Trifolium alexandrinum , an important forage legume, suffers from narrow genetic base . T he present investigation was envisaged to reveal the inter- and intra-species genetic diversity and lineage among 64 accessions, representing a global collection, of T. alexandrinum; it’s two probable progenitor species (T. salmoneum and T. subterraneum) and the three genetically distant species (T. repens, T. vesiculosum, T. michelianum). A set of Simple Sequence Repeats (SSR) primer-pairs developed from T. alexandrinum have shown to amplify alleles across the species under study, suggesting utility of the newly developed resource for assessing molecular diversity among Trifolium species. These SSRs markers together with previously reported SSRs, derived from T. repens, enabled to reveal high intra-species polymorphism in T. alexandrinum and successfully discriminate different species investigated in this study. The diverse accessions determined herein provide a superior resource for further breeding of T. alexandrinum . High allelic similarity of T. alexandrinum with T. subterraneum and T. salmoneum indicated close relatedness among the species, suggesting polyphyletic evolution of T. alexandrinum.
Genus Trifolium, of the family Leguminosae (Fabaceae), comprises more than 237 annual and perennial species [
Various methods such as morphological, biochemical and molecular markers have been deployed to assess the extent of genetic diversity in crop plants including Indian collection of the Trifolium [
Germplasm collections held at various genebanks provide diverse source of naturally occurring genetic variation which can be exploited for trait improvement. Australian Pastures and West Australian Gene Banks have a collection of diverse accessions of T. alexandrinum, T. repens (white clover), T. subterraneum (subterranean clover), T. salmoneum, T. vesiculosum (arrow clover), and T. michelianum (balansa clover). So far, these accessions have not been characterized. Therefore, it is important to characterize this set of germplasm so that forage breeders can target accessions of interest and utilize them effectively in their national breeding programs. SSR markers have been extensively used in the genome and genetic analysis of various crops due to their high repeatability, codominant inheritance, abundance and multiallelic nature in plant genomes. However, unlike major food crops, limited genetic and genomic resources exist for improvement of forage crops especially for T. alexandrinum. In this study, we 1) isolated and characterized SSR markers in T. alexandrinum, and 2) investigated the level of polymorphism and the extent of molecular diversity among 69 accessions of Trifolium. In addition, we used existing SSR markers developed from T. repens to investigate the molecular diversity in Trifolium.
Seeds of 72 accessions of Trifolium were procured from the Western Australian and Southern Australian gene banks (part of the Australian Pastures Genebank-APG); however, three of them did not germinate (
Fifteen days after germination, 2 to 3 g of young leaf tissue was collected from at least 10 plants from each accession and frozen in liquid nitrogen. DNA was extracted following the phenol-chloroform extraction method [
This work was accomplished at the Indian Grassland and Fodder Research Institute, Jhansi, India. A library enrichment protocol [
