Chicken anaemia virus (CAV) causes a viral disease in chickens worldwide and thus has economic importance. The main aim of this study was to develop a rapid, sensitive and specific VP1-CAVI indirect ELISA for the detection of CAV infection. The CAV-VP1, was separately cloned and expressed in recombinant E. coli. The purified recombinant CAV-VP1 protein was then coated as an antigen on an ELISA plates to evaluate its reactivity against chicken sera. The resulting indirect ELISA was then compared with a commercial ELISA. The specificity and sensitivity of the indirect ELISA were measured as 93.3% and 100%, respectively. A t-test produced a t-value of 15.805 for the indirect ELISA and revealed a significant difference between CAV-positive serum and CAV-negative serum (p-value of 0.001). For the second variable (i.e., a commercial ELISA), the t-test yielded a t-value of 5.063, which revealed a significant difference between CAV-positive serum and CAV-negative serum (p-value of 0.015). This intervention produces statistically significant improvements in both variables (p-values < 0.05). The correlation coefficient for the indirect ELISA was r = 0.93. Therefore, this work can be considered as a new achievement in diagnosis for Chicken anaemia virus in chicken flocks.
Chicken anaemia virus (CAV) is an important disease infecting chicken worldwide. It kills chicken by causing plastic anaemia in chicken [
However, economic losses of anaemia dermatitis syndrome can be attributed to many factors such as: stem from increased animal mortality rates, the cost of antibiotics used to control secondary bacterial infections and poor animal growth as described by Mcllory et al. [
Several methods have been employed to develop conventional assays to detect CAV infection, such as serological tests for the identification of CAV antibodies. Recently, immune-histochemistry (IHC) and immunofluorescence (IF) have been used as alternative methods for detecting CAV antigen [
The aim of this study was to develop an indirect ELISA coated with VP1-CAV antigen that is more sensitive and specific for the detection of Chicken Anaemia Virus (CAV). Enzyme-linked immunosorbent assay (ELISA) is a serological detection technique that is based on the use of enzyme-labelled antigens and antibodies where the resulting conjugates have both immunological and enzyme activity. The antigen-antibody complex becomes immobilised by having one component (either antigen or antibody) labelled with enzyme and bound to the immunosorbent support [
The VP1-CAV gene of the chicken anaemia virus (CAV) was amplified from CAV DNA extracted from paraffin-embedded tissues.
A pair of primers based on the published nucleotide sequence of the VP1-CAV Malaysian isolate was prepared. The primer sequences are as follows: forward 5’GGGGTACCCCATGGCAAGACGAGCTCGCAGA3’ and reverse 5’TACATGACCCCCTGCGTCGGGCCTTAAGGC3’. These primers were used with KpnI and EcoRI, respectively, and were used to obtain a full-length VP1-CAV fragment (1.4 kb) from the VP1-CAV isolate. Additionally, VP1-CAV-CAV was sub-cloned into the pet47b plasmid with different sets of primers and was then transformed into E. coli DE21 for expression. The reaction was carried out in 50 ml volumes containing 1 ml of each primer (5 mM), ten ml of 10X reaction buffer (promega, USA), 2 ml of dNTPs (Promega, USA), and 2 ml of taq polymerase (Promega, USA), followed by 5 ml of MgCl2 (2.5 mM) and adjusted to 50 ml with distilled water.
The mixture was mixed thoroughly by vortexing and was then briefly spun down. The PCR cycle profile was as follows: a denaturing temperature of 94˚C for 5 min, then 5 cycles of 94˚C for 1 min followed by an annealing temperature of 74˚C for 2 min and an extension temperature of 72˚C for 2 min; t these steps were followed by 25 cycles of 94˚C for 1 min, 60˚C for 1 min and 72˚C for 1 min and 30 sec. Prior to gel electrophoresis, the PCR products were analysed by running 10 ml of the PCR reaction on a 1% agarose gel by electrophoresis. The remaining samples were stored at −20˚C for later use.
