We examined 50 Escherichia coli ( E. coli ) strains isolated from broiler chickens between January 2013 to March 2014 in order to evaluate the epidemiological prevalence of avian pathogenic E. coli (APEC) in Jordan by multiplex PCR and random amplification of polymorphic DNA (RAPD) tests. The multiplex polymerase chain reaction (PCR) which was used as tentative criteria of APEC targets 8 virulence associated genes; enteroaggregative toxin (astA), Type 1 fimbria adhesion (fimH), iron-repressible protein (irp2), P fimbriae (papC), aerobactin (iucD), temperature-sensitive hemagglutinin (tsh), vacuolating autotransporter toxin (vat), and colicin V plasmid operon (cva/cvi) genes. The number of detected genes could be used as a reliable index of their virulence. E. coli strains already typed as an APEC always harbor 5 to 8 genes, but non-APEC strains harbor less than 4 genes. Assuming the criteria of an APEC is possession of 5 or more virulence associated genes; we found that all 50 E. coli strains were classified as APEC strains. The RAPD analysis showed that the E. coli strains could be grouped into 35 of RAPD types by using these two different RAPD primer sets, RAPD analysis primer 4 5'AAGAGCCCGT5', and RAPD analysis primer 6 5'CCCGTCAGCA3'. The current study confirmed the endemic nature of APEC in broiler flocks in Jordan. It is essential that the biosecurity on poultry farms should be improved to prevent the introduction and dissemination of APEC and other agents. Furthermore, farmers need to be educated about the signs, lesions, and the importance of this agent.
Escherichia coli (E. coli) is one of the most common and important avian bacterial pathogens and infections caused by E. coli are responsible for significant economic losses to the poultry industry. E. coli also causes in- testinal and extra intestinal diseases in domestic and wild animals which lead to severe economic losses through- out the world [
In this study, we screened 50-field E. coli isolated from broiler chickens between January 2013 to March 2014 in order to evaluate the epidemiological prevalence of APEC in Jordan by the multiplex PCR and RAPD tests.
A total 50 avian E. coli strains were isolated from broiler chickens of different ages (hatching up to 5 weeks) in Jordan between January 2013 to March 2014 in Provimi Jordan lab. The E. coli strains were recovered from the livers of broilers that had died from colibacillosis. Before death, chickens had shown different signs of E. coli infection including septicemia and respiratory infections, with pathological finding, such as air sacculitis, hepatitis, pneumonia, pericarditis, and yolk sac infections. The respective isolates were cultured on 5% horse blood and MacConkey agar. E. coli strains were stored in tryptone soy broth (Oxoid, Hampshire, UK) with 15% glycerol at −70˚C.
All E. coli strains were cultured on 5% horse blood agar. An agar plate with a pure culture was prepared; and a single colony from each plate was resuspended, washed twice in 150 µl of sterile distilled water, and boiled for 10 min. The suspension was then chilled on ice for 5 min, and the supernatant collected after centrifugation at 13,000 rpm for 5 min in a microcentrifuge (Biofuge; Heraeus Instruments, Langenselbold, Germany).
All E. coli strains were examined for genesenteroaggregative toxin (astA), Type 1 fimbria adhesion (fimH), iron- repressible protein (irp2), P fimbriae (papC), aerobactin (iucD), temperature-sensitive hemagglutinin (tsh), vacuolating autotransporter toxin (vat), and colicin V plasmid operon (cva/cvi) genes by using primer pairs (Alpha DNA, Montreal, QC, Canada) previously evaluated in previous studies and are listed in
Two different primers (Amersham Pharmacia Biotech) previously reported [
To confirm the reproducibility of the method, each strain was assayed four times by two different operators who used newly prepared samples and who tested all primers each time. All other experimental conditions remained unchanged, and a result was considered valid when the same pattern was obtained at least three times. The bacterial strains were analyzed with each of the two primers in at least two independent reactions and the banding patterns obtained by at least two runs were considered as a fingerprint for that particular isolate. Different banding profiles were designated by letter codes.
Polymerase chain reaction products were electrophoresed on a 2% agarose gel in Tris-acetate-EDTA buffer (40 mM of Tris and 2 mM of EDTA, with a pH value of 8.0) containing ethidium bromide (Promega Corp., Madison, WI, USA) for 1 hour min at 100 V and visualized under UV light (AlphaImager, AlphaInnotech, San Leandro, CA). A 50 bp ladder plus maker (NewEnglands) was used as a molecular weight standard. A digital image of the gel was captured in a computer, and the amplification patterns were evaluated by visual examination of inverted gel pictures.