Primers flanking SSR motifs were designed using the PRIMER 3 software [
Fragments amplified with SSR primer-pairs were scored into binary format (“1” for presence and “0” for absence). Genetic similarity, based on allelic data, was
Pot No. | Species | Primary Name | APG Accession | Status | Country of Origin | Cluster Group |
---|---|---|---|---|---|---|
SA GRC Lines | ||||||
1 | T. alexandrinum | 593c | Gp | |||
2 | 594 | Gp | Afghanistan | A | ||
3 | 595 | Gp | Afghanistan | B1 | ||
4 | 596 c | Gp | ||||
5 | 598 | Gp | Turkey | B1 | ||
6 | 667 | Gp | Portugal | B1 | ||
7 | 668 | Gp | Portugal | B1 | ||
8 | 669 | Gp | Portugal | B1 | ||
9 | 670 | Gp | Portugal | B1 | ||
10 | 671 | Gp | Portugal | B1 | ||
11 | 673 | Gp | Portugal | B1 | ||
12 | 674 | Gp | Portugal | B1 | ||
13 | 675 | Gp | Portugal | B2 | ||
14 | 676 | Gp | Portugal | B1 | ||
15 | 677 | Gp | Portugal | B1 | ||
16 | 678 | Gp | Portugal | B2 | ||
17 | 679 | Gp | Portugal | B2 | ||
18 | 700 | Gp | Israel | B2 | ||
19 | 6168 | Gp | Portugal | B1 | ||
20 | 8579 | cv | Israel | B1 | ||
21 | 8582 | Gp | Israel | D | ||
22 | 14,247c | cv | ||||
23 | 15,890 | Gp | Syria | B2 | ||
24a | 15,892 | Gp | Iraq | G | ||
25 | 19,675 | Gp | Afghanistan | B2 | ||
26 | 19,678 | Gp | Afghanistan | B1 | ||
27 | 24,502 | cv | Morocco | B2 | ||
28 | 24,503 | cv | Morocco | B1 | ||
29 | 24,545 | Gp | Tunisia | B1 | ||
30a | 32,668 | Gp | Turkey | F | ||
31 | 33,621 | Breeder line | Australia | B1 | ||
32 | 33,622 | Breeder line | Australia | B2 | ||
33b | 33,747 | cv | J | |||
34 | 33,875 | cv | B1 | |||
35 | 35,688 | cv | E |
36b | 36,369 | Gp | Israel | I | ||
---|---|---|---|---|---|---|
37 | 37,099 | cv | Saudi Arabia | D | ||
38 | 41,596 | Gp | Morocco | B2 | ||
39 | 42,936 | cv | Italy | C | ||
40 | 45,313 | Gp | Pakistan | B2 | ||
41 | 45,314 | cv | B2 | |||
42 | 45,315 | cv | B1 | |||
43 | 45,316 | cv | B2 | |||
44 | 45,317 | cv | B1 | |||
45 | 45,318 | cv | B1 | |||
46 | 45320 | cv | Italy | B2 | ||
WA GRC Lines | ||||||
47 | T. alexandrinum | 138978 | 80,647 | Gp | Morocco | B2 |
48 | 139496 | 75,354 | Gp | USA | B2 | |
49 | 144658 | 77,737 | Gp | Israel | C | |
50 | 018742 | 76,777 | Gp | B1 | ||
51 | 034544 | 73,590 | Gp | Israel | E | |
52b | 086555 | 77,740 | Gp | Israel | B1 | |
53 | 086558 | 77,741 | Gp | Israel | B2 | |
54 | 086566 | 77,742 | Gp | Portugal | B1 | |
55b | 086756 | 77,743 | Gp | Israel | B1 | |
56b | 087277 | 75,011 | Gp | B2 | ||
57b | 087361 | 68,947 | Gp | H | ||
58 | 93MAR264ALE | 73,299 | Gp | Morocco | B1 | |
59 | 93MAR60ALE | 73,308 | Gp | Morocco | E | |
60 | CQ1166 | 63,256 | Gp | B1 | ||
61 | CS/1/82 | 73,410 | Gp | B1 | ||
62 | Italy.ALE | 77,746 | Gp | C | ||
63 | L59-72 | 77,747 | Gp | B1 | ||
64 b | LA YAPA INTA | 75,014 | Gp | H | ||
65 | Sacromonte | 62,041 | Gp | B1 | ||
66 | Warden | 76,306 | cv | India | B1 | |
67 | T. salmoneum | 087360 | 73,734 | Gp | B1 | |
68 | T. subterraneum | Dalkeith subclover | 17,496 | cv | B1 | |
69 | T. alexandrinum | Elite II | 35,688 | cv | J | |
70 | T. vesiculosum | Arrow leaf clover | 78,434 | cv | K | |
71 | T. michelianum | Boltabalansa | 32,860 | cv | L | |
72 | T. repens | Haifa white | 63,892 | cv | K |
aProstrate and slow growing; bMorphologically close to T. salmoneum; cNo germination; Gp: Germplasm; cv: Cultivar.
