Arboviral encephalitis is a group of animal and human illness that is mostly caused by several distinct families of viruses including orthobunya virus, phlebovirus, flaviviruses, and the alphaviruses. Although specific signs and symptoms vary by the type of central nervous system (CNS), initial signs and symptoms are very similar. Therefore rapid immunologic and molecular tools for differential diagnosis of arboviral encephalitis viruses are important for effective case management and control of the spread of encephalitis. The qRT-PCR assay, especially multiplex PCR, has the potential to produce considerable savings in time and resources in the laboratory detection. Meanwhile, the use of IC can prevent false negatives effectively by monitoring the processes of nucleic acid extraction and amplification. This report describes the development of a panel of internally controlled multiplex one-step real-time RT-PCR assays in which two virus specific-probe sets were used in the same reaction for the detection of 15 species arboviral encephalitis viruses: the comparative sensitivity of multiplex one-step qRT-PCR assays to single plex one-step qRT-PCR assays as well as one-step RT-PCR assays for detection of each viral species. And total of 150 human serum samples were detected to evaluate the multiplex one-step qRT-PCR assays. These multiplex one-step real-time RT-PCR assays with IC were evaluated in terms of sensitivity, linearity, precision, specificity, and also field samples including serum and vector. These assays can detect and differentiate arboviral encephalitis viruses by high throughput, sensitive, and specific way. It is useful for clinical management and outbreak control of arboviral encephalitis viruses and vector surveillance.
Arboviral encephalitis is caused by infection with an arbovirus, which transmitted by a mosquito, tick or another arthropod. The commonest cause of human disease is flaviviruses, alphaviruses, orthobunyavirus and the phlebovirus [
Recently, increasing evidence has shown that certain arboviruses such as dengue virus and chikungunya virus may occasionally cause encephalitis in addition to their conventional symptoms, which usually involves headaches, muscle and joint pain, and rashes [
In view of its identifying the selected target gene of RNA viruses rapidly and specifically, probe-based real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay is widely used for virus detection. Some methods for detection of arboviral encephalitis viruses have been published, which provides useful references for people working on them. However, most of these qRT-PCR assays may cover only one or parts of virus strains.
Meanwhile, despite the large number of reported arboviral encephalitis virus real-time RT-PCR assays, few of these assays have been designed to include an internal control (IC), either as an extrinsic molecule spiked into each sample before or after extraction or as a heterologous intrinsic target that is co-extracted with viral RNA. It has been advocated that ICs be used in settings where PCR inhibitors present a significant source of false-negative results, which may be particularly important in the performance of nucleic acid detection [
Therefore, a panel of reliable comprehensive duplex one-step real-time qRT-PCR assays covering all important pathogens, suitable for multiplex screening or specific quantitative identification with fast turn-around time and identical cycling parameters is still urgently needed, so that the unknown samples can be tested simultaneously and effectively.
Here, we established a panel of species-specific internally controlled one-step real-time qRT-PCR assays for multiplex detection of 15 viruses, which covered nearly all the important viral pathogens that cause arboviral encephalitis, including Eastern equine encephalitis virus (EEEV), Western Equine Encephalitis virus (WEEV), Venequilan Equine Encephalitis virus (VEEV), Japanese Encephalitis virus (JEV), Saint Louis Encephalitis virus (SLEV), Murray Valley Encephalitis virus (MVEV), West Nile virus (WNV), Powassan virus (POWV), California Encephalitis virus (CEV), La Crosse virus (LCV), Tick-borne Encephalitis virus (TBEV), Rift Valley Fever virus (RVFV), Toscana virus (TOSV), Dengue virus (DENV), Chikungunya virus (CHIKV) and internal control (IC). All assays were optimized at a same thermal cycling condition, and evaluated under single plex, duplex qRT-PCR assays or RT-PCR assays for detection of the in vitro-transcribed Viral RNAs, which were proved to be reliable molecular tools of early diagnosis. And total of 150 RNA samples from human serum were examined using the multiplex one-step real-time qRT-PCR assays. The duplex one-step real-time qRT-PCR assays were verified that the assays were sensitive, specific and reliable methods for detection of arboviral encephalitisis viruses. And they are useful for clinical management and outbreak control of arboviral encephalitisis viruses and vector surveillance.
In this study, 15 species viruses were detected, all of genomic sequences were all retrieved from the GenBank database of NCBI (http://www.ncbi.nlm.nih.gov/nuccore/). The multiple alignments and identification of conserved regions of genomic sequences were carried out respectively by Perl script, which using Clustal W alignment program and sequence analysis algorithm. Primers and probe for each virus were designed using a Primer Premier software (version 3.0), and optimized using Oligo software (version 6.0) by analysis of potentials for dimerization, cross-linking and secondary structures. The specificity of primer and probe sequences was further confirmed using primer-BLAST (NCBI). The probes were differently labeled with the fluorescent dyes, FAM, HEX. All oligonucleotides were synthesized by Invitrogen Technology Co., Ltd.
