Long-term maintenance of chicken primordial germ cells (PGCs) in vitro has tremendous potential for transgenic chicken production. Feeder cells are essential for the establishment and culture of chicken PGCs in vitro . Buffalo rat liver (BRL) cells are the most commonly used feeder cells for PGCs culture ; however, this feeder layers from other animal species usually cause immunogenic contaminations, compromising the potential of PGCs in applications. Therefore, we tested chicken source mensenchymal stem cell (MSCs) derived from bone marrow as feeder cells to further improve PGC culture conditions. MSCs derived from chicken bone marrow have a powerful capacity to proliferate and secrete cytokines. We found chicken primordial germ cells derived from circulating blood (cPGCs) and gonads (gPGCs) can be maintained and proliferated with MSCs feeder layer cells. PGCs co-cultured on MSCs feeder retained their pluripotency, expressed PGCs specific genes and stemness markers, and maintained undifferentiated state. Our study indicated that the xeno-free MSCs-feeders culture system is a good candidate for growth and expansion of PGCs as the stepping stone for transgenic chicken research.
PGCs are progenitors of germ cells and play an important role in the production of early embryonic germ cells [
MSCs are multipotent stromal cells and can be isolated from different tissues such as bone marrow, umbilical cord, placenta, muscle, adipose tissue, and liver, and can replicate as undifferentiated cells in vitro [
The care and experimental use of chickens and fresh fertilized eggs was approved by Nanhai Chicken Breeding Co., Ltd. in Foshan Guangdong. Ephedra chickens were maintained according to the standard management program at the Laboratory Animal Centre, Foshan University, China. Chicken Embryos were incubated in a rotary egg incubator (Rcom PRO 20, Korea) at 38˚C and 55% humidity, with rocking at an angle of 90˚ every 1 h for the following test.
Bone marrow from the femur and tibia of 1- to 10-day-old ephedra chickens was collected by inserting a syringe needle into one end of the bone and washing out with knockout Dulbecco’s modified Eagle’s medium (KO-DMEM, Gibco, USA). The bone marrow cell suspension was centrifuged at 1000 rpm for 5 min, and then the top fat impurities were removed. The bottom cells were collected and washed 3 times with PBS, then re-suspended and plated into a culture plate with complete medium containing KO-DMEM, 7.5% fetal bovine serum (FBS, Hyclone, Australia), 2.5% chicken serum (CS, Hyclone, Australia), 2 mM L-glutamine (Invitrogen), 2 m MGlutaMAX-I Supplement (Invitrogen), 10 ng/ml human bFGF (Peprotech, USA), and 104 IU/mL penicillin/streptomycin (Gibco, USA). The cells were cultured in a CO2 incubator maintained at 37˚C in an atmosphere of 5% CO2 in air with 60% - 70% relative humidity. The medium was first changed after 24 h, and then once every 3 days. When primary cultures reached 80% confluence, the cultured MSCs were subcultured by dissociating cells using 0.25% trypsin containing 0.02% EDTA.
Chicken MSCs at different passages were collected and total RNA extracted using a Trizol kit (Takara, China). The total RNA was subjected to reverse transcription with random primers and M-MLV enzyme (Takara, China). Transcribed products used to amplify target genes segment with the primers in
The Chicken MSCs were fixed in 3.7% paraformaldehyde solution for 30 min, washed three times with PBS containing 5% (v/v) fetal bovine serum, and blocked with blocking buffer consisting of PBS containing 10% (v/v) fetal bovine serum, for 30 min. Cells were then washed three times (10 min per wash) with PBS containing 5% FBS, and incubated with primary antibodies against CD 29 and CD 44 (1:200, Santa Cruz, CA) at 4˚C overnight. Afterwards, the primary antibody was removed and cells were washed three times (10 min per wash) with PBS containing 5% FBS. Cells were then incubated with secondary antibodies (1:500, Santa Cruz, CA) labeled with FITC at room temperature in the dark for 1 h. The samples were finally incubated with DAPI (Invitrogen) for 5 min, protected from light, and analyzed under a fluorescence microscope (Olympus).