One ligation reaction was prepared. The prset-b vector (Invitrogen, usa) and the VP1-CAV-CAV insert was ligated in a reaction mixture containing 1 ml (80 ng/ml) of KpnI- and EcoR1-digested vector, 3 ml (40 ng/ml) of VP1-CAV-CAV insert, 1 ml of 10X ligation buffer and 1 ml of T4 dna ligase (0.4 Weiss unit) (New England Biolabs, Inc.). The final volume of each reaction mixture was adjusted with distilled water to 10 ml, and the reactions were incubated at 16˚C overnight. Using the same procedure, a separate ligation reaction was prepared using Pet47b (Novagen, Germany).
These cloning mixtures were transformed into competent cells using the following heat shock method: competent bacteria cells were mixed with 2 ml of ligated plasmid containing the VP1-CAV gene and were placed on ice. The mixture was stirred gently and incubated on ice for 30 min and then incubated in a water bath at 42˚C for 90 sec. The incubated mixture was then placed immediately on ice. Lb broth (250 ml) was added to the mixture and incubated at 37˚C for 1 hour. Fifty and 100 ml of the mixture were spread on culture plates and were incubated overnight. On the following day, several colonies were picked from the plates and were inoculated into 25 ml LB broth. The colonies were then analysed by a double digestion of the recombinant plasmid with restriction enzymes (EcoRI and KpnI) for further confirmation of positive cloning. The insertion of the gene was further investigated by PCR amplification and double restriction enzyme digestion of the VP1-CAV gene.
Twenty ml of bacterial stock was placed into 25 ml LB medium, which was then incubated at 37˚C for 18 - 24 hours until the optical density (OD600) reached 0.6. LB medium (250 ml) was added to the culture and incubated for 5 hr to (OD600) 2.0. IPTG (0.1 mM) was added to induce VP1-CAV protein expression, and the mixture was incubated for another 5 hours. Bacterial cells were harvested by centrifugation at 12,000 rpm at 4˚C for 30 min. The cell pellet was resuspended in hepes, pH 7.6. To lyse the cells, the suspension was sonicated using a sonicator. The cell suspension was then washed with distilled water. The cell suspension was spun at 12,000 rpm for 30 min, and the purity and concentration of the supernatant containing soluble VP1-CAV protein was measured as 10 mg/ml. The sample was loaded into SDS polyacrylamide gel electrophoresis and run at 100 V for 1.5 hours. The gel was stained with Coomassie Blue (0.1% Coomassie Blue, 40% methanol and 10% glacial acetic acid) and then destained with buffer (10% methanol and 10% glacial acetic acid) overnight.
The protein gel was transferred to a PVDF membrane (Immobilon-P, Millipore Corp, USA) for western blot analysis using a semi-dry electro-blotting system (Bio-Rad Laboratories, USA) for 45 min at 15 V in transfer buffer (25 mM Tris-Base, 192 mM glycine, and 20% (w/v) methanol). The membrane was blocked with blocking buffer (1% bovine serum albumin in PBS) for one hour and washed in washing buffer (0.05% Tween 20 in PBS). The membrane was then incubated with an anti-VP1-CAV monoclonal antibody (Trop Bio) for two hours in blocking buffer at 37˚C with gentle mixing. The membrane was washed three times in washing buffer for 5 min and incubated with a conjugated antibody (goat anti-mouse IgG-AP (BioRad) for two hours at 37˚C. The conjugated antibody was prepared in blocking buffer containing 100 mM Tris and 150 mM NaCl. The membrane was washed, and the DAB substrate was then added to the membrane. After 5 min, the reaction was stopped by adding distilled water. The membrane was examined for the correctly sized protein band (50 kDa).
The indirect ELISA test was carried out as previously described by Todd [
The cav serum samples (n = 100) were obtained from 8 farms (chicken village). The sera were detected using a commercial ELISA kit (I-DEXX, Australia). The commercial ELISA kit employed antigens to the entire CAV protein. The serum samples were used to establish and evaluate the new indirect ELISA, which uses recombinant VP1 protein as an antigen. Serum samples were diluted 1:100 in washing buffer. Sera from SPF chickens were used as negative controls.
