Phosphorylation of proteins is an important post-translational modification. Me thods to determine the phosphorylation state of proteins are very important to evaluate diverse biological processes. CRK5 is the CDPK-related protein kinase in <i> Arabidopsis </i> , WD-repeat protein (WDRP) might be CRK5-interact-protein based on Y2H results. Here, we used bimolecular fluorescence complementation (BiFC) further to study and visualize the interaction between CRK5 and WDRP in living cells. Then, we combined Phos-tag <sup> TM </sup> SDS-PAGE with western blot (WB) analysis, using WDRP antibody and the anti-6×His antibody, to detect phosphorylated WDRP. This approach confirmed that WDRP might be phosphorylated by CRK5 <i> in vitro </i> . Site mutation analysis suggested that serine-70 might be the amino acid phosphorylated by CRK5 in WDRP. Cell extracts isolated from WT, OERK5, and <i> crk </i> 5 used to analyze the kinase reaction using recombinant WDRP as substrate. These results demonstrated that WDRP was phosphorylated by cell extracts and that there may be additional kinases that phosphorylate WDRP in <i> Arabidopsis </i> . Phos-tag <sup> TM </sup> SDS-PAGE thus provides a suitable and convenient method for analysis of phosphorylation in plants.
Phosphorylation is an important post-translational modification of proteins that regulates protein properties, resulting in dynamic control of enzymatic activity, localization, and complex formation with other proteins [
In 2003, Prof. Koike’s group first reported a selective phosphate-binding tag molecule, Phos-tagTM [
Calcium acts as an important second messenger in plant cells. CDPKs are serine-threonine protein kinases for the transduction of calcium signals in plant cells [
The conventional CDPKs are multifunctional kinases that are involved in the regulation of diverse aspects of cellular function [
To identify proteins capable of interacting with AtCRK5, the N-terminal region of AtCRK5 fusing with the GAL4 DNA-binding domain was used as bait to screen an activation domain-tagged cDNA library prepared from Arabidopsis [
Here, we used bimolecular fluorescence complementation (BiFC) to further study the interaction between CRK5 and WDRP in living cells. We demonstrated a novel application to detect the phosphorylated WDRP in vivo and in vitro using Phos-tagTM SDS-PAGE and WBs. Our findings will provide new insight in the analysis of protein phosphorylation in the calcium signal system in plants.
Seeds of wild-type Arabidopsis thaliana (Columbia-0) and mutant lines, were germinated after two days stratification at 4˚C on half-strength Murashige and Skoog (MS) medium [
The T-DNA insertion mutant crk5 was kindly provided by Dr. Ágnes Cséplő from the Institute of Plant Biology at the Biological Research Center, Hungary.
The pBS-T vector containing the complete ORF CRK5 was digested with Bam H I, and ligated into the binary expression vector pMD, which was digested with Bam H I, thus allowing the gene to be driven by the cauliflower mosaic virus (CaMV) 35S promoter. The construct was transformed into Agrobacterium tumefaciens (GV3101) by heat shock and used to transform Arabidopsis thaliana accession Col-0 plants by floral dipping [
To generate the BiFC constructs, the coding regions of AtCRK5 without stop codons were sub-cloned into 35S-SPYCE vector, and the coding regions of AtWDRP without stop codon were sub-cloned into 35S-SPYNE vector.
Transformation of onion epidermal cells was performed according to the following method. Each plate was shot twice. Each shot contains 270 μg gold particles (1.0 μm in diameter), and particles were coated with 2 μl of pSPYCE-35S-CRK5 and pSPYNE-35S-WDRP recombinant plasmid at 0.5 μg/μl. The gold-coated DNA particles were delivered into onion epidermal cells using the PDS-1000/He Biolistic Particle Delivery System (BioRad Laboratories, Hercules, CA, USA), and the bombarded onion epidermal peels were maintained at 25˚C for at least 12 h until they were examined by fluorescence microscopy (Nikon, Tokyo, Japan) according to Lee et al. [
Total protein was extracted from 4-day-old Col-0 or 8-day-old seedlings using extraction buffer (25 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM DTT, protease inhibitor mixture and phosphatase inhibitor mixture). After centrifugation at 18,000 × g for 20 min at 4˚C, the supernatant was transferred to a new tube and the protein concentration was determined using the Bio-Rad protein assay kit.