At the third passage, when the confluence of cells reached 80%, the medium was removed and the cells were washed with PBS 3 times. The adipogenesis differentiation induction medium (ADM, Biowit, China) and osteogenic differentiation induction medium (ODM, Biowit, China) were added to the induced group and control cells cultured in complete medium. The media was completely replaced every 3 - 4 days Adipogenic potential was assessed by Oil Red O staining, and osteogenic capacity was determined by alizarin red staining after inducting for 2
Gene | Sequence ( 5’ -3’ ) | Length, bp |
---|---|---|
CD29 | GAACGGACAGATATGCAACGG | 300 |
TAGAACCAGCAGTCACCAACG | ||
CD34 | GTGCCACAACATCAAAGACG | 239 |
GGAGCACATCCGTAGCAGGA | ||
CD44 | CATCGTTGCTGCCCTCCT | 290 |
ACCGCTACACTCCACTCTTCAT | ||
CD71 | CCCAGGCTTCCCTTCGT | 305 |
GGGCTCCAATCACAACATAC | ||
PPAR-γ | CTGTCTGCGATGGATGAT | 199 |
AATAGGGAGGAGAAGGAG | ||
FAS | GACCCACCACGTCCCTGACATTG | 193 |
GGTTTCGTAGGCTCCTCCCATCC | ||
OSTEOPONTIN | CTTGCTCGCCTTCACCAC | 227 |
CTGTCTGCGATGGATGAT | ||
BMP2 | CGCTTACGCTGTTTGTGTTTCG | 192 |
GGTGGAGGTGGTTCACTTGGA | ||
NANOG | TGGTTTCAGAACCAACGAATGAAG | 180 |
TGCACTGGTCACAGCCTGAAG | ||
POUV | GTTGTCCGGGTCTGGTTCT | 189 |
GTGGAAAGGTGGCATGTAGAC | ||
SOX2 | GAAGATGCACAACTCGGAGATCA | 100 |
GAGCCGTTTGGCTTCGTCA | ||
CVH | GTCTGCCTGTGCAGCATGACATTG | 202 |
CTTTGCCCAAAGATGCCAGGAACTC | ||
DAZL | CGTCAACAACCTGCCAAGGA | 540 |
TTCTTTGCTCCCCAGGAACC | ||
ACTB | ATTGTCCACCGCAAATGCTTC | 113 |
AAATAAAGCCATGCCAATCTCGTC |
weeks. Adipogenic and osteoblast specific genes were further detected using RT-PCR.
The chicken MSCs and embryo fibroblast cells at passage 3 - 8 were seeded in 6-well plates. When cultures reached 80% confluence the medium was removed, and cells were treated with 10 ug/ml Mitomycin C for 2 h. Afterwards, they were washed five times with PBS, and then the mitotic inactivated cells were seeded in feeder cell medium to achieve a confluent layer.
Blood cells, including cPGCs, were isolated from the vasculature system of stage 14 - 16 HH ephedra chicken embryos and cultured on dishes containing feeder cells pretreated with Mitomycin C in KO-DMEM, 7.5% FBS, 2.5% chicken serum (CS, Hyclone, Australia), 2 mM GlutaMAX-I Supplement (Invitrogen), 1 × nucleosides (Millipore, CA), 1 × nonessential amino acids, β-mercaptoethanol, and combinations of the following growth factors: 5 ng/ml human LIF (Peprotech, USA), 5 ng/ml human SCF (Peprotech, USA), and 10 ng/ml human bFGF (Peprotech, USA).
The embryos at stage 28 HH and incubated for 5.5 days were retrieved and rinsed three times with PBS. Gonadal ridges were isolated by medial section of the abdomen with sharp tweezers under a stereomicroscope (SZX16, Olympus). Gonadal tissue was dissociated into single cells with 0.25% trypsin containing 0.02% EDTA, and then washed with PBS and centrifuged at 1000 rpm for 5 min. The primary gonadal cells, including gPGCs and somatic cells, were re-suspended in complete medium, the same as the cPGCs, and the moved to a 35 mm dish without feeder cells. The somatic cells adsorbed on the surface of the dish completely in 24 h, and then suspended gPGCs were moved to a new dish containing mitotic inactivated feeder cells.
The methods of RNA isolation and Reverse Transcription PCR were previously described in Reverse Transcription PCR of Chicken MSCs above. RT-PCR analysis was performed to determine the expression level of the PGCs-specific genes, including Nanog, PouV, Sox2, Cvh, and Dazl. Primer sequences are summarized in
Three plates cultured cPGCs and gPGCs were prepared to detect Chicken PGC surface markers SSEA-1 and Dazl using anti-SSEA-1 (1:200, Santa Cruz, CA) and anti-Dazl (1:200, Santa Cruz, CA) antibodies. The specific steps are the same as in Immunocytochemistry of Chicken MSCs, given above.
The cPGCs and gPGCs at passage 2 that dissociated to single cells were seeded in 12-well plates and cultured with MSCs-feeder cells, CEF-feeder cells, and withoutfeeder. After culturing for 3 days, the PGCs were moved to 96-well plates in order to detect the efficiency of cell proliferation using Cell Counting Kit-8 (CCK-8, Beyotime, China). After treatment with CCK-8 in a CO2 incubator maintained at 37˚C, cells were moved to determine the absorbance values of OD 450 using a Microplate Reader (Thermo).