The CAV-coated antigen plate was prepared and used to detect the presence of CAV antibodies. Negative serum (100 ml) was added to plates A1 and A2, while 100 ml of positive serum was added to plates A3 and A4. Additionally, 100 ml of the diluted serum samples (1:50) was added into each well, and in duplicate plates, which were then incubated at 37˚C for 60 min. The plates were then washed three times with 350 ml of washing solution. Goat anti-chicken horseradish peroxidase conjugate (100 ml) was then added to each well, and the plate was incubated at 37˚C for 30 min and then washed with washing solution. A volume of 100 ml of the TMB substrate was added to each well, and the plate was incubated for 15 min at room temperature. The absorbance was then read by an ELISA reader (dynatech, MR7000, USA) with the absorbance value set at a wavelength of 650 nm. The evaluation of a commercial IDEXX ELISA was carried out using xChek software (IDEXX Laboratories). The presence or absence of antibody recognising CAV was determined by the sample to negative (S/N) ratio for each sample by the following:
Purified VP1 protein was diluted in 0.05 M coated buffer (Appendix D2) at dilutions 1:10, 1:50 and 1:100 (v/v). One hundred ml of each diluted antigen was coated onto the plates, and the plates were then covered with parafilm paper and incubated at 4˚C overnight. The coated plates were then washed three times with washing buffer (Appendix D3). The plates were tapped dry. The plates were then blocked with 100 ml of 2% bovine serum albumin (BSA) (prepared in washing buffer) overnight at 4˚C and were then washed three times with washing buffer.
The goat anti-chicken IgG-HRP (KPL, USA) conjugate was used in the ELISA test. The conjugate was diluted in washing buffer at 1:1000, 1:2000, 1:4000, 1:8000 and 1:16,000. The optimum incubation reaction time was then determined.
A threshold should be determined to evaluate the performance of an ELISA. A total number of 23 negative sera were obtained from SPF chickens. The mean OD was calculated, and the standard deviation (SD) was then determined. The threshold for the OD level was determined as the following: threshold OD level = mean OD + 3SD.
Three sera were used as reference sera in serial dilutions to obtain the standard curve. The following serial dilutions were made: 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12,800, 1:25600, 1:51,200, 1:102,400, 1:409,600, 1:819,200, 1:1,638,400 and 1:3,276,800. The serum ODs of the three reference sera were 0.75, 0.812 and 0.852, respectively, as measured with the IDEXX commercial ELISA kit (IDEXX, Australia). The reference sera were diluted with washing buffer. The negative sera from SPF chickens were diluted at 1:500 and used as negative controls. The positive sera from the SPF chickens, with ODs measured by IDEXX, were diluted at 1:500 and used as positive controls. Two wells per plate were used for each positive and negative control. When the test assays were run, the absorbance value for the serially diluted individual reference sera were obtained and then converted to sample-to-positive (S/P) ratio values according to the following:
The standard curve relating optical density (OD650) to S/P was obtained. The curve regression estimation was calculated using the software of statistical programme for social science (spss, 1999, version 10.0) to generate the regression equation line from the indirect ELISA standard curve.
Diluted VP1 protein of 1:100 (100 ml) was coated into each well, covered with parafilm paper and incubated at 4˚C overnight. The plate was then washed three times with washing buffer. The plate was tapped to dry and blocked with 100 ml of 2% BSA (prepared in washing buffer) and incubated at 37˚C for 2 h. The plate was washed again with washing buffer three times. The diluted serum samples of 1:100 were added to each well and incubated at 37˚C for 90 min. The plate was then washed with washing buffer three times. Goat anti-chicken IgG-HRP conjugate (100 ml) diluted at 1:8000 was then added to each well. The plate was then incubated at 37˚C for 1 hour and then washed three times with washing buffer.
The substrate tetra methybenzidine (TMB) was used for the enzyme reaction. The substrate and peroxidase solution B (KPL, USA) were mixed in equal volumes immediately prior to use. A total 100 ml volume of the substrate was added to each well and the plates were incubated for 10 min at room temperature. The reaction was then measured using an ELISA reader (dynatech, MR7000, USA) at a 650 nm absorbance.
The serum samples of other avian viruses, namely, Newcastle disease virus (NDV) and infectious bursal disease virus (ibdv) were used as controls to determine the specificity of the indirect ELISA.