estimated following [
Amplicons generated through the five degenerate primers having (GA)10, (CT)10, (GTG)6, (GACA)5 and (CAA)6 repeats, were cloned and 89 colonies obtained. Of the 59 positive clones, 46 had inserts containing one or more SSR repeat motifs, suggesting that our approach for library construction was effective in isolation of SSR. Redundant clones visualized after BLAST analysis were removed. Although sequence analysis revealed all recombinants to possess terminal microsatellite repeats, to avoid any base pair degeneracy in degenerate primers, synthesis of forward and reverse primers was done; which helped in getting better cross-species reaction. The SSR motifs comprised of mononucleotide (T), dinucleotide (CA), tetranucleotides and compound repeats (
Locus/Primer name | SSR motif | Expected fragment size (bp) | Primer sequence (5’ to 3’) |
---|---|---|---|
IGFRI-SSR1 | (AACC)3 | 139 | GATGCTGGAATTGGAAGAGAAT(F) |
CTTGAACCAACCAACCAGTACA(R) | |||
IGFRI-SSR2 | (AACC)3N*.(GGTT)3 | GCTGTGTGATTACTGCTTGGAG(F) | |
GCTGATCTTATCTCTAATGGGAAGAG(R) | |||
IGFRI-SSR3 | (ACCA)3 | 189 | AACTTCTTCCCCATCAGTTTCA(F) |
ACCAACCAACCAAGATGACC(R) | |||
IGFRI-SR4 | (AACC)3N*.(GGTT)3 | 317 | GTTAAGAAATCCTGTGGGCAAG(F) |
GAAGAAAGGAGCGAAAACAGAC(R) | |||
IGFRI-SSR5 | (ATGT)12N*.(AACC)3 | 337 | CATCGGTTGGTTGGTTGG(F) |
TCGTACATTAACATGCGTGACC(R) | |||
IGFRI-SSR6 | (GGTT)3 | 296 | ATTAAAACCGAACCAACCAACC(F) |
AAGATGTGACCAACCAACCAAC(R) | |||
IGFRI-SSR7 | (AACC)3N*.(GGTT)3 | 320 | GGTTAATTGGTCACGCATGTT(F) |
TTGAAGCAATCTAGTCAGGCAG(R) | |||
IGFRI-SSR8 | (AACC)3 | 225 | GAAAGGAGGCCACACAGAACT(F) |
TCATACAACCAACCAACCAAGA(R) | |||
IGFRI-SSR9 | (TTGG)3 | 259 | ACTTAAACCAACCAACCGGAA(F) |
GCCCCATATTCCCTCACTAAAC(R) | |||
IGFRI-SSR10 | (T)10 | 300 | GAAATCTTGGTTGGTTGGTTGT(F) |
CACTAAAGGGTTCCATTCCATT(R) | |||
IGFRI-SSR11 | (T)10 | 151 | AATGGAATGGAACCCTTTAGTG(F) |
TGCATGTGGAAAATACCTTCAG(R) | |||
IGFRI-SSR12 | (CCAA)3N*.(GGTT)3 | 274 | AACTCCCCTCTCCTCTGCTAGT(F) |
CATGATATACGGACCACCTGC(R) | |||
IGFRI-SSR13 | (AACC)3 | 240 | GGTCACGCATGTTAATGTACGA(F) |
CATAACCAACCAACCGGAACT(R) | |||
IGFRI-SSR14 | (GGTT)3 | 167 | TGAACCAACCAACCTGGAGT(F) |
GGCAGCATTAGCCTTTCTTTTA(R) | |||
IGFRI-SSR15 | (CA)20 | 229 | GGGGACTCTCTCTCTCTCTCTC(F) |
GCGTGATTCCTTTCCACA(R) |
*N - A/C/G/T, bp = base pair.
