The isolation of high quality RNA is a crucial technique in plant molecular biology. The quality of RNA determines the reliability of downstream process like real time PCR. In this paper, we reported a high quality RNA extraction protocol for a variety of plant species. Our protocol is time effective than traditional RNA extraction methods. The method takes only an hour to complete the procedure. Spectral measurement and electrophoresis were used to demonstrate RNA quality and quantity. The extracted RNA was further used for cDNA synthesis, expression analysis and copy number determination through Real Time PCR. The results indicate that RNA was of good quality and fit for real time PCR. This high throughput plant RNA extraction protocol can be used to isolate high quality RNA from diverse plants for real time PCR and other downstream applications.
High quality RNA extraction is an important step for gene expression studies. As a nucleic acid, RNA is used for protein synthesis, also widely employed in studies of gene expression pattern in different plants. Types and quantity of RNA in plants depends upon expression of particular genes, which leads to a particular phenotype. Obtaining a sufficient quantity of pure RNA is more challenging for next generation sequencing of transcrip- tomes and Quantitative Real Time PCR (qPCR) analysis [
Because of extraction techniques variability and the quality of their products, the comparative analysis of ge- nomes or transcriptomes across plant lineages and tissue types remains a challenge for plant evolution research- ers. Most isolation methods are complex and have low throughputs due to presence of polysaccharides and po- lyphenol. Thus, these methods produce low RNA yields. Real time PCR has been used as a major analytical platform for quantification of nucleic acid, due to its greater sensitivity and accuracy and better quantitative performance as compared to conventional PCR [
Keeping in view the above facts, we have standardised a high throughput protocol which can be utilized for wide range of plant tissues across a broad range of taxa. We tested this protocol with different explants of dif- ferent crops like cereals crops (rice, wheat, maize), vegetable crops (onion), commercial crop (sugarcane). Our protocol is safer, easiest and cost-efficient than other RNA extraction methods. The purpose of this study is to evaluate the efficiency of Trizol to isolate high yield and quality of RNA from different types of tissues. Our motive is to introduce this protocol and not to discount other protocols that work well in particular cases, but the aim is to present a single protocol that works well across a broad variety of plant tissue types and plant species within an hour.
Fresh leaves and callus of rice (Oryza sativa), leaf samples of wheat (Triticum aestivum), Wheat kernels (Triti- cum aestivum), roots of maize (Zea mays), leaf samples of onion (Allium cepa) and spindles of sugarcane (Sac- charum officinalis) were collected from glasshouse of “School of Agricultural Biotechnology, Punjab Agricul- tural University, Ludhiana” and used for RNA extraction with following method.
Trizol (Life technologies Cat No. # 15596-018), Tri reagent (Sigma-Aldrich®, USA, Cat No. # T9424), Tri extract, Fast RNA® Green kit (MP biomedicals, USA, Cat No. # 116045-050)
Liquid nitrogen and dry ice
Chloroform (Sisco Research Laboratories Pvt. Ltd., India, Cat No. # 032967)
Isopropanol (2-propanol) (Sisco Research Laboratories Pvt. Ltd., India, Cat No. # 092956)
Diethyl pyrocarbonate (DEPC) (Amresco, USA, Cat No. # E174-100G)
Ethanol (Changshu Yangyuan Chemical, China, Cat No. # XK-13011-00009)
70% DEPC treated Ethanol
Sodium dodecyl sulphate (SDS) (Amresco, USA, Cat No. # 0227-1KG)
Nuclease free water (Promega, USA, Cat No. # P1193)
3-(N-morphorinio) propane sulphonic acid (MOPS) buffer (Hi-media, India, Cat No. # TC067)
2X RNA loading dye (Thermo scientific, USA, Cat No. # R0641)/Glycerol (Hi-media, India Cat No. # MB- 060-500 ML)
Formaldehyde (Hi-media, India, Cat No. # AS017-5L)
Ribo Ruler High Range RNA ladder (Thermo scientific, USA, Cat No. # SM1823)
Agarose (Hi-media, India, Cat No. # MB002-500G)
RNAseZap® (Ambion®/Life technologies, USA Cat No. # AM9780)
Fume hood (Optional)
Centrifuge (Eppendrof, Germany)
Pre-cooled pestle and mortar
Vortex mixture (Labnet, India)
Gel electrophoresis system (Bio-Rad, USA)
Nano Drop ND-1000 Spectrophotometer (Thermoscientific)
Spectrophotometer (Hitachi, Japan)
Gel documentation system (Avegene, USA)
The preparation for total RNA isolation is quite critical than DNA isolation as in RNA isolation the risk of RNase (catalyzes degradation of RNA) contamination is always there, that unlike DNase does not require any cofactor such as Mg2+ ion for its activity. Therefore, to remove RNAse contamination, all the glasswares and plasticwares should be sterilized.