The sensitivity and specificity was calculated using the formulas given by Anon [
or
or
These two equations were used in
Primers for VP1-CAV gene amplification were derived from published complete sequences of a CAV isolate. Both primers were designed to amplify the full-length VP1-CAV gene. The first strand of the VP1-CAV gene was successfully synthesised using PCR amplification and optimised with a MgCl2 concentration of 2.5 mM. The PCR products were 1.4 kb, similar to the expected size of the published CAV isolate (
. Calculations for sensitivity and specificity
Screening Test | Positive for CAV | Negative for CAV | |
---|---|---|---|
Positive for CAV | a | b | Sensitivity a/(a + c) × 100 |
Negative for CAV | c | d | Specificity d/(b + d) × 100 |
Total | (a + c) | (b + d) |
Lane M is a 1 kb marker. Lanes 1 and 2 consist of a 1.4 kb PCR product of the VP1 gene
indeed specific.
Recombinant plasmid DNA was transformed into E. coli top 10 and E. coli BL12 DE3 cells by the heat shock method. The PCR product was inserted within the lacz gene, which resulted in the insertional inactivation of the gene. The transformants containing a putative VP1-CAV-CAV fragment could only produce white colour colonies. The next step was to clone VP1-CAV into the pet47b plasmid and transform the resulting plasmid into E, coli BL12 DE3 for expression. Transformants were screened by PCR with two primer sets (
The VP1-CAV protein can diffuse and be lost during treatment with acetic acid and methanol, which follows staining with Coomassie Blue. Therefore, expression of the VP1-CAV protein was further confirmed by western blot analysis using a PVDF membrane, as shown in
PCR screening on 15 white colonies. Eleven colonies were positive for the 1.4 kb product of the VP1 gene inserted into the pET47B plasmid. Lane M is a 1 kb marker. Lanes 1 - 11 are white colonies that are positive for the 1.4 kb VP1 gene product. Lanes 11 and 15 consist of white colonies that were cloned into the pet47b plasmid
VP1-CAV fusion protein, regardless of whether the latter is purified or is from a crude extract. A protein with a molecular weight of 50 kDa was detected and found to correspond in size to the band detected by SDS-PAGE. No proteins were detected in the supernatant of non-induced cultures, which is shown in
Antigen optimisation was carried out in
Conjugate optimisation was carried out in
A threshold od value of 0.1375 was established to determine whether the ELISA result was positive or negative by obtaining background values using laboratory chicken serum. The calculated mean OD value was 0.1375 with an SD value of ±0.0381. The threshold OD was 0.2520 (the mean OD plus three times the SD).
The standard curve of the new indirect ELISA is shown in
(a) pet47b plasmid contains C-terminal thrombin recognition site followed by an S∙Tag™ coding sequence. Unique restriction sites are shown on the circle map. Also, the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circle map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown; (b) The flowchart shows the steps of cloning and expression of the VP1-CAV inserted into pET47b plasmid. VP1 gene inside the pET47b plasmid was transformed into DE21 bacterial competent cell. Gene positive cloning was detected using double digestion and PCR tests also protein expression inside the bacterial system was detected using SDS-PAGE and western blot
Nucleotide sequence alignment of the VP1 gene of CAV UPM isolate compared to published CAV69548 nucleotide sequence. The sequence of the VP1 gene (from nucleotide 1 - 263) from the published CAV69548 sequence is compared to the consensus sequence. A dot indicates the position where the sequence is identical to that of the consensus sequence. The identity was 100%
(a) Expression of the recombinant VP1 protein in E. coli on a Coomassie-stained 12.5% SDS-PAGE gel. Lane M has a 10 kDa protein ladder. Lane 1 consists of a whole cell extract from a culture of B12DE3 E. coli transformed with empty pET47b plasmid. Lane 2 consists of whole cell extract from an induced bacterial culture expressing VP1 protein. Lane 3 consists of 5 mg/ml of soluble protein extract from an induced bacterial culture expressing VP1 protein; (b) Detection of the VP1 protein band in E. coli using an anti-VP1 monoclonal antibody. SDS-PAGE and Western blot on 12.5% gradient gels. Lane M has molecular weight markers. Lane 1 consists of a plasmid control. Lanes 2 and 3 have 10 mg/ml of VP1 soluble protein fraction. An anti-VP1 monoclonal antibody (1:50) and a goat anti-mouse IgG-AP (BioRad) conjugate (1:1000) were used, and DAB was used as a substrate