No | Virulent Gene | Primer Sequences | Location within Gene | Size (bp) | Primer References |
---|---|---|---|---|---|
1 | astA | 5'TGCCATCAACACAGTATATCC3' 5'TCAGGTCGCGAGTGACGGC3' | 797 ~ 817 912 ~ 894 | 116 | [ |
2 | vat | 5'TCCTGGGCATAATGGTCAG3' 5'GTGTCAGAACGGAATTGT3' | (−)10 ~ (−)28 282 ~ 264 | 981 | [ |
3 | irp2 | 5'AAGGATTCGCTGTTACCGGAC3' 5'AACTCCTGATACAGGTGGC3' | 22 ~ 42 434 ~ 416 | 413 | [ |
4 | papC | 5'TGATATCACGCAGTCAGTAGC3' 5'CCGGCCATATTCACATAA3' | 1284 ~ 1304 1784 ~ 1767 | 501 | [ |
5 | iucD | 5'ACAAAAAGTTCTATCGCTTCC3' 5'CCTGATCCAGATGATGCTC3' | 239 ~ 259 952 ~ 934 | 714 | [ |
6 | tsh | 5'ACTATTCTCTGCAGGAAGTC3' 5'CTTCCGATGTTCTGAACGT3' | 132 ~ 151 955 ~ 937 | 824 | [ |
7 | CvaA/B cvi cvaC | 5'TGGTAGAATGTGCCAGAGCAAG3' 5'GAGCTGTTTGTAGCGAAGCC3' | 1076 ~ 1095 2056 ~ 2038 | 1181 | [ |
8 | fimH | 5' GGATAAGCCGTGGCCGGTGG 3' 5' CTGCGGTTGTGCCGGAGAGG 3' | 215 ~ 235 671 ~ 691 | 331 | [ |
Each isolate was scored for the presence or absence (1 or 0) of each band on agarose gel. The index of similarity (F) between samples was calculated using the formula [
Association between genes and RAPD patterns were tested by use of the chi-square test.
Assuming the criteria of an APEC is possession 5 or more virulence associated genes (Ewers et al., 2005); we found that all 50 E. coli strains were classified as APEC strains (
Analysis of RAPD banding patterns of 50 isolates revealed a total of 35 distinct patterns (C1 to C35)
Previous investigations have indicated that the distribution of various virulence factors are useful markers for the detection and characterization APEC, and could therefore, be used in the diagnosis of colisepticemia in poultry [
Presences of Virulence-Associated Genes in E. coli Strains | RAPD Profiles1 | Cumulative RAPD2 Profiles Based on Two Primes | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Strain No | fimH | vat | tsh | iucD | papC | irp2 | cav/cvi | astA | Total No of Virulence Associated Genes | Primer 4 | Primer 6 | |
1 | + | + | + | + | − | + | + | + | 7 | A1 | B1 | C1 |
2 | − | + | + | + | − | + | + | − | 5 | A1 | B1 | C1 |
3 | + | + | + | − | − | + | + | − | 5 | A1 | B1 | C1 |
4 | + | + | − | + | − | + | − | + | 5 | A1 | B2 | C2 |
5 | + | − | + | + | − | − | + | + | 6 | A2 | B3 | C3 |
6 | + | + | − | + | − | + | − | + | 5 | A3 | B4 | C4 |
7 | + | + | − | + | + | + | + | − | 5 | A4 | B5 | C5 |
8 | − | − | + | + | + | + | − | + | 5 | A5 | B6 | C6 |
9 | + | − | + | − | − | + | + | + | 5 | A5 | B6 | C6 |
10 | + | + | + | + | − | + | + | − | 5 | A6 | B6 | C7 |
11 | + | + | + | − | − | + | + | − | 5 | A7 | B7 | C8 |
12 | + | + | − | + | − | − | + | + | 5 | A8 | B7 | C9 |
13 | + | + | + | − | − | + | + | + | 6 | A9 | B7 | C9 |
14 | + | + | − | + | + | + | + | − | 6 | A9 | B8 | C10 |
15 | + | + | + | + | − | + | − | + | 5 | A10 | B8 | C11 |
16 | + | + | − | + | − | + | − | + | 5 | A10 | B9 | C12 |
17 | + | − | + | + | − | + | + | − | 5 | A11 | B10 | C13 |
18 | + | + | − | + | − | + | + | − | 5 | A12 | B11 | C14 |
19 | + | + | − | + | + | + | + | + | 6 | A12 | B12 | C15 |
20 | + | − | + | + | + | − | + | + | 5 | A12 | B13 | C16 |
21 | + | + | − | + | − | − | + | + | 5 | A13 | B13 | C17 |
22 | + | + | + | − | − | − | + | + | 5 | A14 | B13 | C18 |
23 | + | − | + | − | + | + | + | − | 5 | A15 | B14 | C19 |
24 | + | + | + | − | + | + | + | − | 6 | A16 | B15 | C20 |
25 | + | + | + | + | − | − | + | + | 5 | A17 | B15 | C21 |
Presences of Virulence-Associated Genes in E. coli Strains1 | RAPD Profiles2 | Cumulative RAPD3 Profiles Based on Two Primes | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Strain No | fimH | vat | tsh | iucD | papC | irp2 | cav/cvi | astA | Total No of Virulence Associated Genes | Primer 4 | Primer 6 | |
26 | + | + | + | + | − | + | + | + | 6 | A18 | B15 | C22 |
27 | + | + | + | + | − | − | + | − | 5 | A19 | B15 | C23 |