Add 1 ml of DEPC into 1 litre autoclaved distilled water and allow it to stand for overnight (12 hr) at 37˚C.
For DEPC water treatment microtubes (1.5 and 2 ml) and tips (10 μl, 200 μl and 1 ml) were fully immersed in DEPC water overnight at 37˚C. DEPC water was also added into the mortars in which pestles were immersed. After overnight treatment the tips and microtubes were filled in tip boxes and jam jars respectively. The tip boxes and jam jars were kept in hot air oven at 80˚C for overnight baking, which results in complete drying of mois- ture. Thereafter, all the material was autoclaved at 121˚C for 20 min. The pestles-mortars were baked at 300˚C for 4 h incubation before their use for samples grinding.
Plastic ware should be thoroughly rinsed with a solution of 0.1 M NaOH and 1mM EDTA, followed by rinsing with RNase free water. Chloroform resistant plasticwares should be rinsed with chloroform to inactivate RNases. Glasswares should be treated with DEPC (0.1%), allow it to stand for overnight (12 hrs) at 37˚C and then autoc- laved to eliminate residual DEPC.
Electrophoresis tank should be cleaned with a detergent solution (0.5% SDS) thoroughly rinsed with RNase free water, then rinsed with ethanol and allow it to dry.
The most critical step in RNA isolation procedure is sample collection, because the common sources of RNAse contamination are human contact, environmental exposure and aqueous solutions. For sample collection, aseptic scissor, autoclaved falcon tubes, tissue paper, gloves, RNAse Zap and liquid nitrogen are required. Gloves were swabbed with RNAse Zap solution to avoid RNAse contamination. Then young leaves were cleaned with tissue paper to remove dust, cut with scissor and put in autoclaved falcon tubes and then kept in liquid nitrogen. But in case of root samples, we need more precautions while collecting the samples. For this first of all take out the roots from soil, then remove the soils with the help of tissue paper or cotton after that kept it in liquid nitrogen. In case of callus, excised 2 - 3 mm size callus and crush immediately without storing it in liquid nitrogen.
The Trizol reagent was developed by Chomczynski and Sacchi [
To obtain high yield of RNA, grinding is a critical point in the extraction of genetic material. So, grinding should be fine as much as possible and temperature should be low as much as possible to avoid degradation. Take 50 mg of sample and grind it with the help of liquid nitrogen in mortar and pestle that was sterilized and baked, then add 1 ml of Trizol/Tri reagent/Tri extract per 50 - 100 mg of tissue in 2 ml microcentrifuge tube. Sample volume should be less than 100 µl. Mix the sample by vigorously shaking by hand or by briefly vortex- ing until the sample is thoroughly resuspended.
In this step, incubate the samples for 5 minutes at room temperature. After that add 0.2 ml of chloroform to each tube and shake vigorously by hand for 15 seconds, then incubate the samples for 5 minutes at room temperature. After the incubation centrifuge for 15 minutes at 12,000 ×g (RCF) at 4˚C or room temperature.