working with different legume and grass species [
Of the 15 IGFRI-SSR primer pairs (
Primer name | T. alexandrinum (bp) | T. salmoneum (bp) | T. subterraneum (bp) | T. vesiculosum (bp) | T. michelianum (bp) | T. repens (bp) | Accessions with doubtful identity (bp) | PIC | No. of fragments | |||
---|---|---|---|---|---|---|---|---|---|---|---|---|
T. repens primers | ||||||||||||
A02H09 | 211 - 213 | 213 | 211 - 213 | 0.99 | 2 | |||||||
A01C10 | 287 - 289 | 287 - 289 | 287 - 289 | 238 - 289 | 238 - 289 | 287 - 318 | 0.82 | 8 | ||||
A04F01 | 182 - 202 | 182 - 192 | 192 | 192 - 234 | 192 | 192 - 234 | 192 | 0.89 | 7 | |||
A01H11 | 138 - 175 | 138 - 144 | 138 - 144 | 175 - 245 | 138 - 169 | 169 - 242 | 138 - 144 | 0.95 | 8 | |||
A02D12 | 237 - 247 | 146 - 148 | 148 | 146 - 247 | 237 - 247 | 0.97 | 6 | |||||
A05A09 | 168 - 197 | 193 - 197 | 168 - 205 | 176 - 197 | 179 - 205 | 0.98 | 4 | |||||
B01B05 | 121 - 269 | 121 - 265 | 123 | 235 - 269 | 263 - 267 | 235 - 269 | 121 - 269 | 0.89 | 10 | |||
A06E06 | 131 - 161 | 131 - 161 | 131 - 161 | 137 - 175 | 131 - 144 | 137 - 175 | 131 - 263 | 0.91 | 13 | |||
A06B04 | 165 - 194 | 173 - 175 | 173 - 175 | 185 - 194 | 173 - 199 | 165 - 199 | 0.84 | 8 | ||||
A02D07 | 165 - 182 | 165 | 165 | 165 - 182 | 165 - 182 | 165 - 182 | 0.97 | 7 | ||||
B02E01 | 133 - 177 | 139 - 143 | 135 - 137 | 135 - 177 | 127 - 137 | 177 | 0.97 | 7 | ||||
B01E07 | 137 - 189 | 181 | 233 - 235 | 235 | 233 - 235 | 137 - 235 | 0.89 | 6 | ||||
A04B12 | 254 - 258 | 254 - 258 | 254 - 258 | 258 - 278 | 278 | 266 - 278 | 250 - 258 | 0.84 | 8 | |||
A03B05 | 122 - 166 | 126 - 130 | 126 - 136 | 126 - 166 | 122 - 134 | 122 - 166 | 128 - 166 | 0.96 | 10 | |||
A02H03 | 232 - 234 | 232 - 240 | 236 | 0.99 | 5 | |||||||
T. alexandrinum primers | ||||||||||||
IGFRI-SSR3 | 133 - 189 | 173 - 189 | 165 - 189 | 0.97 | 7 | |||||||
IGFRI-SSR7 | 251 | 251 | 259 | 251 | 0.99 | 2 | ||||||
IGFRI-SSR8 | 250 - 262 | 0.99 | 2 | |||||||||
IGFRI-SSR11 | 168 - 172 | 168 - 172 | 168 - 172 | 168 - 172 | 168 - 172 | 168 - 172 | 168 - 172 | 0.74 | 3 | |||
IGFRI-SSR13 | 168 - 176 | 168 - 176 | 168 - 176 | 168 - 176 | 168 - 176 | 168 - 176 | 0.78 | 2 | ||||
IGFRI-SSR14 | 158 - 170 | 158 | 0.99 | 2 | ||||||||
IGFRI-SSR15 | 228 - 232 | 228 - 232 | 228 - 232 | 228 - 232 | 228 - 232 | 0.68 | 2 | |||||
bp: base pair.