The IC nucleic acids contained primer-binding regions that were designed according to the sequence of the tobacco mosaic virus (isolate Guangyuan, complete genome, http://www.ncbi.nlm.nih.gov/nuccore/HE818460.1). The details of its primers and probes are listed in
Viral isolates propagated in C6/36 or Vero cells, including DENV 1-4 types,
Group | Viruses | GenBank\Accession No. | Forward Primers/Tm value | Reverse Primers/Tm value | Probes/Tm value | Ampliconsize (bp) |
---|---|---|---|---|---|---|
A | EEEV | NC_003899.1 | CTGTGTGTTCGTACGCTGCG/60.1 | GCTGCTTATTTTGCTGTGGGC/60/7 | CGCCCAAGGCGCCGCAGACAA/74.7 | 75 |
WEEV | NC_003908.1 | GATCGGGCCGTCCATGAG/61 | GCTTCTATTTCCTTCAGAGGCG/58.3 | TACGCCCCGCGCCTCGATC/69.3 | 105 | |
B | VEEV | NC_001449.1 | CCCCGTTCAATGTGTCTGTCAC/61.2 | CAGGCTATGCTGCTACGATGC/59.6 | TTGCAGCACAAGAATCCCTCGCG/69.1 | 69 |
CHIKV | NC_004162.2 | TGGCTTTTTTAGCCGTAATGAGC/60.5 | CGGTACTCCCACCGTGTTCG/62.2 | TCGGTGCCCACACTGTGAGCGC/71.5 | 88 | |
C | MVEV | NC_000943.1 | GCCATGATGGTGATGCAACT/58 | CTGTCTGGGAATGAGCAGCC/59.4 | TCGCCCTCCAGCACCAAATCGA/69.6 | 99 |
SLEV | NC_007580.2 | CTTGTGCGTCCTCTCCAGCC/61.8 | CTGGGTGCAAAGCCCCTC/60.2 | CGTGCCAGGGACCCTCCCGAGTC/72.4 | 68 | |
D | WNV | NC_001563.2 | CAGCGATCTCTCCACCAAAGC/60.8 | GGGTCAGCACGTTTGTCATTG/60 | TGCCCGACCATGGGAGAAGCTCA/70.6 | 69 |
JEV | NC_001437.1 | ACTGGGTTACCAAAGCCGTTG/59.9 | AGTCCTTCCACCTCCTCTACAGC/58.9 | CCCCCACGGCCCAAGCCTCGT/73.5 | 152 | |
E | CEV | U12800.1 | AGCAGGATATAGGTCATTTCTGCC/58.7 | GCCAATCGCAGTTGCTTATATG/58.4 | CCCCAGGTGTGCCACTGTTAGATTCC/68.1 | 90 |
LCV | NC_004109.1 | ATACACACCCATCACTTACAGCC/56.7 | CATTTGCAAGAGAGAGGACAAGC/ CATTTGCAAGAGAGAGGACAAGT/59.1 | AGGCAACCAAACTCTTCGCATCCCC/69.5 | 75 | |
F | POWV | NC_003687.1 | GGCACTCCCCAACTCCG/ GGCACTCCCCAGCTCCA/59.3 | GCTGGGGCAAGTCAATCTTG/59.4 | TCAACCCCCATCATCATGCGCCT/70.1 | 81 |
TBEV | NC_001672.1 | GGGGGGCGGTTCTTGTT/59.3 | CACACATCACCTCCTTGTCAGAC/58.2 | CTCCCTGAGCCACCATCACCCAGAC/69.6 | 72 | |
G | TOSV | NC_006320.1 | CTAACTGGGCCACACACATGC/60 | TCACCATTGCTCGCACTGG/60.4 | CTGCCTATTCCCCCCCTAACCCC/67 | 135 |
RVFV | NC_014396.1 | CTTGACCCCCTTCAACATCAAA/59.8 | CTCCAGAATCACCACTTGCTCTAC/58.1 | AAGCCTCTGCCCCAACTGACCCTGC/71.6 | 121 | |
H | DENV | NC_001474.1 | CAAAAGGAAGTCGYGCAATA/53.8 | CTGAGTGAATTCTCTCTGCTRAAC/56.5 | CATGTGGYTGGGAGCRCGC/65.5 | 112 |
IC | HM745932 | GTCAAGATCCTCAAAGATACAGCT/54.8 | ACTCTTGGCCGTTGGTTTG/57.3 | AGTTTGGAGTCTTGGATGTCGCAT/62 | 113 |
CHIKV, TBEV, RVFV and WNV were provided by Wuhan institute of virology, CAS. Human serum samples from healthy persons (n = 150) were assembled from samples library of Ningbo International travel healthcare center. The human serum from JEV patients (N = 20), TBEV patients (N = 13) and DENV patients (N = 29) in the acute phase were from Ningbo center for disease prevention and control, other serum from DENV patients (N = 16) and CHIKV patients (N = 8) were from laboratory of Ningbo International travel healthcare center, which were all confirmed by single plex real-time qRT-PCR assays, and other specific detection methods (virus isolation or IgG detection). These healthy human serums were used as negative control in all the tests, whereas the other viral isolates were implied as positive control in the detection assays for different viruses. Vector tissue samples were collected by our laboratory during vector surveillance in 2015, including mosquito pools (N = 112) and tick (N = 38).
RNA samples used for detection and quantification were prepared using QIAampViral RNA Mini Kit (Qiagen). A total 140 ul of samples which from serum,strain and culture supernatant of virus-infected cells were used for detection and quantification. RNA extraction was performed according to the manufacturer’s instructions for use of the RNA extraction procedure selected, and finally eluted in 60 mL sterilized RNase free water. Viral RNA samples were stored at −80˚C before use, and samples are aliquoted into sample sizes adequate for future use in the lab in order to avoid repeated freeze-thawing.
Single-stranded DNA fragments containing cDNA derived from (DENV, CHIKV, TBEV, RVFV and WNV) which obtained through chemical synthesis or RT-PCR amplification from viral isolates, andcontaining a 5’T7 RNA polymerase promotersequence (TAATACGACTCACTATAGGG) were synthesized. Single-stranded DNA fragments were purified using the Gel Extraction Kit (Qiagen) and performed according to the protocal. Subsequently, the purified single-stranded DNA fragments were transcribed by T7 RNA polymerase using RiboMAXTM Large Scale RNA Production Systems-T7 (Promega), and Viral RNA standards prepared according to the manufacturer’s instructions for use. After in vitro transcription, the RNA transcripts were purified by RNeasyMini Kit (Qiagen), the concentration of RNA transcripts was measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies), and evaluated by 2% agarose gel electrophoresis in the presence of ethidium bromide and visualized by fluorescence under UV light. Dilutions of viral RNA standards ranging from 1.0 × 103 to 1.0 × 107 copies/µL were prepared by 10-fold serial dilution of RNA transcripts in sterilized RNase free water according to the concentration and length of each transcript.
To reduce the assay cost and improve condition for the multiple reaction. Multiplex assays were assembled by grouping the primers and probes according to the hosts/Vectors or viral families for the duplex reaction. Originally, the linear dynamic range of detection for reaction containing one primer-probe set (singleplx) and multiple prime-probe sets for multiple targets (duplex) was determined using One-step real-time qRT-PCR in duplicates with 10-fold serial dilution of a single species of target RNA. Singlex or Multiplex One-step real-time qRT-PCR reactions were performed using AgPath-IDTM one-step RT-PCR Kit (Applied Bio systems), and performed according to the protocol. It was performed in a total reaction volume of 25 ul consisting of 12.5 mL of 2 × RT-PCR buffer, 400 nM of each primer, 120 nM of each probe, 1 mL of Enzyme Mix and 5 mL of viral RNA transcripts or RNA samples. DEPC water was used as negative control. The qRT-PCR standard curve ranging from 1.0 × 103 to 1.0 × 107 copies/µL, was generated from a 10-fold serial dilution of RNA transcripts. Real-time qRT-PCR cycling was performed on ABI 7500 fast system as follows: 45˚C for 10 min, 95˚C for 15 min, then 40 cycles of 15 s at 95˚C for denaturation and 60 s at 60˚C for annealing and extension incubations. Raw data was analyzed with 7500 Software v2.0.6 to determine the amount of viral RNA base on the threshold cycle value (Ct). Multiplex one-step real-time qRT-PCR assays and single one-step real-time qRT-PCR assays were compared for each of the species viruses.