Transfer the upper aqueous phase to a fresh tube. Then add 0.5 ml of isopropyl alcohol to precipitate RNA (If this RNA will be used for RT-PCR, first add 50 µl isopropyl alcohol to precipitate RNA, mix it and incubate samples at room temperature for 5 min and centrifuge at 12,000 ×g (RCF) for 10 minutes at 4˚C or room tem- perature), Mix it gently, incubate the samples at room temperature for 10 minutes and centrifuge at 12,000 ×g (RCF) for 10 minutes at 4˚C or room temperature. The RNA will form a white minute pellet on side or bottom of the tube.
Discard the supernatant gently and wash the pellet with 1 ml of chilled 75% ethanol (Freshly prepared in DEPC water). Mix samples by vortexing for 15 secs, then centrifuge at 12,000 ×g (RCF) for 5 minutes at 4˚C or room temperature. Repeat this step twice.
Remove the supernatant gently, then air dry the pellet not more than 5 minutes. Dissolve the pellet in 60 µl RNase free water (commerical) or autoclaved DEPC treated water.
For the short time storage we can put it in −20˚C and for long time storage put it in −80˚C.
RNA concentration and purity can be assessed by two ways, i.e. agarose gel electrophoresis and spectrophoto- meter.
The presence and overall quality of RNA preparation was determined by electrophoresis on denaturing 1.2% Agarose gel at 80 V for 45 min in 1× MOPS buffer [
The concentration of RNA was quantified in ND-1000 UV/VIS spectrophotometer (Hitachi, Japan). The RNA was diluted in autoclaved double distilled water to make dilution factor of 100, i.e. 1 µl RNA sample + 99 µl autoclaved double distilled water. The quantification of RNA was done in duplicates. The O.D values were tak- en at 260 and 280 nm. The RNA concentration was determined as per the formula given below.
If the sample is not clean, the following modified cleanup procedure will help to purify the total RNA. This protocol is adapted from that published for DNA cleanup by Rohland and Reich [
One μg of total RNA was used to synthesize cDNA with 1st strand cDNA synthesis kit (TakaRa Prime scriptTM, Japan) according to manufacturer’s instructions. The authenticity of cDNA was confirmed using 26S rRNA gene specific primers 26SF and 26SR (
Name of Components | Working Concentration |
---|---|
MOPS | 200 mM |
Sodium Acetate | 80 mM |
EDTA | 10 mM |
Preparation of 1.2% denaturing gel: Take 1.2 gm agarose in 250 ml Conical flask and dissolved in 100 ml 1× MOPS buffer and heat in microwave oven for 2 min. After cooling, add 37% formaldehyde 1.78 ml and add 2 µl EtBr and pour it in casting tray. After solidification use it for RNA quantification. Preparation of RNA sample: Add 2 volumes of 2× RNA loading buffer to 1 volume of RNA sample and denature at 70˚C for 10 minutes. Followed by cooling. Rinse well with buffer and load the RNA samples into lanes. Run the gel for approximately 1.5 hr at 80 V.
Primer set | Gene | Primer name | Nucleotide sequence (5’ - 3’) | Amplicon size (bp) | Annealing temperature (˚C) | Gen bank accession # |
---|---|---|---|---|---|---|
1 | 26S rRNA | Forward Primer 26SF | CACAATGATAGGAGGAGCCGAC | 534 | 60˚C | AY283368 |
Reverse Primer 26SR | CAAGGGAACGGGCTTGGCAGAATC | |||||
2 | actin11 (for rice) | Forward Primer Act1F | CAGCCACACTGTCCCCATCTA | 67 | 60˚C | AK100267 |
Reverse Primer Act1R | AGCAAGGTCGAGACGAAGGA | |||||
3 | β-tubulin (for sugarcane) | Forward Primer TubF | CCAAGTTCTGGGAGGTGATCTG | 103 | 60˚C | CA222437 |
Reverse Primer TubR | TTGTAGTAGACGTTGATGCGCTC |
phoretically separated on 1.0 per cent agarose gel at 80 V for 2 h, stained with ethidium bromide, visualized un- der UV light and photographed using photo gel documentation system (Avegene, USA).