133 to 262 bp among T. alexandrinum accessions as well as across the different species. The number of alleles/SSR ranged from two to seven, with an average of 2.85 allele/SSR locus. The number of alleles/SSR among T. alexandrinum accessions ranged from one to seven with 2.71 alleles per SSR locus. PIC values observed with these primers ranged from 0.99 to 0.68. Primer IGFRI-SSR 8 was species specific and polymorphic with T. alexandrinum. IGFRI-SSR 14 amplified fragments with T. alexandrinum and the two off type (prostrate and slow growing) T. alexandrinum accessions 15,892 and 33,747 (
To validate the usefulness of T. repens primers and to assess molecular diversity among Trifolium species, we analyzed second set of 15 SSR markers developed from T. repens [
In all, the two sets of primers proved to be effective in revealing the intra and the interspecies diversity. Additionally, high polymorphism exhibited among T. alexandrinum accessions indicated suitability of these SSRs for further allelic study of the species.
In order to investigate the genetic relationship among accessions of T. alexandrinum and related species, we generated dendogram using clustering method. Twelve distinct clusters were formed containing a varying number of accessions (
of collection was established. This might be because of movement of germplasm and its intermixing with native germplasm. Two prostrate and slow growing T. alexandrinum accessions 32,668 and 15,892 formed independent clusters “F” and “G” respectively. These two accessions were having no morphological similarity with T. alexandrinum. T. alexandrinum accessions, possessing morphological similarity with T. salmoneum, 68,947 and 75,014 formed cluster “H”; accession 36,369 formed independent cluster “I” whereas accession 33,747 formed cluster “J” with an T. alexandrinum cv Elite II. Cluster “F”, “G” and “H” grouped together before joining the major cluster. Similarly, cluster “J” and “I” also grouped together before joining the major cluster. These T. alexandrinum accessions which differed in morphology were placed closely in the dendogram. Cluster “K” possessed the two species T. vesiculosum and T. repens whereas cluster “L” was represented with T. michelianum only.
The genus Trifolium has been divided in eight sections [
Origin and ancestry of T. alexandrinum has remained controversial. T. berytheum [
Boundaries among different Trifolium species are extremely difficult to define because of the range of diversity caused by primary polymorphism [
Thus, this study developed a set of primer-pairs which have shown to amplify alleles from T. alexandrinum, T. salmoneum, T. vesiculosum, T. michelianum, T. repens and T. subterraneum, suggesting that this newly developed resource is useful for assessing molecular diversity among accessions of at least six Trifolium species. The seven SSR markers from T. alexandrinum genomic resource and 15 from T. repens genomic resource were able to distinguish different accessions of T. alexandrinum and the species under study. Allelic dissimilarity among morphologically similar accessions (accession 594, a typical T. alexandrinum, forming independent cluster) and clustering together of morphologically distinct accession (Elite II and accession Nos. 33,747 and 36,369) shows the efficiency of SSR primers in the study. High PIC value of SSR proves that these markers were suitable to differentiate among accessions. Cluster analysis indicated suitability of SSR markers for genome analysis. The study could successfully establish the larger diversity of the T. alexandrinum gene pool as superior resource for further breeding and enriching the SSR markers repertoire for further genetic study. The study also established the relatedness of T. subterraneum and T. salmoneum accession with T. alexandrinum, indicating their role in the evolution of T. alexandrinum.
Five species of Trifolium, other than T. alexandrinum, were represented by single accession because of primary interest to characterize the T. alexandrinum germplasm. The interspecific lineage discussed in the study may be more emphatically established with representation of more number of accessions of related species. Although the limited number of SSR primers used in the study could effectively differentiate among species, studies with more SSRs will help exposing intra-species variation and contribution of different species in development of cultivars/ germplasm.
DRM is thankful to Department of Biotechnology, India for Overseas Associateship and Graham Centre for Agricultural Innovation, Wagga Wagga NSW, Australia for agreeing to carrying out this research. Authors are also thankful to Department of Biotechnology, India for financial support to network project.
The authors declare that there is no conflict of interest.
Malaviya, D.R., Raman, H., Dear, B.S., Raman, R., Roy, A.K., Kaushal, P., Chandra, A. and Hughes, S.J. (2019) Genetic Diversity and Lineage Based on SSR Markers of Two Genomic Resources among Trifolium Collections Held within the Australian Pastures Geneban. Open Journal of Genetics, 9, 1-14. https://doi.org/10.4236/ojgen.2019.91001