Mastitis is one of the most commonly occurring diseases of dairy animals. It is the most important cause of economic losses to the dairy industry in India and throughout the world. In the present study prevalence of microorganisms isolated from mastitic milk and their antibiotic resistance was studied. A total of sixty nine milk samples from mastitic animals (clinical and subclinical) were tested using sodium lauryl sulphate test and those positive were selected and transported to the laboratory for isolation and identification of the causative agent. Out of these samples fifty samples yielded bacterial growth when tested on selective/non selective medium. Of these fifty samples, seven samples had single bacterial growth whereas rest of the 43 samples had mixed growth. Among the bacterial isolates it was found that the highest prevalence was of Streptococcus agalactiae and Staphylococcus aureus followed by E. coli and Klebsiella pneumoniae. Antibiotic sensitivity test revealed that Streptococcus agalactiae revealed the highest sensitivity to ofloxacin, ciprofloxacin, gentamicin and resistance to amoxicillin and doxycycline; Staphylococcus aureus revealed the highest sensitivity to ciprofloxacin, doxycycline, azithromycin and sparfloxacin and resistance to amoxycillin and gentamicin. Similarly, E. coli revealed the highest sensitivity to azithromycin and chloramphenicol and resistance to amoxicillin and teicoplanin, and Klebsiella pneumoniae revealed highest sensitivity to azithromycin, gentamicin and resistance to amoxicillin, teicoplanin and erythromycin. Thus, from the present study it could be concluded that Streptococcus agalactiae, Staphylococcus aureus, E. coli and Klebsiella pneumoniae were the most frequently isolated organisms from mastitic animals and azithromycin and the third generation fluoroquinolones (ciprofloxacin, sparfloxacin and ofloxacin) were the most sensitive drugs.
India ranks number one in the world in terms of total milk production with 146.3 million tones of milk produced annually [
The consequence of mastitis is restricted not only to the dairy farmers but is also a concern to the consumers because of increasing antimicrobial resistance due to the extensive and indiscriminate use of antimicrobials for the management of mastitis [
Primarily diagnosis for mastitis is based on the physiological symptoms, such as swelling and inflammation of the mammary gland or apparent changes in the milk. Because, such symptoms appear only at the chronic or clinical state of mastitis, its earlier diagnosis relies on multitude of simple diagnostic methods. Among these the most commonly employed methods are the measurement of somatic cell count and enzymatic analysis, but, these simple methods hold many discrepancies which could increase the likelihood for false positive or false negative results.
Isolation of bacteria from the aseptically collected milk sample is considered as gold standard. These isolated bacteria could be subjected to antibiotic sensitivity test to know the sensitivity pattern prevailing. Keeping in view the above facts the present study was designed with an objective to isolate and identify bacteria from the mastitic milk and to study their antibiotic sensitivity and resistance pattern.
Milk samples (15 - 20 ml) from mastitic (subclinical and clinical) were collected aseptically after discarding first few streaks of milk from the Teaching Veterinary Clinical Complex, GADVASU, Ludhiana and also from the nearby dairy farms in and around Ludhiana. These samples were collected from January, 2017 till June, 2017. These milk samples were tested with the SLS test by adding three ml of milk and 3% sodium lauryl sulphate test reagent (SLS). The mixture was rocked in the horizontal plane to record the positive reaction as indicated by a gelatinous mass collected near the center of the well. Samples positive via SLS tests were kept on ice and transferred immediately to the laboratory and were subjected for isolation of bacteria.
Milk samples brought to the laboratory were mixed thoroughly and one loop full of the milk sample was inoculated on Brain Heart Infusion (BHI) Agar, Eosin Methylene Blue (EMB) Agar, MacConkey’s Lactose Agar (MLA), Baird Parker Agar (BPA) supplemented with egg-yolk tellurite emulsion, Edward’s medium and Blood Agar (BA) (Hi Media, Mumbai). Later, these inoculated plates were incubated at 37˚C for 16 - 24 hours. The isolated bacterial colonies were subjected to Gram’s staining for the identification of gram positive and negative and were subjected to various biochemical tests (catalase, oxidase, indole, methyl red, voges proskauer’s, citrate, triple sugar iron etc) for confirmation.