As the standard for comparison, One-step RT-PCR arrays were conduct according to previously reported method. One-step RT-PCR reactions were performed using Ag Path-IDTM one-step RT-PCR Kit (Applied Bio systems), and performed according to the protocol. Briefly, the primers for RT-PCR of each assay are the same as those for qRT-PCR. Also, the templates for RT-PCR are the same as those for qRT-PCR, including the reaction system. The amplified product was analyzed by electrophoresis using 2% agarose gel. The gel was stained with ethidium bromide and the amplified product was visualized under UV light. Multiplex One-step real-time qRT-PCR assays and One-step RT-PCR assays were compared for sensitivity for 15 species viruses.
To assess the specificities of the developed multiplex one-step real-time qRT-PCR assays, each pair of primer-probe was tested in duplicates against all the other in vitro synthetic viral RNA transcripts with the concentration of 1.0 × 106 copies/µL, RNA samples of DENV, CHIKV, TBEV, RVFV, WNV, WEEV and EEEV, as well as serum RNA were extracted from a panel of 150 sera from human without CNS.
To evaluate sensitivity of single plex, multiplex one-step real-time qRT-PCR assays, single plex one-step real-time qRT-PCR assays and one-step RT-PCR assays, each group of 10-fold serial dilutions of RNA transcripts, ranging from 1.0 × 103 to 1.0 × 107 copies/µL, were used as standard preparations to assess the detection limits of viral RNA copy load. Duplicates of the assay within or between runs were performed to assess the reproducibility, and the intra-assay and inter-assay variations over the linear range of the assays were statistically calculated.
Regression, reproducibility and the coefficient of variation (CV)of the mean Ct value for each standard concentration within and between individual PCR runs were statically calculated by SPSS 15 to evaluate linearity and determine the quantitative performance of each assay.
Calculation method:Ct (threshold cycle) is the intersection between an amplification curve and a threshold line. It is a relative measure of the concentration of target in the PCR reaction.
Equation for Ct value: lg X 0 = − C t × lg ( 1 + E x ) + lg M
Linear equation:
Efficiency = ( 10 − 1 slope − 1 ) × 100 %
Genomic sequences of all representative strains of each viral species were downloaded from the GenBank database (Supplementary
For further assessment of specificity and sensitivity for the developed Multiplexone-step real-time qRT-PCR assays, one-step real-time qRT-PCR assays, and one-step RT-PCR assays against the Viral RNAs as the closets virus with DENV, CHIKV, TBEV, RVFV and WNV, Viral RNAs were used and generated via in vitro transcription of single-stranded DNA fragments containing cDNA derived from (DENV, CHIKV, TBEV, RVFV and WNV) and T7 RNA polymerase promoter sequence. The 260 nm/280 nm ratios were all between 2.0 and 2.1, indicating that the RNA products were highly pure. The concentration of RNA transcripts was quantified and the copynumbers were calculated respectively according to the concentration and size of each single-stranded RNA fragment (Supplementary
The sensitivity of multiplex one-step qRT-PCR assays, single plex one-step qRT-PCR assays and one-step RT-PCR assays for detection of each viral species. As shown in Supplementary
The reproducibility of the multiplex one-step real-time qRT-PCR assays for detection of each viral species, duplicates of the assay within or between runs were performed. And mean CT values were calculated at a serial dilution of viral RNA transcript standards (from 1.0 × 103 to 1.0 × 107 copies/µL), and the variations within and between runs in the linear range of the assays were statistically analyzed (Supplementary
Group | Detected viruses | Limits of detection (copies/UL) | ||
---|---|---|---|---|
Single plex qRT-PCR assays | Duplexq RT-PCR assays | RT-PCR assays | ||
A | EEEV | 133.5 | 114.4 | 114,400 |
WEEV | 155.7 | 215.6 | 215,600 | |
B | VEEV | 94.3 | 134.8 | 134,800 |
CHIKV | 103.5 | 146 | 146 | |
C | MVEV | 114.2 | 124.8 | 124,800 |
SLEV | 116.9 | 110.4 | 1104 | |
D | WNV | 105.6 | 116.5 | 11,650 |
JEV | 100.1 | 174.3 | 174,300 | |
E | CEV | 143.9 | 143.5 | 14,350 |
LCV | 85.7 | 94.1 | 9410 | |
F | POWV | 86.3 | 124.3 | 12,430 |
TBEV | 90.4 | 103.5 | 10,350 | |
G | TOSV | 78.1 | 107.1 | 10,710 |
RVFV | 101.3 | 110.6 | 1106 | |
H | DENV | 110.8 | 131.2 | 131,200 |