The primary cells were isolated from bone marrow of 1 to 10 day old ephedra chickens and cultured in the presence of bFGF. After 7 days of growth, most of the blood cells were dead and most MSCs were attached to the culture plate. The cells expanded easily and exhibited fibroblast-like morphology. Approximately 10 days later, the cells grew to 80% - 90% confluence and were passaged for the first time. After 3 passages, the cultures were very pure and displayed a unique vortex shape. There were no obvious morphological differences among different passages and cellular morphology remained stable after serial passages (Figures 1(A)-(D)). Eventually, as passage numbers increased, the cells showed signs of slowed proliferation (
RT-PCR experiments showed that chicken MSCs expressed the pluripotent stem cell marker, Nanog, and mesenchymal stem cell markers, CD29, CD44, and CD71. All the above cell markers are positive, and the hematopoietic blood stem cell marker, CD34, was negative (
Specific marker proteins for chicken MSCs were detected through immunofluorescence staining. Expression of CD29 and CD44 was observed in chicken MSCs (
Adipogenic Differentiation of chicken MSCs. After induction with adipogenic inducers for 2 weeks, the chicken MSCs changed gradually from fibroblast-like cells to flattened cells (
Osteogenic Differentiation of chicken MSCs. After incubation in medium for 15 days, chicken MSCs showed obvious morphological changes. Tightly packed colonies forming nodule-like structures were observed. Deposition of calcium in these cells was shown by staining with alizarin red (
cPGCs from chicken embryos at stages 14 - 15 were isolated and cultured on MSCs-feeders. After 7 - 14 days of growth, most of the blood cells had disappeared, and PGC colonies had formed and were loosely attached on culture MSCs-feeders (
other gonadal cells were dead. Next, the pure gPGCs were cultivated on MSCs-feeders (
Immunocytochemical analysis was performed to characterize cultured PGCs in detail. These cPGCs and gPGCs were positive for the chicken PGC markers SSEA-1 and DAZL (
RT-PCR analysis was performed (
The proliferation activity of PGCs on MSCs- and CEFs-feeder cells was detected using CCK-8. The results showed that the feeder cells can promote proliferation of cPGCs and gPGCs in vitro, and that MSCs-feeder cells were better at enhancing the proliferation of PGCs rather than CEFs-feeder cells (
PGCs are precursor cells of spermatozoa and ova [
proliferation in vitro of chicken PGC culture depends on the feeder cells being present [
MSCs are multipotent stromal cells from the mesoderm and can be isolated from various sources such as bone marrow, adipose tissue and others [
In our study, a xeno-free feeder layer system was developed for prolonged expansion of chicken PGCs in culture with a bone marrow MSCs-feeder. Chicken cPGCs and gPGCs showed clonal growth when co-cultured on a mitomycin C treated MSCs feeder layer. The positive expression of NANOG, SOX2, POUV, DAZL, and CVH was apparent, implying that the pluripotency andgenitality of PGCs was not primarily changed after prolonged cultured with an MSCs feeder. The different levels of cell proliferation of PGCs co-cultured on a MSCs- feeder layer, a CEFs-feeder layer, and a feeder-free layer was determined by cck-8 kit. The results indicated that feeder cells can significantly increase cell proliferation, and that the MSCs-feeder layer performed better than the CEFs-feeder layer. Both the cPGCs and gPGCs co-cultured on MSCs-feeder layers expressed PGCs specific surface and pluripotent gene expression and had a good state of growth. An MSCs-feeder layer is therefore more suitable for PGCs cultivation in vitro rather than a CEFs-feeder layer. It is possible that the MSCs-feeder layer provids a more suitable microenvironment for PGCs.
This study confirmed that chicken MSCs are a more efficient source of chicken feeder cells, capable of maintaining the growth of PGCs and their undifferentiated state. The results provide a new feeder system to deal with the current problems associated with chicken PGC cultivation in vitro, and show its potential future application.
In conclusion, we demonstrated that MSCs-feeder could improve the in vitro expansion of chicken PGCs and generate a greater number of primitive cells during this expansion. Our results provide insight into the potential use of MSCs-feeders in vitro to aid the expansion of chicken PGCs cultures.
The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.
The authors declare no conflicts of interest regarding the publication of this paper.
Li, D.S., Chen, Z.S., Chen, S.F., Ji, H.Q., Zhan, X.S., Luo, D.Z., Luo, H.N. and Wang, B.Y. (2019) Chicken Mesenchymal Stem Cells as Feeder Cells Facilitate the Cultivation of Primordial Germ Cells from Circulating Blood and Gonadal Ridge. Stem Cell Discovery, 9, 1-14. https://doi.org/10.4236/scd.2019.91001