The gene expression was analyzed by qRT-PCR using iQ™ SYBR® Green supermix (BioRad, USA). The qRT- PCR primers were designed for the reference genes, i.e. actin-11 for rice (
To assess the presence and purity of extracted RNA, use the ratio of absorbance at 230 nm, 260 nm, and 280 nm. If the RNA is pure, we expect a 260/280 ratio around 2, although this ratio does not guarantee pure RNA. If the ratio is appreciably lower, it is an indication of the presence of protein, phenol, or other contaminants that absorb strongly at or near 280 nm. The ratio 260/230 is expected to be around 2 - 2.2. If this value is appreciably lower, it is an indication that contaminants such as carbohydrates, EDTA, guanidine isothiocyanate, and phenol that absorb at 230 nm are present in the sample. Ratios lower than expected could indicate that additional cleaning is necessary and the optional cleanup should be followed. In this experiment, all the extracted RNA showed a 260/280 nm absorbance ratio of 1.98 - 2.14 and 260/230 ratio of 2.05 - 2.24 (
Total RNA from different crop samples was analysed on 1.2% denaturing formaldehyde agarose gel electrophoresis [
The major steps before and during RNA isolation is sterilization. We have to do proper sterilization as men- tioned above. Working area should be properly cleaned and sterile. Tissue should be immediately homogenized in Trizol after crushing. During layer separation, aqueous phase should be free of organic contamination. RNA pellet should not be air dry for more than 5 minutes otherwise it will be very difficult to dissolve.
The primary cDNA was synthesized from approximately 1 μg of total RNA using the PrimeScriptTM 1st strand cDNA Synthesis Kit (Takara, Japan), according to protocol of the manufacturer in a total volume of 20 μl. The authenticity of cDNA was confirmed using 26S rRNA Primer as described above. The PCR amplification showed the target 26S fragment with a clear and sharp band of expected size 534 bp (
Plant | A260/280 | A260/230 | Yield (ng/µl) |
---|---|---|---|
Rice | 2.02 ± 0.04 | 2.18 ± 0.05 | 3246 |
Maize | 2.14 ± 0.06 | 2.24 ± 0.08 | 2956 |
Wheat | 1.98 ± 0.05 | 2.05 ± 0.07 | 3042 |
Sugarcane | 2.01 ± 0.02 | 2.12 ± 0.04 | 3120 |
Onion | 1.99 ± 0.09 | 2.05 ± 0.09 | 2834 |
Data are reported as means ± standard deviation for N = 2 in each group.
The expression of actin and β-tubulin reference gene in the four samples (two from rice and two from sugarcane) were estimated in triplicates by qRT-PCR (
In this study, evaluation of quality and quantity of total RNA isolated from different tissues was done with spec- trophotometer and formaldehyde denatured gel. This protocol does not give a significant difference in the yield of total RNA. This method gave the highest yield for all kind of tissues ranging from 2834 to 3246 ng/µl RNA. This method gave A260/A280 range of 1.98 - 2.14 and abundant band for 28SrRNA than 18SrRNA, indicating that the RNA was not degraded and free from protein and polysaccharide contamination. Expression of 26SrRNA was monitored with all samples. Expression of this gene was represented as a single band without any smearing; indicating that the RNA was intact.
Real Time PCR permits monitoring of the progression of cDNA amplification after each cycle through fluo- rescence [
Our RNA extraction protocol is a high-throughput protocol and the RNA purity is sufficiently high to meet the requirements of real time PCR. In conclusion, we have developed a rapid and reliable method of high-quality RNA extraction, i.e. widely used to isolate RNA from different types of plant tissues. It is highly significant to wider plant science community and also fruitful to other users wishing to conduct high throughput transcript profiling in a time and cost effective manner. We have used extracted RNA for copy number determination and expression analysis of transgenes in rice and sugarcane. We have also used extracted RNA for transcriptome analysis in maize roots under water logging stress.
We are thankful to Dr. Kuldeep Singh, Director, School of Agricultural Biotechnology, Punjab Agricultural University for providing the research facilities.