The QuikChange® XL site-directed mutagenesis method was used to make point mutations. The complimentary oligonucleotides containing the desired mutation, flanked by unmodified nucleotide sequence were synthesized by Invitrogen company. The complimentary oligonucleotides for WDRP site mutations were shown in the following. WDRPS70A 5’: GCGACGTTCATGTTACTGCAGACAATGCC, WDRPS70A 3’: GGCATTGTCTGCAGTAACATGAACGTCGC, WDRPS227A 5’: GGTCATATTGCCAAGTCATTTAAAACGGATTGTTGC, WDRPS227A 3’: GCAACAATCCGTTTTAAATGACTTGGCAATATGACC, WDRPS264A 5’: GCAAAAGTGCTAGCGAAATTTAGAGCTCAC, WDRPS264A 3’: GTGAGCTCTAAATTTCGCTAGCACTTTTGC, WDRPS289A 5’: GTATGTTGACTTCTGCGGTCGATGGTACAATTCG, WDRPS289A 3’: CGAATTGTACCATCGACCGCAGAAGTCAACATAC.
The full ORF sequence of CRK5 and WDRP were constructed into pET28a and pEA separately using BamH I site, and then the recombinant plasmids were transformed into E.coli DE3 respectively. WDRP site mutations were constructed in to pET28a using BamH I site. 1 mM IPTG was added to the culture, then CRK5-6×His or WDRP-6×His recombinant proteins was purified by Ni-nitrilotriacetic acid agarose affinity chromatography (QIAGEN) according to the manufacturer’s instructions. Fractions containing apparently homogeneous recombinant proteins were dialyzed with storage buffer (10 mM Tris-HCl, pH 7.5) at 4˚C, and stored at −80˚C.
In vitro phosphorylation assays were performed with 1 μg CRK5-6×His or 1 mg extractions isolated from seedlings (4 weeks) in 50 μl kinase buffer (25 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 0.5 mM DTT, and 0.1 mM ATP), 2 μg WDRP-6×His was added as substrate and kept at 30˚C for 30 min. CaCl2 was added, at a final concentration of 2 μM with or without 5 mM Ca2+-chelator EGTA where indicated.
Phos-tag Acrylamide (AAL-107) is commercially available from from Wako Pure Chemical Industries (Osaka, Japan). The kinase reaction mixtures were separated on 10% SDS-polyacrylamide gels which were prepared with 75 μM acrylamide pendant Phos-tag ligand and 150 μM MgCl2 according to the instructions provided by the Phos-tag Consortium. Gels were electrophoresed. Prior to transfer, gels were first equilibrated in methanol-free transfer buffer containing 1 mm EDTA for 10 min and then in transfer buffer without EDTA for 10 min.
Transfer onto Immunoblot Membrane (Millipore) was performed at 75 V at 4˚C for 2 hours. The membrane was incubated for 1 h in TBST blocking buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20, and 5% dry skimmed milk) and for 1 h with anti-6×His (1:2000, Roche) or anti-WDRP antibody (1:500 dilution, NewEast Bioscience) in blocking buffer. After washing with TBST three times, the membranes were incubated for 1 h with peroxidase-conjugated goat anti mouse or rabbit antibody (Pierce; dilution 1:2000), washed with TBST, and overlaid with Immunoblot Western Chemiluminescent horseradish peroxidase substrate to detect target proteins by autoradiography (Tanon 5200, Shanghai).
Seeds were sown on MS medium supplemented with 3% sucrose, and the plates were placed at 4˚C for 2 days in the dark prior to germination. To determine the effect of salt stress, 10-day-old seedlings germinated in normal medium were transferred to medium supplemented with 200 mM NaCl. To test the effect of ABA stress, the seeds were allowed to germinate under normal growth conditions and then 10-day-old seedlings were transferred to medium supplemented with 10 μM ABA. To determine the effect of drought, 10-day-old seedlings were transferred to medium supplemented with 20% PEG 6000.