All the isolates were tested to fifteen antibiotics which were divided into groups consisting of Quinolones [ciprofloxacin (5 mcg), gatifloxacin (5 mcg), ofloxacin (5 mcg), sparfloxacin (5 mcg)], Penicillin and cephalosporins group [amoxicillin (10 mcg), cephalexin (30 mcg)], Macrolides [azithromycin (15 mcg), erythromycin (15 mcg)], Aminoglycosides [gentamicin (10mcg)], Tetracyclines (tetracycline (30 mcg), doxycycline (30 mcg)), Glycopeptides [vancomycin (30 mcg), teicoplanin (30 mcg)], chloramphenicol (30 mcg) and co-trimoxazole (25 mcg) on Muller Hinton Agar (MHA). In brief, overnight grown culture of individual bacteria in Luria Bertani (LB) broth was uniformly spread onto a Muller Hinton Agar plate with the help of a sterilized cotton swab and antibiotic discs were placed on it and these plates were incubated for 16 - 24 h. Next day, the zone of sensitivity was measured using a ruler and the diameter of the zone was recorded in millimeters (mm). All the isolates were classified as sensitive, intermediate and resistant on the basis of zone of inhibition as per the standard guidelines of CLSI [
The extraction of genomic bacterial DNA was done using Phenol: Chloroform: Isoamyl alcohol (25:24:1) (PCI) as per the method of Sambrook and Russell [
PCR was carried out using genus specific primers for E. coli, Klebsiella pneumoniae, Staphylococcus aureus and Streptococcus agalactiae individually (
Mastitis is characterized by an increase in somatic cells, especially leukocytes, in the milk and by pathological changes in the mammary tissue [
S. No. | Organism | Accession No./Reference | 5’ to 3’ | Amplicon Size (bp) |
---|---|---|---|---|
1 | Escherichia coli | NC_002695.1 | F: TGTTGGGTTAAGTCCCGCAA R: CTCCAATCCGGACTACGACG | 230 |
2 | Klebsiella pneumoniae | NC_06845.1 | F: CTGCATTCGAAACTGGCAGG R: GTTTACGGCGTGGACTACCA | 187 |
3 | Staphylococcus aureus | CP000253.1 | F: GAGCGGGACATGCCCTTTA R: TGTCCGCCTTTTCTTCTTGC | 508 |
4 | Streptococcus agalatiae | NC_004116.1 | F: CTGTGAGATGGACCTGCGTT R: ACGCCCAATAAATCCGGACA | 352 |
implicated to cause mastitis includes Staphylococcus, Streptococcus and members of Enterobacteriaceae etc. In the present study, out of a total of sixty nine milk samples collected from mastitic animals (clinical and subclinical) positive using sodium lauryl sulphate (SLS) test fifty samples had bacterial growth and in rest of the nineteen samples there was absence of bacterial growth. Out of the fifty samples that showed bacterial colonies, only seven had single bacterial growth whereas rest of the 43 samples had mixed growth (
Bacteriological culturing is considered most suitable, accurate and reliable method to confirm the presence of the causative organisms and many investigations have assured it as the gold standard for identifying intramammary infections and for developing a specific mastitis control program for a dairy herd. In the present study, out of a total of 69 samples collected from mastitic animals that were having either clinical/subclinical mastitis, 50 samples yielded bacterial growth. Similar findings have been reported by various workers [
(Total: 50 positive samples) | Percent (%) | |
---|---|---|