To verify that multiplex one-step qRT-PCR assays was detecting infectious virus and not simply RNA, the cross-reactivity of the single plex primers/probe was examined using all the in vitro transcribed viral RNA standards with the concentration of 106 copies/mL. We also attempted to 150 RNA samples in the test. RNA samples were isolated Viral RNAs from clinical specimens, healthy human sera and sera from the respective patients infected with individual viruses and vectors infected with individual virus. According to the criteria of qualitative determination in this study, the detection results of all the samples were determined. The multiplex one-step real-time qRT-PCR assays on four related groups of duplex qRT-PCR assays, including Group B, Group D, Group F and Group H, were performed for test the diagnostic specificity and sensitivity in comparison with signleplex qRT-PCR assays. The result showed that no cross-amplification reaction for any other virus was observed in qRT-PCR assays. And all of the specific reactions had high positive fluorescence signals, and mean CTs were in the range of 17 - 24 (
A total of 150 RNA samples which contained 8 CHIKV patients, 20 JEV patients and 13 TBEV patients were tested using the multiplex one-step real-time qRT-PCR assays, the assay sensitivity was 100% with all the tested samples. The result showed 8 positive (8/8) in Group B, 20 positive (20/20) in Group D, 13 positive (13/13) in Group F, and the healthy human sera were negative (
Assay | In vitro transcribed target viral RNA (1 × 106 copies/µL) | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EEEV | WEEV | VEEV | CHIKV | MVEV | SLEV | WNV | JEV | CEV | LCV | POWV | TBEV | TOSV | RVFV | DENV | |
EEEV | 21.18 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
WEEV | - | 20.69 | - | - | - | - | - | - | - | - | - | - | - | - | - |
VEEV | - | - | 20.10 | - | - | - | - | - | - | - | - | - | - | - | - |
CHIKV | - | - | - | 20.53 | - | - | - | - | - | - | - | - | - | - | - |
MVEV | - | - | - | - | 18.04 | - | - | - | - | - | - | - | - | - | - |
SLEV | - | - | - | - | - | 17.86 | - | - | - | - | - | - | - | - | - |
WNV | - | - | - | - | - | - | 18.49 | - | - | - | - | - | - | - | - |
JEV | - | - | - | - | - | - | - | 18.05 | - | - | - | - | - | - | - |
CEV | - | - | - | - | - | - | - | - | 20.12 | - | - | - | - | - | - |
LCV | - | - | - | - | - | - | - | - | - | 21.46 | - | - | - | - | - |
POWV | - | - | - | - | - | - | - | - | - | - | 20.65 | - | - | - | - |
TBEV | - | - | - | - | - | - | - | - | - | - | - | 20.13 | - | - | - |
TOSV | - | - | - | - | - | - | - | - | - | - | - | - | 20.52 | - | - |
RVFV | - | - | - | - | - | - | - | - | - | - | - | - | - | 20.83 | - |
DENV | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 23.29 |
Assay | Viral isolates | Healthy human serum (positive/tested) | ||||||
---|---|---|---|---|---|---|---|---|
WNV | JEV | DENV1-4 | CHIKV | TBEV | RVFV | |||
EEEV | - | - | - | - | - | - | 0/150 | |
WEEV | - | - | - | - | - | - | 0/150 | |
VEEV | - | - | - | - | - | - | 0/150 | |
CHIKV | - | - | - | 20.69 | - | - | 0/150 | |
MVEV | - | - | - | - | - | - | 0/150 | |
SLEV | - | - | - | - | - | - | 0/150 | |
WNV | 19.26 | - | - | - | - | - | 0/150 | |
JEV | - | 18.73 | - | - | - | - | 0/150 | |
CEV | - | - | - | - | - | - | 0/150 | |
LCV | - | - | - | - | - | - | 0/150 | |
POWV | - | - | - | - | - | - | 0/150 | |
TBEV | - | - | - | - | 21.18 | - | 0/150 | |
TOSV | - | - | - | - | - | - | 0/150 | |
RVFV | - | - | - | - | - | 21.94 | 0/150 | |
DENV | - | - | 21.47, 21.12, 25.42, 26.39- | - | - | - | 0/150 | |
Group | Detected Viruses | Patients sera (positive/tested) | Vectors tissues (positive/tested) | Healthy human sera (positive/tested) |
---|---|---|---|---|
B | CHIKV | 8/8 | - | 0/150 |
VEEV | - | - | 0/150 | |
D | WNV | - | - | 0/150 |
JEV | 20/20 | 6/112 | 0/150 | |
F | POWV | - | - | 0/150 |
TBEV | 13/13 | 2/38 | 0/150 | |
H | DENV | 45/45 | 2/112 | 0/150 |
IC | - | - | - |
The test of 45 sera collected from Dengue patients showed 95.6% sensitivity (43 out of 45 detected DENV positive) with only two negative samples (
There are many central nervous system diseases and conditions, including infections of the central nervous system such as encephalitis. Arboviral Encephalitis Viruses are member of animal viruses, including flaviviruses, phlebovirus, orthobunyavirus, and the alphaviruses. And mostly Arboviral Encephalitis Viruses may cause encephalitis in a minority of infected humans.
Due to the unspecific clinical characters at the early phase of CNS, detection of Arboviral Encephalitis Viruses infection is very importance in early diagnosis, and it is important for successful clinical management. There have several methods were reported for detection of Arboviral Encephalitis Viruses. For example Double Antibody Sandwich ELISA was used to detect WNV [
In conclusion, the comprehensive multiplex one-step real-time TaqManqRT-PCR assays for rapid detection of 15 viruses was established and evaluated in this study. The developed multiplex one-step real-time qRT-PCR assay was tested using different simulate samples and showed excellent parameters in the followed statistical analysis. Therefore, this assay proved to be specific, sensitive and, apparently, convenient for rapid and simultaneous identification in laboratory, and could be certainly extended to routine diagnosis and epidemiological detection of arboviral encephalitis infections.
