α_IIb does not hold true in this hematopoietic cell system and does not offer a mechanism to explain α-subunit regulation of β₃ tyrosine phosphorylation. Naik et al., in the yeast two-hybrid system, using the α_IIb cytoplasmic domain as “bait,” showed that CIB interacts specifically with the α_IIb cytoplasmic domain [1]. Here, we show that this interaction is not α_IIb exclusive and suggest that cell environment is a factor determining the α cytoplasmic domain interaction specificity. A recent work suggests that CIB may exist in multiple structural and metal ion-bound states in vivo, which may also play a role in its regulation of target proteins such as platelet integrins [28]. A third partner could also be involved since Rac3 and the polo-like kinase Skn have been shown to interact with CIB [8,9].

4. Acknowledgements

We thank Matthew P. Williams for his excellent technical assistance in cell transfection and sorting. This work was supported by NIH DK79884 awarded to Scott D. Blystone and an American Heart Postdoctoral Fellowship awarded to Innocent H. Yamodo.

REFERENCES

NOTES

^*Corresponding author.