28 | + | + | + | + | + | + | − | 5 | A19 | B16 | C24 | |
29 | + | − | + | + | + | − | + | + | 5 | A19 | B16 | C24 |
30 | + | + | − | + | + | − | + | + | 5 | A20 | B17 | C25 |
31 | − | + | − | + | + | + | + | + | 6 | A21 | B18 | C26 |
32 | + | − | − | + | + | + | + | − | 5 | A22 | B18 | C27 |
33 | + | + | − | + | + | + | − | + | 6 | A23 | B19 | C28 |
34 | + | − | + | + | − | + | − | + | 5 | A23 | B20 | C29 |
35 | + | − | + | + | + | − | + | + | 5 | A23 | B20 | C29 |
36 | + | + | − | + | + | + | + | − | 6 | A23 | B20 | C29 |
37 | + | + | + | + | − | + | + | − | 5 | A23 | B20 | C29 |
38 | + | + | + | − | − | + | + | + | 6 | A23 | B20 | C29 |
39 | + | − | + | − | + | − | + | + | 5 | A24 | B21 | C30 |
40 | + | − | + | + | + | − | + | − | 5 | A24 | B21 | C30 |
41 | + | + | + | − | + | + | − | + | 6 | A25 | B22 | C31 |
42 | + | + | − | + | − | + | − | + | 5 | A25 | B22 | C31 |
43 | + | + | + | + | + | + | − | + | 7 | A26 | B23 | C32 |
44 | + | + | + | + | + | − | + | + | 7 | A27 | B24 | C33 |
45 | + | − | + | + | + | + | − | + | 5 | A28 | B25 | C34 |
46 | + | − | + | + | + | + | + | − | 5 | A28 | B25 | C34 |
47 | + | + | + | + | + | + | − | + | 7 | A28 | B26 | C35 |
48 | + | − | + | + | − | + | − | + | 5 | A28 | B26 | C35 |
49 | + | + | − | + | + | − | + | − | 5 | A28 | B26 | C35 |
50 | + | + | − | + | + | + | + | − | 6 | A28 | B26 | C35 |
1+ and –, gene detected and undetected, respectively, by PCR. 2A1-A28 and B1-B26 represent the different RAPD fragment patterns with respect to each primer. 3C1-C35 represents the different RAPD fragment patterns based on two primers primer.
We tentatively determined that the criteria of APEC were harboring of more than 5 virulence-associated genes as previously reported [
The gene fimH was predominantly distributed among all genes. The high prevalence of type I fimbriae in this study (94%) is in accordance with published data [
The genepapC, indicating the existence of the papC operon, was present in 50% of all investigated strains. P-fimbriae are known to adhere to internal organs and to protect the E. coli from antibacterial action of neutrophils [
Tsh and vat genesencodes an auto-transporter protein which shows similarity to a subclass of the IgA protease family [
Irp2 and iucD, both related to iron acquisition system [
AstA was found to be widely distributed among different categories of diarrheagnic E. coli in humans and animals, and the toxin was also expressed by 38% of none pathogenic E. coil strains [
Herein data also represented the importance of colicin V plasmid operon (cva/cvi) gene. Colicin Vplasmids were found primarily among virulent enteric bacteria and have been shown to encode several virulence related properties in addition to colicin V [
The RAPD analysis results presented here show that the 50 avian E. coli strains collected from broiler chickens in Jordan could be differentiated into 35 different RAPD sub-types with five major clusters designed (A-D). No association was observed between virulence genes possession and RAPD patterns.
RAPD results of this study revealed that avian E. coli genetically very heterogenic. This result is in agreement with results of Chansiripornchai et al. [
In RAPD analysis, Maurer et al. [
In conclusion, by utilizing such diagnostic techniques, it is possible to conduct a detailed epidemiological study to determine the full economic effect of colibacillosis. Future research can be done to try and establish an in vivo chicken infection model to determine the actual pathogenicity of the strains used in the present study for the correlation of the virulence gene RAPD profiles with pathogenicity in chickens.
This study was funded by Provimi Jordan (a Cargill Company). The author wishes to thanks all members of Provimi Jordan lab staff.