(a) Antigen optimisation. Rows A-B include (1:100) positive sera exposed to VP1 antigen. Rows E-F include SPF-negative sera (1:100) exposed to VP1 antigen; (b) Antigen dilutions (1:10, 1:50 and 1:100) reacted with positive and negative sera. The results were plotted against optical density values at an absorbance of 650 nm. Ratios shown refer to antigen dilutions
(a) Conjugate optimisation. Rows A-B consist of positive sera (1:100) exposed to VP1 antigen. Rows E-F consist of SPF-negative sera (1:100) exposed to VP1 antigen; (b) Conjugate dilutions (1:1000, 1:2000, 1:F000, 1:8000, and 1:16,000) reacted with positive (1:100) and negative sera (1:100) in an ELISA plate coated with antigen. The results were plotted against optical density values at an absorbance of 650 nm. Ratios shown refer to conjugate dilutions
Standard curve for the indirect ELISA
Comparison between the indirect ELISA and an IDEXX commercial Elisa, which used 4 serum samples for each mean. Mean optical density values were measured at an absorbance of 650 nm and were plotted against S/P values. The y-error bars represent the standard error (Mean OD ± SD) for the indirect ELISA
ELISA, which revealed a significant difference between CAV-positive serum and CAV-negative serum (p-value of 0.001). For the second variable (i.e., a commercial ELISA), the t-test yielded a t-value of 5.063, which revealed a significant difference between CAV-positive serum and CAV-negative serum (p-value of 0.015). The intervention produces a statistically significant improvement in both variables with respect to the p-value (p-value < 0.05). Moreover,
As described earlier, a total of 100 sera samples were tested to determine the sensitivity and specificity to CAV protein using a commercial ELISA and the new indirect ELISA as listed in
In previous years, several expression systems have been used to express VP1-CAV, including E. coli, baculovi- rus-insect cells, and plant cells [
In this study, the optimum antigen dilution was determined as 1:100, as shown in
. Sensitivity and specificity of ELISA by using recombinant VP1 protein as anchored antigen
Screening Test | Positive for CAV | Negative for CAV | |
---|---|---|---|
Positive for CAV | 53 | 0 | Sensitivity 93.3% |
Negative for CAV | 7 | 40 | Specificity 100% |
Total | 60 | 40 | 100 |
. Sensitivity and specificity of the commercial ELISA kit I-DEXX, Australia
Screening Test | Positive for CAV | Negative for CAV | |
---|---|---|---|
Positive for CAV | 60 | 2 | Sensitivity 100% |
Negative for CAV | 0 | 38 | Specificity 95% |
Total | 60 | 40 | 100 |
trapping of conjugate. Pallister et al., [
Because the sensitivity of the indirect ELISA is high, serum samples at low dilutions should not be used [
Acceptable background levels and improved specificity were attributed to the quality of the antibody sera that was used. To ensure good quality of the antibodies, freezing and thawing of the serum samples should be minimised to avoid antibody precipitation, which can cause a loss in antibody activity by steric interference of the antigen-combining site or by the generation of insoluble material that is lost during centrifugation or filtration [
The goat anti-chicken IgG-HRP (KPL, USA) conjugate used in this study was of high quality because it could be used at a dilution of 1:16,000. This observation is clearly demonstrated in
Statistical analysis was carried out using SPSS software. The t-test produced a t-value of 15.805 for the indirect ELISA, with an associated single-sided (“tailed”) p-value of 0.001. For the second variable (i.e., a commercial ELISA), the t-test gave a t-value of 5.063 and a p-value of 0.015. The intervention produces statistically significant improvements in both variables with respect to the p-value (p-value < 0.05).
The standard curve for the indirect ELISA was determined and is shown in
Traditional approaches to estimate test sensitivity and specificity depend on testing populations of both diseased and non-diseased animals [
These findings are in agreement with studies which have shown that the ELISA test failed to determine sero- conversion, and an SN test proved to be the most effective assay to determine sero-conversion [
In this paper, the indirect ELISA that utilised VP1 protein was successfully applied. The protein that was produced served as a crucial antigen for the detection of CAV polyclonal antibody in chickens. The results demonstrated that the indirect ELISA possesses a number of advantages: the indirect ELISA system is rapid, sensitive and specific for the detection of serum antibodies to CAV and it is well-suited for the serological diagnosis of CAV in SPF and commercial chicken flocks.