AtCRK5 has been reported to be required for the proper polar localization of PIN2 in the transition zones of roots. Inactivation of CRK5 results in a root gravitropic defect and stimulates lateral root formation. CRK5 undergoes auto-activation and phosphorylates the hydrophilic T-loop of PIN2 in vitro [
To identify proteins capable of interacting with AtCRK5, the N-terminal region of the kinase fusing to the GAL4 DNA-binding domain, and was used as a bait to screen an activation domain-tagged cDNA library prepared from Arabidopsis [
KinasePhos (http://kinasephos.mbc.nctu.edu.tw/) can computationally predict phosphorylation sites within given protein sequences [
Though WDRP was predicted to be phosphorylated by CRK5, it also remains to be determined whether endogenous WDRP is phosphorylated in plant cells. We used the Mn2+−Phos-tagTM SDS-PAGE method to analyze the phosphorylation state of WDRP in plant cells. Four-week seedlings were used to analyze the phosphorylation state of WDRP in plant cells. First, the full protein was extracted from four-week wild-type seedlings and then separated in Mn2+−Phos-tagTM
gel. The specific protein was detected by WB analysis with anti-WDRP. The bottom and top gels are normal SDS-PAGE and 75 μM Mn2+−Phos-tagTM SDS-PAGE in
We also detected the phosphorylation state of WDRP in the OECRK5 transgene line and the crk5 line. In the OECRK5 transgene line, the CRK5 gene was over-expressed, while in the crk5 line, the CRK5 gene was knocked out. No differences were found in the phosphorylation state of WDRP among WT, OECRK5, and crk5 (
These results implied that WDRP could be phosphorylated and CRK5 might not be the only kinase that can phosphorylate WDRP in plant cells.
In order to further confirm the phosphorylation of AtWDRP by AtCRK5, we completed an in vitro kinase assay with purified recombinant AtCRK5 and AtWDRP proteins. AtCRK5 and AtWDRP were cloned into pET28a and pEA, respectively, and then the recombinant protein, AtCRK5-6×His or AtWDRP-6×His, was purified from Escherichia coli by Ni-NTA resin and then assayed by SDS-PAGE as a single polypeptide, consistent with the predicted molecular mass of the fusion protein (
Phosphorylation by AtCRK5 was performed in a 50 μl reaction mixture containing 25 mM Tris-HCl, pH 7.5, 0.5 mM DTT, 5 mM MgCl2, 100 μM ATP, 1 mg/ml AtWDRP-6×His and either 1 μM CaM and 2 μM CaCl2 or 5 mM EGTA at 30˚C for 30 min. The reaction was initiated by the addition of purified AtCRK5-6×His, terminated by adding a one-fifth volume of 5×SDS sample buffer, and analyzed by Mn2+−Phos-tagTM SDS-PAGE as described above.
Mn2+−Phos-tagTM SDS-PAGE results demonstrated that after the in vitro kinase assay, there was a protein band with slow mobility, in addition to the
WDRP protein band. Based on the principles of Mn2+−Phos-tagTM SDS-PAGE, the band with slow mobility was phosphorylated WDRP. These results implied that WDRP can be phosphorylated by CRK5 and that phosphorylation does not dependent on calcium and calmodulin (
There was only one phosphorylated protein band in
Temporal changes in the ratios of non-phosphorylated to phosphorylated WDRP have been analyzed using Mn2+−Phos-tagTM SDS-PAGE and WB. Consistent with this observation, normal SDS-PAGE and WB were also used to show the time course of kinase reaction using the anti-phosphorylated serine/threonine (1:1000) antibody. Time-course analyses demonstrated that CRK5 rapidly phosphorylated WDRP in the presence of Ca2+/CaM, soon after CRK5 was added to the reaction mixture at 30˚C, and the phosphorylated WDRP accumulated, as shown in normal SDS-PAGE and Mn2+−Phos-tagTM SDS-PAGE (
Site mutation analysis was used to examine the amino acids susceptible to phosphorylation in WDRP. There were four predicted phosphorylation sites in WDRP, all of which were serine, which might be phosphorylated by CaMK II, based on the KinasePhos results. We changed the four serines to alanine respectively, and then the four mutants (named WDRPS70A, WDRPS227A, WDRPS264A, and WDRPS289A) were expressed in E. coli. After purification, recombinant CRK5-6×His was added to the kinase reaction buffer which contained different mutants in the kinase reaction buffer. We found that only WDRPS70A could not be phosphorylated by CRK5 in kinase reaction buffer (
To further determine if WDRP, the possible substrate of protein kinase CRK5, was phosphorylated by plant cell extraction, we performed an in vitro kinase reaction, Mn2+−Phos-tagTM SDS-PAGE, and WB analyses.