The arboviral encephalitis virus panel with IC developed in this study was found to be highly specific and sensitive in the detection of 15 encephalitis viruses from clinical specimens and vector tissues. The use of IC prevented false negative readings and improved accuracy of the assay. The panel can be a great aid to clinical management, vector surveillance and outbreak response of CNS in the future.
The authors thank Dr. Bo Zhang, Dr. Hongping Wei and staff of Wuhan Institute of Virology for their technical assistance and for virus strains. We thank Dr. Yuping Luo for her linguistic advice.
According to the medical research regulation of National Health and Family Planning Commission, China, all studies involved in human samples were reviewed and approved by the ethics committee of Ningbo International Travel Healthcare Center, which uses international guidelines to ensure confidentiality, anonymity, and informed consent. The written informed consent was agreed by the donors.
The authors have declared no competing financial interests exist.
This work was supported by Project of Zhejiang Provincial Natural Science Foundation (LY16H260004) and Project of Ningbo Entry-exit Inspection and Quarantine Bureau Science and Technology Program (Y2015-15).
Zhou, D.G. and Luo, J. (2018) Development and Validation of Multiplex One-Step Real-Time TaqManqRT-PCR Assays for Detection and Quantification of Arboviral Encephalitis Viruses. Advances in Microbiology, 8, 519-557. https://doi.org/10.4236/aim.2018.87036
Families | Genus | Species | Vector | GenBank accession numbers | Total numbers |
---|---|---|---|---|---|
Togaviridae | Alphavirus | Eastern equine encephalitis virus | mosquito | NC_003899.1,KJ469600.1,KJ469595.1,X63135.1,KJ469583.1,KJ469566.1,KJ469603.1,KJ469636.1,AY722102.1,KJ469617.1,KJ469611.1,KJ469599.1,KJ469557.1,KJ469609.1,KJ469635.1,EF568607.1,KJ469630.1,KJ469567.1,KJ469624.1,KJ469575.1,KJ469563.1,KJ469593.1,KJ469579.1,EF151502.1,KJ469638.1,KJ469610.1,KJ469616.1,KJ469602.1,KJ469577.1,KJ469561.1,KJ469634.1,KJ469559.1,KJ469573.1,KJ469587.1,KJ469639.1,KJ469592.1,KJ469560.1,KJ469643.1,KJ469646.1,KJ469632.1,KJ469651.1,KJ469647.1,KJ469618.1,KJ469568.1,KJ469619.1,KJ469591.1,KJ469631.1,KJ469556.1,KJ469642.1,KJ469582.1,KJ469597.1,KJ469628.1,KJ469613.1,KJ469606.1,KJ469584.1,KJ469588.1,KJ469562.1,KJ469555.1,KJ469633.1,KJ469570.1,KJ469625.1,KJ469571.1,KJ469572.1,KJ469612.1,KJ469608.1,KJ659366.1,KJ469620.1,AY705240.1,KJ469650.1,KJ469649.1,KJ469604.1,KJ469615.1,KJ469627.1,KJ469605.1,KJ469644.1,KJ469629.1,KJ469585.1,AY705241.1,KJ469621.1,KJ469594.1,KJ469607.1,KJ469564.1,DQ241304.1,DQ241303.1,EF151503.1 | 86 |
Western equine encephalitis virus | mosquito | NC_003908.1,AF214040.1,GQ287645.1,GQ287642.1,GQ287641.1,GQ287647.1,GQ287643.1,GQ287644.1,GQ287640.1,GQ287646.1 | 11 | ||
Venezuelan equine encephalitis virus | mosquito | NC_001449.1,AF075254.1,AF075253.1,AF075255.1,AF075259.1,KC344517.1,KC344483.1,KC344485.1,AY741139.1,KC344505.1,KC344516.1,AF069903.1,KC344430.1,KC344524.1,KC344484.1,KC344525.1,KC344486.1,KC344522.1,KC344462.1,KC344459.1,KC344429.1,KC344460.1,KC344523.1,KC344461.1,KC344521.1,KC344513.1,AF100566.1,AF004459.2,AF004472.2,AF004458.2,KC344509.1,KC344508.1,KC344502.1,KC344514.1,KC344487.1,KC344520.1,KC344519.1,KC344477.1,KF985959.1,KC344512.1,KC344528.1,KC344476.1,KC344526.1,KC344504.1,KC344490.1,KC344507.1,KC344518.1,KC344471.1,KC344506.1,KC344488.1,KC344475.1,KC344474.1,KC344511.1,KC344510.1,KC344503.1,KC344472.1,KC344473.1,AF075251.1,AF075252.1,KC344432.1,KC344438.1,KC344437.1,KC344527.1,KC344467.1,KC344434.1,KC344435.1,KC344454.1,KC344436.1,KC344482.1,KC344464.1,KC344465.1,AY823299.1,KC344515.1,KC344466.1,KC344501.1,KC344470.1,KC344491.1,KC344500.1,KC344499.1,KC344496.1,KC344492.1,KC344497.1,KC344498.1,KC344469.1,KC344450.1,KC344453.1,KC344452.1,KC344480.1,KC344478.1,KC344479.1,KC344451.1,KC344449.1,KC344463.1,KC344494.1,KC344489.1,KC344495.1,KC344468.1,KC344481.1,KC344493.1,KC344447.1,KC344431.1,KC344445.1,KC344448.1,KC344457.1,KC344446.1,KC344433.1,KC344440.1,KC344439.1,KC344458.1,KC344441.1,KC344456.1,KC344443.1,KC344455.1,KC344442.1,KC344444.1,AF075256.1,AF075258.1,AF075257.1| | 119 |
Chikungunya virus | mosquito | NC_004162.2,KJ451623.1,KJ451622.1,KJ451624.1,KF318729.1,FJ807897.1,FN295483.3,FN295484.2,EU703760.1,EU703761.1,EU703759.1,EU703762.1,HE806461.1,HM045814.1,HM045808.1,HM045796.1,HM045787.1,HM045802.1,HM045789.1,HM045800.1,HM045790.1,HM045791.1,HM045797.1,EF452494.1,L37661.,EF452493.1,HM045810.1,HM045813.1,HM045803.1,HM045788.1,EF027141.1,EF027140.1,JF274082.1,HM159390.1,HM159389.1,HM159388.1,HM159386.1,HM159387.1,HM159385.1,FJ445511.2,FJ445510.2,FJ000068.1,FJ000062.1,FJ000065.1,EU564335.1,JN558836.1,JN558835.1,JN558834.1,EF210157.2,EF027138.1,FJ807896.1,GU908223.1,FJ445484.2,FJ445433.2,FJ445463.2,GU301779.1,KC862329.1,GU301781.1,FJ445430.2,GQ905863.1,FJ445502.2,FJ445443.2,FJ445445.2,FJ445431.2,FJ445432.2,JX088705.1,FN295485.3,FN295487.2,FJ807899.1,GU199353.1,GU199352.1,GU301780.1,GQ428212.1,FJ000069.1,GQ428213.1,GQ428214.1,EU244823.2,HM045801.1,GU199350