Single organism growth | Total: 7 | |
Streptococcus agalactiae | 3 | 42.86 |
Staphylococcus aureus | 4 | 57.14 |
Multiple organisms growth | Total: 43 | |
Klebsiella pneumoniae + Streptococcus agalactiae + Staphylococcus aureus | 2 | 4.65 |
E. coli + Klebsiella pneumoniae | 3 | 6.97 |
E. coli + Staphylococcus aureus + Streptococcus agalactiae | 4 | 9.3 |
E. coli + Klebsiella pneumonia + Staphylococcus aureus + Streptococcus agalactiae | 5 | 11.62 |
Staphylococcus aureus + Streptococcus agalactiae | 14 | 32.55 |
E. coli + Klebsiella pneumoniae + Streptococcus agalactiae | 15 | 34.88 |
Isolation of individual causative agent | Total: 124 | |
Streptococcus agalactiae | 43 | 34.67 |
Staphylococcus aureus | 29 | 23.38 |
E. coli | 27 | 21.77 |
Klebsiella pneumoniae | 25 | 20.16 |
California mastitis test (CMT). Similarly Ergun [
Isolation of individual causative agent revealed that there were a total of 43 (34.67%) Streptococcus agalactiae, 29 (23.38%) Staphylococcus aureus, 27 (21.77%) E. coli and 25 (20.16%) Klebsiella pneumoniae isolated from all the samples on the basis of their cultural, morphological, biochemical characters and polymerase chain reaction. The presence of Staphylococcus and Streptococcus organisms in mastitic milk is a common finding which has been observed by various workers. Fujikura and Shibata [
A combination of all or two or more than two organisms was found in 43/50 (86%) samples indicating that more than one organism was causing mastitis. The above finding is similar to the findings of many workers in which they reported the presence of mixed infection [
Antimicrobial Sensitivity test helps to understand the resistance and susceptibility of bacteria towards a particular drug and thus helping in the choice of drug to be used for treatment. Antibiogram study of the individual organisms isolated viz., Streptococcus agalactiae, Staphylococcus aureus, E. coli and Klebsiella pneumonia from the mastitic milk was done (
In case of Klebsiella pneumoniae, highest sensitivity was observed to azithromycin, gentamicin (100%) each, followed by cephalexin (96%), ciprofloxacin (76%), clotrimazole (72%) doxycycline and vancomycin (64%) each whereas highest resistance to amoxicillin and teicoplanin (100%) each, followed by erythromycin (76%), sparfloxacin (60%), gatifloxacin (56%) and ofloxacin (40%). In an earlier study it was observed that Klebsiella pneumoniae was susceptible to ofloxacin, gentamicin, amikacin, pefloxacin and ciprofloxacin whereas resistance to carbenicillin, piperacillin, ampicillin, co-trimoxazole, cefotaxime, chloramphenicol and tetracycline similar to the findings of our study [
Sr. No. | Antibiotic | E. coli | Klebsiella pneumoniae | Staphylococcus aureus | Streptococcus agalactiae | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
S (%) | I (%) | R (%) | S (%) | I (%) | R (%) | S (%) | I (%) | R (%) | S (%) | I (%) | R (%) | ||
1 | Chloramphenicol(C) (30 mcg) | 100 | 0 | 0 | 100 | 0 | 0 | 72.41 | 0 | 31.03 | 72 | 0 | 28 |
2 | Erythromycin (E) (15 mcg) | 92.50 | 0 | 7.5 | 24 | 0 | 76 | 34.48 | 27.58 | 31.03 | 58.13 | 0 | 41.86 |
3 | Tetracycline (TE) (30 mcg) | 44.44 | 19 | 37.03 | 56 | 8 | 36 | 65.51 | 0 | 34.48 | 23.25 | 9.3 | 67.44 |