AtWDRP-6×His was expressed in E. coli and then purified by Ni-NTA resin. Plant cell extracts were isolated from different four-week seedlings of WT, OECRK5, and crk5. Anti-6×His antibody was replaced by anti-WDRP to identify the endogenic WDRP. Immunoblots of kinase reaction mixtures revealed that WDRP-6×His migrates at its characteristic molecular weight (marked non-P in
When EGTA (an aminopolycarboxylic acid, a chelating agent, which compared to EDTA, has a lower affinity for magnesium, making it more selective for
calcium ions) was added to the kinase reaction system, the phosphorylation state of WDRP was different from the other reaction conditions. In WT, OECRK5, and crk5 extraction systems, the phosphorylated WDRP-6×His band (marked 3) was almost missing, which result implied that this phosphorylation state of WDRP was dependent on calcium (
Using the Phos-tagTM SDS-PAGE method, we analyzed the phosphorylation state of WDRP in four-week seedlings (
Phos-tagTM SDS-PAGE is an electrophoretic method that permits the separation of phosphorylated and non-phosphorylated proteins and is based on the conventional SDS-PAGE technique.
There are many advantages to the Phos-tagTM SDS-PAGE method. First, radioactive and chemical labels are avoided. Radioactive and chemical labels are traditional methods to analyze protein phosphorylation. As radioactive labels are harmful to health and environment, special protective measures should be used in lab. However, the preparation of protein samples, operating procedure, and reagents used for Phos-tagTM SDS-PAGE are almost identical to those for conventional SDS-PAGE. Downstream procedures, such as WB analysis, are applicable. If a protein has multiple phosphorylation sites and exist in multiple phosphorylation state, the resulting differences in the electrophoretic mobility of the various phosphorylated forms of the protein in a lysate sample result in the formation of several bands that can be individually detected. Temporal changes in ratios of phosphorylated to non-phosphorylated proteins can also be analyzed quantitatively [
Thus, the Phos-tagTM SDS-PAGE method facilitates the resolution and separation of proteins with different phosphorylation states and the analysis of the corresponding individual bands on the gel. This is beneficial for investigations of the characteristic functions of various proteins and the relevance of phosphorylation state in cellular processes. This will allow researchers to identify in greater detail the phosphorylation target molecules that are implicated in particular physiological functions or dysfunctions in the cell and their roles in pathogenic mechanisms of diseases. Krauß et al. used this method to analyze the phosphorylation state of GLI3, a transcription factor, protein phosphatase 2A (PP2A), and the ubiquitin ligase, MID1, which regulate the nuclear localization and transcriptional activity of GLI3 [
In this paper, in vitro phosphorylation assays demonstrated that WDRP can be phosphorylated by CRK5 in a kinase reaction system where only one band moved slower than non-phosphorylated WDRP on Phos-tag gel. This result implied that WDRP was phosphorylated by CRK in the in vitro kinase reaction system with sufficient kinase and reaction time. On the contrary, in plant cells, the phosphorylation of WDRP was regulated and demonstrated different phosphorylated states; there were at least three bands, which represented three phosphorylated forms of WDRP (
In the future, detection by Phos-tagTM SDS-PAGE followed by immunoblotting is expected to increase the sensitivity of visualization of multiple phosphorylated variants of a given protein. Phos-tagTM gel-based approaches combined with the MS-based phosphoproteomic method, site-directed mutagenesis analysis, and the in vitro kinase reaction, have shed new light on the phosphorylation dynamics of a typical intracellular signaling molecule in biological and medical fields.
We thank Dr. Ágnes Cséplő from the Institute of Plant Biology at the Biological Research Center, Hungary, who kindly provided the T-DNA insertion mutant crk5. This work was supported by the National Natural Science Foundation of China (Grant No. 31271512 and Grand No. 31570288).
Di Xi performed the genetic and biochemical studies. Le-Ping He prepared all of the expression constructs and protein purification. Sequence analyses were performed by Lei Zhang. Lei Zhang designed the research and prepared the article.
Xi, D., He, L.P. and Zhang, L. (2018) A Highly Sensitive Detection Method, Phos-tagTM Affinity SDS-PAGE, Used to Analyze a Possible Substrate of CDPK-Related Protein Kinase5 in Arabidopsis. American Journal of Plant Sciences, 9, 1708-1724. https://doi.org/10.4236/ajps.2018.98124