.1,GU189061.1,FJ513679.1,FJ513628.1,FJ513657.1,FJ513629.1,FJ513637.1,FJ513635.1,FJ445428.2,AB455494.1,AB455493.1,FJ445427.2,EF027137.1,FJ000066.1,HM045799.1,GQ428211.1,FJ000064.1,FJ000063.1,EU372006.1,FJ807898.1,GQ428215.1,FJ513675.1,GU199351.1,FJ513654.1,FJ513645.1,FJ513673.1,FJ513632.1,FJ445426.2,FJ000067.1,HQ456254.1,HQ456253.1,HQ456252.1,HQ456251.1,DQ443544.2,EU564334.1,FJ959103.1,EF012359.1,EU037962.1,FR717337.1,FR717336.1,HQ456255.1,EF027134.1,EF027136.1,EF027135.1,GQ428210.1,HM045794.1,HM159384.1,HM045823.1,HM045784.1,HM045812.1,EF027139.1,HM045793.1,JQ067624.1,HM045822.1,AF369024.2,AF490259.3,HM045821.1,HM045806.1,HM045805.1,HM045795.1,HM045792.1,HM045811.1,HM045809.1,HM045819.1,HM045818.1,HM045820.1,AY726732.1,HM045807.1,HM045786.1,HM045816.1,HM045804.1,HM045798.1,HM045785.1,HM045815.1,HM045817.1 | 154 | ||
---|---|---|---|---|---|
Flaviviridae | Flavivirus | Japanese encephalitis virus | mosquito | NC_001437.1,JF915894.1,HM596272.1,JF706274.1,JN381840.1,FJ495189.1,JN381839.1,JN381845.1,JN381844.1,JF706267.1,JN381836.1,JN381835.1,JN381837.1,JN381838.1,GU187972.1,JN381831.1,JN381832.1,JF706268.1,JN381833.1,KC196115.1,JF499790.1,JQ031753.1,JF706277.1,GU205163.1,JN381830.1,JN381834.1,JN381842.1,JN381841.1,AB241118.1,AB698909.1,AB698906.1,AB698905.1,AB698908.1,AB698907.1,AB853904.1,HM366552.1,JN381843.1,AB594829.1,JN381849.1,GU556217.1,EU693899.1,EU429297.1,EU880214.1,AB830335.1,HQ893545.1,JF706286.1,JF499789.1,JF499788.1,JF706271.1,JN381852.1,JN381850.1,HM228921.1,JF706270.1,JN381851.1,JN381846.1,AB241119.1,JF706281.1,JF706278.1,JN381848.1,JN381847.1,AY316157.1,JF706282.1,AF045551.2,GQ902062.1,GQ902061.1,GQ902059.1,GQ902058.1,GQ902060.1,JF706279.1,AF217620.1,AY303791.1,AY303792.1,AF254453.1,AF254452.1,AB196924.1,KF907505.1,AB196926.1,AB196923.1,AB196925.1,AF069076.1,JF706275.1,GQ918133.2,AY508813.1,AY508812.1,JF706280.1,AF098737.1,AF098736.1,AF098735.1,AF221500.1,AF221499.1,AY303794.1,AY303793.1,AY303797.1,AY303796.1,AY303798.1,AY303795.1,M18370.1,EF543861.1,AB551990.1,JN381869.1,GQ199609.1,AY585243.1,AY585242.1,A | 166 |
B551992.1,AB551991.1,KF297916.1,KC915016.1,JN381873.1,JF706269.1,JN381872.1,KC517497.1,D90194.,D90195.,JN604986.1,AF315119.1,JQ086762.1,JN864064.1,JQ086763.1,KF297915.1,AF416457.1,M55506.1,JN381870.1,EF623988.1,EF623989.1,AF075723.1,GQ902063.1,EF623987.1,JN381871.1,JF706283.1,JN381865.1,EF107523.1,AY849939.1,JN381853.1,JN381854.1,U47032.1,JF706276.1,JN381858.1,JF706272.1,JN381856.1,JN381857.1,JN381855.1,JF706273.1,JN381859.1,JN381860.1,JN381861.1,JN381863.1,JN381862.1,JN381864.1,JN381867.1,JN381866.1,L48961.1,L78128.1,JN381868.1,EF571853.1,HE861351.1,JN711459.1,JN711458.1,JF706284.1,FJ185037.1,FJ185036.1,JF706285.1,JX072965.1,JX050179.1,JX131374.1,AF080251.1,JN644310.1| | 8 | ||||
---|---|---|---|---|---|
Saint Louis encephalitis virus | mosquito | NC_007580.2,DQ525916.1,JQ957868.1,JQ957869.1,JF460774.1,EU566860.1,FJ753286.2,FJ753287.2 | |||
Murray Valley encephalitis virus | mosquito | NC_000943.1,AF161266.1,JX123032.1 | 3 | ||
West Nile virus | mosquito | NC_001563.2,KC601756.1,JQ928175.1,JQ928174.1,AF404757.1,AF404756.1,AF404755.1,AF404754.1,AF404753.1,AY646354.1,GQ379161.1,GQ379160.1,GQ379159.1,GQ379158.1,GQ379157.1,GQ379156.1,GU011992.2,AY842931.3,FJ527738.1,DQ377180.1,DQ377179.1,DQ377178.1,KF647253.1,KF647252.1,KF647251.1,KF647250.1,KF647249.1,KF647248.1,KF588365.1,KF179640.1,KF179639.1,KF234080.1,JN393308.1,JF957186.1,JF957185.1,JF957184.1,JF957183.1,JF957182.1,JF957181.1,JF957180.1,JF957179.1,JF957178.1,JF957177.1,JF957176.1,JF957175.1,JF957174.1,JF957173.1,JF957172.1,JF957171.1,JF957170.1,JF957169.1,JF957168.1,JF957167.1,JF957166.1,JF957165.1,JF957164.1,JF957163.1,JF957162.1,JF957161.1,JF719069.1,JF719068.1,JF719067.1,JF719066.1,JF719065.1,FJ411043.1,AY660002.1,AF206518.2,AF260968.1,AF260967.1,AY765264.1,DQ176636.2,DQ176637.1,KF704158.1,KF704153.1,KF704147.1,KC954092.1,KC711059.1,KC711057.1,KC736502.1,KC736501.1,KC736500.1,KC736499.1,KC736498.1,KC736497.1,KC736496.1,KC736495.1,KC736494.1,KC736493.1,KC736492.1,KC736491.1,KC736490.1,KC736489.1,KC736488.1,KC736487.1,KC736486.1,JQ700442.1,JQ700441.1,JQ700440.1,JQ700439.1,JQ700438.1,JQ700437.1,HM147824.1HM147823.1,HM147822.1,JX123031.1,JX123030.1,JX556213.1,HM488124.1,HM488123.1,HM488122.1,HM488176.1,HM488175.1,HM488174.1,HM488173.1,HM488172.1,HM488171.1,HM488170.1,HM488169.1,HM488168.1,HM488167.1,HM488166.1,HM488165.1,HM488164.1,HM488163.1,HM488162.1,HM488161.1,HM488160.1,HM488159.1,HM488158.1,HM488157.1,HM488156.1,HM756659.1,HM756658.1,HM756657.1,HM756656.1,HM756654.1,HM756653.1,HM756652.1,HM756651.1,HM756650.1,HM756649.1,HM756648.1,HM488236.1,HM488235.1,HM488234.1,HM488233.1,HM488232.1,HM488231.1,HM488230.1,HM488229.1,HM488228.1,HM488227.1,HM488226.1,HM488225.1,HM488224.1,HM488223.1,JN858070.1 | 157 |
Powassan virus | tick | NC_003687.1,HQ231415.1 | 2 | ||
---|---|---|---|---|---|