4 | Amoxicillin (AMX) (10 mcg) | 0 | 0 | 100 | 0 | 0 | 100 | 6.89 | 0 | 93.10 | 6.97 | 0 | 93.03 |
5 | Co-trimoxazole (COT) (25 mcg) | 25.90 | 14.10 | 60 | 72 | 0 | 28 | 58.62 | 27.39 | 13.79 | 76.74 | 9.3 | 13.9 |
6 | Ciprofloxacin (CIP) (5 mcg) | 70.37 | 0 | 29.62 | 76 | 0 | 24 | 100 | 0 | 0 | 95.34 | 0 | 4.6 |
7 | Gentamicin (GEN) (10 mcg) | 100 | 0 | 0 | 100 | 0 | 0 | 58.62 | 0 | 41.37 | 95.34 | 0 | 4.6 |
8 | Cephalexin (CN) (30 mcg) | 92.5 | 0 | 7.5 | 96 | 0 | 4 | 79.31 | 0 | 20.68 | 76.74 | 0 | 23.25 |
9 | Ofloxacin (OF) (5 mcg) | 37 | 0 | 63 | 36 | 36 | 40 | 68.96 | 31.03 | 0 | 100 | 0 | 0 |
10 | Sparfloxacin (SPX) (5 mcg) | 66.66 | 0 | 33.33 | 40 | 0 | 60 | 100 | 0 | 0 | 81.39 | 9.3 | 9.3 |
11 | Gatifloxacin (GAT) (5 mcg) | 59.25 | 11.11 | 29.62 | 28 | 16 | 56 | 48.27 | 20.68 | 31.03 | 76.74 | 2.32 | 20.93 |
12 | Teicoplanin (TEI) (30 mcg) | 44 | 0 | 66 | 0 | 0 | 100 | 72.41 | 27.58 | 0 | 70 | 0 | 30 |
13 | Azithromycin (AZM) (15 mcg) | 100 | 0 | 0 | 100 | 0 | 0 | 100 | 0 | 0 | 90.69 | 9.3 | 0 |
14 | Vancomycin (VA) (30 mcg) | 44 | 0 | 66 | 64 | 0 | 36 | 68.96 | 0 | 31.03 | 46.51 | 18.6 | 34.88 |
15 | Doxycycline (DO) | 37 | 37 | 26 | 64 | 0 | 36 | 100 | 0 | 0 | 0 | 9.3 | 90.69 |
Antibiotic sensitivity of Staphylococcus aureus revealed highest sensitivity to ciprofloxacin, doxycycline, azithromycin, sparfloxacin (100%) each followed by cefalexin (79.31%), teicoplanin, chloramphenicol (72.41%) each, vancomycin and ofloxacin (68.96%) each and highest resistance to amoxicillin (93.1%) followed by gentamicin (41.37%), tetracycline (34.48%) erythromycin, vancomycin and gatifloxacin (31.03%) each. Mir [
Antibiotic sensitivity of Streptococcus agalactiae revealed highest sensitivity to ofloxacin (100%), followed by ciprofloxacin and gentamicin (95.34%) each, azithromycin (90.69%) and sparfloxacin (81.39%), co-trimoxazole, cefalexin (76.74%) each and highest resistance to amoxicillin (93.03%) followed by doxycycline (90.69%), tetracycline (67.33%), erythromycin (41.86%) and vancomycin (34.88%) which is almost similar to the findings of similar earlier studies [
Thus, from the present study it could be concluded that most frequently isolated organisms form mastitic milk were Streptococcus agalactiae, Staphylococcus aureus, E. coli and Klebsiella pneumoniae and there was a higher percentage of mixed infection in comparison to the single infection. Further, antibiotic sensitivity test on the isolated bacteria revealed azithromycin, ciprofloxacin, sparfloxacin and ofloxacin to be the most sensitive whereas amoxicillin, erythromycin, tetracycline and vancomycin to be the most resistant drugs.
The authors are grateful to the University Grant Commission (UGC), India for the financial support MRP-MAJOR-VETE-2013-31898 (General). The authors are also thankful to the Director Research, GADVASU for providing the necessary laboratory facilities.
Singh, K., Chandra, M., Kaur, G., Narang, D. and Gupta, D.K. (2018) Prevalence and Antibiotic Resistance Pattern among the Mastitis Causing Microorganisms. Open Journal of Veterinary Medicine, 8, 54-64. https://doi.org/10.4236/ojvm.2018.84007