Tick-borne encephalitis virus | tick | NC_001672.1,AY169390.3,KF151173.1,FJ968751.1,HM535611.1,HM535610.1,HQ201303.1,GU121642.1,GQ228395.1,FJ997899.1,FJ906622.1,EU816455.2,FJ402886.1,FJ402885.1,EU816454.1,EU816453.1,KC835597.1,KC835596.1,KC835595.1,DQ401140.3,KC414090.1,JF819648.2,HQ901367.1,HQ901366.1,HM859895.1,HM859894.1,EU816452.1,EU816451.1,EU816450.1,GQ266392.1,AF069066.1,FJ572210.1,JX534167.1,AB753012.1,JQ650523.1,JQ650522.1,JF316708.1,JF316707.1,KJ000002.1,KF951037.1,EF469662.1,EF469661.1 | 41 | ||
Dengue virus | mosquito | DENV1:AF311957,AF311958,AF513110,EU482497, EU482500-EU482502,EU482509,EU482511,EU482512,EU482515,EU482516,EU482521,EU482525,EU482526,EU482533-EU482535,EU482538,EU482539,EU482567,EU482706,EU482800,EU482802,EU482803,EU482822,EU482823,EU596501,EU660390,EU660391,EU687247,EU848545,FJ024423,FJ024440,FJ024441,FJ024442,FJ024446,FJ024448,FJ024472,FJ024480,FJ024481,FJ205873,FJ205874,FJ410290,FJ432720,FJ461307,FJ461308,FJ461310,FJ461330,FJ461335,FJ461336,FJ461341,FJ639669,FJ639670,FJ639671,FJ639673,-FJ639678,FJ639680-FJ639684,FJ639686,FJ639688,FJ639692,FJ639796,FJ639797,FJ639802,FJ639812-FJ639814,FJ639824,FJ687432,FJ687433,FJ744701,FJ744702,FJ810415,FJ810419,FJ850068,FJ850069,FJ898391,FJ898423,FJ898424,FJ898430,FJ898431,FJ898433,FJ898437,FJ898448,FN429881-FN429883,FN429887,FN429889,FN429890,GQ199771,GQ199772,GQ199791,GQ199793,GQ199794,GQ199817-GQ199819,GQ199827-GQ199829,GQ199831-GQ199833,GQ199836-GQ199838,GQ199852-GQ199854,GQ199856-GQ199859, GQ199873, GQ199875, J461323, J639823 DENV2:NC_001474,AB122020-AB122024,AF489932,AY702034,AY702040,AY744147,AY858035,AY858036,DQ181797,DQ181798, DQ181803, DQ181804, DQ181806,EF051521,EF457904,EU056810,EU056811,EU056812,EU179857-EU179859,EU359009,EU482608,EU660415,EU677145,EU687212,EU687213, EU687217, EU687220, EU687225, EU687232, EU687241-EU687243,EU687246,EU726767,EU726775,EU781135,FJ024475,FJ024477,FJ182012,FJ226066,FJ390389,FJ410259,FJ410288,FJ432726,FJ461311,FJ639700,FJ639705,FJ639706,FJ639711,FJ639717,FJ639718,FJ639783,FJ639822,FJ810412, FJ850067,FJ850072,FJ850074, FJ850076, FJ850078, FJ850082,FJ850085,FJ850088, FJ850108, FJ850112, FJ906962,FM210202,FM210204,FM210206-FM210213,FM210216-FM2102123,FM210231-FM210234, FM210236-FM210244, FN429891, FN429892, FN429895,GQ199869,GQ199874,GQ199890, GQ199892,GQ199893,GQ199895-GQ199898, GQ199901,GQ252676,GQ252677,M20558,M29095, MD1515 DENV3:NC_001475,AY099337,AY766104,AY770511,DQ863638, EU529699, EU660420, EU854292, FJ182013,FJ182041,FJ898441-FJ898445, FJ898455-FJ898459,FJ898462-FJ898464, FJ898468, | 326 |
Bunyaviridae | Orthobunyavirus | FJ898471,FJ898472,FJ898474, FN429897-FN429900,FN429904,FN429907, FN429909,FN429911,FN429913,GQ199889,GQ199891, GQ252674, GQ252678, M93130 DENV4:AY947539,EU854295-EU854297,EU854299-EU854301,FJ024424,FJ024476,FJ182016, FJ182017,FJ882590-FJ882592, FJ882595-FJ882601, FN429919-FN429922,FN429924-FN429926,GQ199876-GQ199882,GQ199884,GQ252675,MY0327498, MY95328 | |||
---|---|---|---|---|---|
California encephalitis virus | mosquito | U12800.1,AF123483.1 | 2 | ||
La Crosse virus | mosquito | NC_004110.1,NC_004109.1,NC_004108.1,GU591168.1,GU591166.1,GU591165.1,GU591167.1,GU591164.1,GU591169.1,K00610.1,EF485038.1,EF485037.1,EF485036.1,EF485035.1,EF485034.1,EF485033.1,EF485032.1,EF485031.1,EF485030.1 | 19 | ||
Phlebovirus | Rift valley fever virus | mosquito | NC_014396.1,JF784387.1,JF311385.1,JF311384.1,JF311383.1,JF311382.1,JF311381.1,JF311380.1,JF311379.1,JF311378.1,JF311377.1,DQ380222.1,DQ380221.1,DQ380220.1,DQ380219.1,DQ380218.1,DQ380217.1,DQ380216.1,DQ380215.1,DQ380214.1,DQ380212.1,DQ380211.1,DQ380210.1,DQ380209.1,DQ380207.1,DQ380206.1,DQ380205.1,DQ380204.1,DQ380203.1,DQ380200.1,DQ380198.1,DQ380197.1,DQ380196.1,DQ380195.1,DQ380194.1,DQ380191.1,DQ380190.1,DQ380189.1,DQ380188.1,DQ380187.1,DQ380186.1,DQ380185.1,DQ380184.1,DQ380183.1,HE687306.1,HE687303.1 | 46 | |
Toscana virus | Sand fly | NC_006320.1,JX867535.1,EU003177.1,EU003180.1,EU003179.1,EU003178.1,EU003176.1,EU003175.1,EU003174.1,EU003173.1 | 10 |
virus | source | GenBank accession number of the referenced sequence | Length (nt) | Concentration (ng/mL) | Copy number (copies/µL) |
---|---|---|---|---|---|
Eastern equine encephalitis virus | Chemical synthesis | NC_003899.1 | 750 | 867 | 2.0468E12 |
Western equine encephalitis virus | Chemical synthesis | NC_003908.1 | 759 | 904 | 2.1088E12 |
Venezuelan equine encephalitis virus | Chemical synthesis | NC_001449.1 | 935 | 1020 | 1.9316E12 |
Chikungunya virus | Virus isolate | NC_004162.2 | 968 | 820 | 1.4999E12 |
Japanese encephalitis virus | Virus isolate | NC_001437.1 | 967 | 856 | 1.5673E12 |
Saint Louis encephalitis virus | Chemical synthesis | NC_007580.2 | 1011 | 896 | 1.5692E12 |
Murray Valley encephalitis virus | Chemical synthesis | NC_000943.1 | 714 | 351 | 8.7042E11 |
West Nile virus | Virus isolate | NC_001563.2 | 1224 | 1388 | 2.0078E12 |
Powassan virus | Chemical synthesis | NC_003687.1 | 1476 | 712 | 8.541E11 |
Tick-borne encephalitis virus | Virus isolate | NC_001672.1 | 1127 | 893 | 1.403E12 |
Dengue virus | Virus isolate | NC_001474.1 | 730 | 859 | 2.0835E12 |
California encephalitis virus | Chemical synthesis | U12800.1 | 1365 | 315 | 4.086E11 |
La Crosse virus | Virus isolate | NC_004109.1 | 1048 | 822 | 1.3888E12 |
Rift valley fever virus | Virus isolate | NC_014396.1 | 839 | 925 | 1.9521E12 |
Toscana virus | Chemical synthesis | NC_006320.1 | 1237 | 416 | 5.9544E11 |
Assays | RNA transcripts | RNA transcripts concentration | Mean Ct value | Intra-assay CV (%) | Inter-assay CV (%) | linear range |
---|---|---|---|---|---|---|
Group A | EEEV | 107 copies/µL | 18.13 | 1.96 | 3.41 | Y = 3.46x + 46.25 R2 = 0.996 |
106 copies/µL | 22.06 | 2.17 | 2.01 | |||
105 copies/µL | 25.22 | 1.22 | 1.59 | |||
104 copies/µL | 29.31 | 1.05 | 0.51 | |||
103 copies/µL | 33.17 | 1.29 | 0.3 | |||
WEEV | 107 copies/µL | 20.02 | 4.81 | 4.68 | Y = 3.68x + 47.69 R2 = 0.988 | |
106 copies/µL | 22.96 | 3.28 | 0.56 | |||
105 copies/µL | 26.14 | 1.47 | 0.82 | |||
104 copies/µL | 30.11 | 1.3 | 0.4 | |||
103 copies/µL | 34.15 | 0.95 | 0.71 | |||
Group B | VEEV | 107 copies/µL | 17.51 | 4.46 | 1.52 | Y = 3.66x + 47.2 R2 = 0.998 |
106 copies/µL | 21.04 | 3.3 | 0.21 | |||
105 copies/µL | 24.16 | 2.77 | 0.58 | |||
104 copies/µL | 27.20 | 0.69 | 0.44 | |||
103 copies/µL | 30.43 | 1.7 | 0.59 | |||
CHIKV | 107 copies/µL | 19.65 | 0.59 | 0.59 | Y = 3.58x + 47.49 R2 = 0.999 | |
106 copies/µL | 22.14 | 2.74 | 2.74 | |||
105 copies/µL | 25.63 | 0.73 | 0.73 | |||
104 copies/µL | 29.07 | 0.37 | 0.37 | |||
103 copies/µL | 33.12 | 0.14 | 0.14 | |||
Group C | MVEV | 107 copies/µL | 14.82 | 2.87 | 1.27 | |
106 copies/µL | 18.31 | 1.39 | 1.64 | Y = 3.53x + 46.31 R2 = 0.998 | ||
105 copies/µL | 23.85 | 0.73 | 1.72 | |||
104 copies/µL | 28.02 | 0.79 | 1.32 | |||
103 copies/µL | 32.97 | 1.17 | 0.68 | |||
SLEV | 107 copies/µL | 14.57 | 2.82 | 0.98 | Y = 3.56x + 46.69 R2 = 0.997 | |
106 copies/µL | 18.61 | 3.08 | 4.06 | |||
105 copies/µL | 24.03 | 1.97 | 0.9 | |||
104 copies/µL | 28.09 | 1.03 | 0.68 | |||
103 copies/µL | 33.11 | 2.15 | 0.81 | |||
Group D | WNV | 107 copies/µL | 14.61 | 2.2 | 3.79 | Y = 3.54x + 47.26 R2 = 0.997 |
106 copies/µL | 19.58 | 1.16 | 0.37 | |||
105 copies/µL | 24.64 | 0.14 | 0.21 |
104 copies/µL | 28.83 | 1.85 | 0.95 | |||
---|---|---|---|---|---|---|
103 copies/µL | 33.32 | 0.59 | 0.19 | |||
JEV | 107 copies/µL | 14.02 | 4.51 | 3.79 | Y = 3.79x + 44.26 R2 = 0.998 | |
106 copies/µL | 18.57 | 1.01 | 0.37 | |||
105 copies/µL | 24.01 | 0.105 | 0.21 | |||
104 copies/µL | 27.95 | 1.31 | 0.95 | |||
103 copies/µL | 33.12 | 0.43 | 0.19 | |||
Group E | CEV | 107 copies/µL | 18.04 | 3.48 | 4.84 | Y = 3.64x + 46.09 R2 = 0.993 |
106 copies/µL | 21.49 | 2.86 | 3.14 | |||
105 copies/µL | 25.53 | 1.02 | 0.25 | |||
104 copies/µL | 29.32 | 0.45 | 0.66 | |||
103 copies/µL | 33.84 | 2.07 | 1.81 | |||
LCV | 107 copies/µL | 19.01 | 4.52 | 3.49 | ||
106 copies/µL | 23.05 | 1.69 | 0.56 | Y = 3.56x + 50.76 R2 = 0.996 | ||
105 copies/µL | 27.10 | 2.97 | 1.7 | |||
104 copies/µL | 31.19 | 2.57 | 1.56 | |||
103 copies/µL | 34.20 | 1.36 | 0.66 | |||
Group F | POWV | 107 copies/µL | 18.82 | 2.17 | 1.64 | Y = 3.9x + 45.96 R2 = 0.996 |
106 copies/µL | 21.39 | 1.11 | 0.77 | |||
105 copies/µL | 24.92 | 1.37 | 1.63 | |||
104 copies/µL | 28.75 | 0.69 | 0.71 | |||
103 copies/µL | 33.02 | 0.16 | 0.03 | |||
TBEV | 107 copies/µL | 18.06 | 0.71 | 0.2 | Y = 3.68x + 46.52 R2 = 0.996 | |
106 copies/µL | 21.97 | 3 | 2.82 | |||
105 copies/µL | 26.01 | 3.87 | 0.21 | |||
104 copies/µL | 30.03 | 2.84 | 0.34 | |||
103 copies/µL | 33.97 | 1.8 | 0.16 | |||
Group G | TOSV | 107 copies/µL | 18.62 | 0.44 | 1.95 | Y = 3.58x + 50.24 R2 = 0.983 |
106 copies/µL | 21.74 | 2.66 | 0.91 | |||
105 copies/µL | 25.02 | 3.27 | 0.43 | |||
104 copies/µL | 28.97 | 2.1 | 0.31 | |||
103 copies/µL | 32.10 | 2.41 | 0.4 | |||
RVFV | 107 copies/µL | 17.91 | 0.3 | 2.37 | Y = 3.55x + 46.47 R2 = 0.995 | |
106 copies/µL | 21.89 | 0.87 | 0.33 |
105 copies/µL | 25.92 | 1.48 | 0.93 | |||
---|---|---|---|---|---|---|
104 copies/µL | 30.02 | 1.04 | 0.09 | |||
103 copies/µL | 33.89 | 2.11 | 0.27 | |||
Group H | DENV | 107 copies/µL | 18.94 | 4.65 | 3.66 | Y = 3.65x + 50.15 R2 = 0.992 |
106 copies/µL | 22.87 | 1.91 | 0.26 | |||
105 copies/µL | 26.10 | 1.81 | 0.64 | |||
104 copies/µL | 29.83 | 1.07 | 0.1 | |||
103 copies/µL | 33.17 | 1.13 | 0.25 |
CV, coefficient of variation. Intra-assays were determined from two replicates within each dilution. Inter-assays were determined from three independent assays performed on different days.
AbbreviationsCNS: Central Nervous System;
EEEV: Eastern Equine Encephalitis Virus;
WEEV: Western Equine Virus;
VEEV: Venequilan Equine Encephalitis Virus;
JEV: Japanese Encephalitis Virus;
SLEV: St. Louis Encephalitis Virus;
MVEV: Murray Valley Encephalitis Virus;
WNV: West Nile Encephalitis Virus;
POWV: Powassan Virus;
CEV: Californiaencephalitis Virus;
LCV: La Crosse Virus;
TBEV: Tick-Borne Encephalitis Virus;
RVFV: Rift valley Fever Virus;
TOSV: Toscana Virus;
DENV: Dengue Virus;
CHIKV: Chikungunya Virus;
LOD: Limit of Detection;
IC: Internal Control.