We have previously reported the presence of three types of chitinase (acidic fish chitinase-1: AFCase-1, acidic fish chitinase-2: AFCase-2, fish chitinase-3: FCase-3) in Actinopterygii. In the present research, we report the identification of the novel chitinase genes HjChi (ORF: 1380 bp) and DkChi (ORF: 1440 bp) from the stomach of Chondrichthyes, Japanese bullhead shark ( Heterodontus japonicas) and Kwangtung skate ( Dipturus kwangtungensis), respectively. Organ-specific expression analysis identified the stomach-specific expression of HjChi, whereas DkChi was expressed widely in all organs. Chitinase activity was measured using pNP-(GlcNAc) n ( n = 2, 3) as a substrate and β-N-acetylhexosaminidase (Hex) activity was measured using pNPGlcNAc. Relatively high values of chitinase activity were observed in the stomach, spleen, and gonads of the Japanese bullhead shark, H. japonicas , compared with that observed in the stomach of the Kwangtung skate D. kwangtungensis . However, Hex activity was detected throughout the body of both species. The optimal pH of chitinase in both the Japanese bullhead shark, H. japonicas, and the Kwangtung skate, D. kwangtungensis, were 3.5 - 5.5 and 3.5 - 4.0, respectively, and 4.0 for Hex in both species. Phylogenetic analysis revealed that Chondrichthyes chitinase forms a unique group (Chondrichthyes chitinase). These results suggested that the possibility of the formation of chitinase groups for each class in the phylogenetic analysis based on the observation of class-specific chitinase.
Chitinase (EC 3.2.1.14) is an endo-chitinolytic enzyme that randomly hydrolyzes the β-1,4 glycosidic linkages of chitin to produce N-acetyl chitooligosaccharides ((GlcNAc)n) [
It is reported that chitinase from marine animals displays characteristics that are unlike chitinase from other organisms. In particular, we made very interesting findings regarding chitinase in the stomach of fish that feed on organisms containing a chitin exoskeleton. For example, two or more kinds of chitinase isozymes have been discovered in the stomach of Actinopterygii, one of the most successful vertebrates on earth. The activity of these chitinase isozymes is dependent on an acidic pH and the crystalline α-chitin decomposition activity of these enzymes has been demonstrated to be superior to that of other organisms [
This is the first paper that seeks to clarify the characteristics of Chondrichthyes chitinase compared with the larger group of fish chitinase. This was performed through primary structural analysis, the investigation of chitinase activity, the expression status of mRNA to assess the physiological role in the body, and the use of genetic databases, including phylogenetic analysis.
The Japanese bullhead shark H. japonicus and Kwangtung skate D. kwangtungensis were purchased from the fishing port in Miura City, Kanagawa Prefecture. Each organ was collected, washed with chilled distilled water, and stored at −80˚C until use. Each organ was homogenized with five volumes of 20 mM sodium phosphate buffer (pH 7.3) and centrifuged at 9000 ×g for 20 min at 4˚C. The supernatant was filtered through filter paper to remove floating fat and used as the crude extract solution. The crude extract solution was stored at −80˚C until use.
The sequences of all primers are presented in
Primer name | Sequence (5'-3') | Length | Usage |
---|---|---|---|
Oligo dT | CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTTTTT | 40 mer | cDNA synthesis |
HjChi-a | TGYTAYTTYACNAAYTGG | 18 mer | Conserved region PCR |
HjChi-b | GAYATHGAYTGGGARTAYCC | 20 mer | |
HjChi-c | TTCCARTARTTCATNGCRTARTC | 23 mer | |
DkChi-a | GYNGGNGGNTGGAAYTTYGGNAC | 23 mer | |
DkChi-b | GAYTGGGARTAYCCNGG | 17 mer | |
DkChi-c | AYTTCATNGCRAARTCNAC | 19 mer | |
DkChi-d | TARTANGCNARRAANCCNGC | 20 mer | |
3'RACE | CTGTGAATGCTGCGACTACGAT | 22 mer | 3' RACE PCR |
HjChi-1 | CTGCGTCGTTATGGATTTGATGGT | 24 mer | |
DkChi-1 | GACAAGCATCTCTACACTG | 19 mer | |
DkChi-2 | TTCCTCAGCTCGGCAAGGTAGTT | 23 mer | |
HjChi-2 | AGMSSMRASATGGCAAAGCTT | 21 mer | 5' RACE PCR |
HjChi-3 | AGTCCAGGATTTGTCCAAGCTG | 22 mer | |
AAP | GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG | 36 mer | |
AUAP | GGCCACGCGTCGACTAGTACC | 21 mer | |
DkChi-3 | TTGCTCATCCCACCAGCAAC | 20 mer | |
DkChi-4 | ATCAGCTCCTGAGCCAG | 17 mer | |
DkChi-5 | CGAGATCCAGGATATTCCC | 19 mer | |
DkChi-6 | AAAGCCGTACCCTCTCAGG | 19 mer | |
DkChi-7 | AACTACCTTGCCGAGCTGAGG | 21 mer | |
HjChi-4 | AGAGGCGAGATGGCAAAGCTTCT | 23 mer | Full length amplification |
DkChi-8 | CTCCTGCCCAGAACAGTAAC | 20 mer | |
DkChi-9 | CCCAAGACTGTGGTCAAC | 18 mer | |
β-actin-a | GAAAGACAGTTACGTTGGTG | 20 mer | Organ expression |
β-actin-b | AGAATCTAGCACAATGCCAG | 20 mer | |
HjChi-5 | TCCCAAATTCCCAAGACACT | 20 mer | |
HjChi-6 | TCCAACCCATTCATTTCCAC | 20 mer | |
DkChi-10 | CTGCCTAATGACAAGGATTAC | 21 mer | |
DkChi-11 | GCCGACCCATATTCCATTCT | 20 mer |
analyses were performed using custom kits (5' and 3' RACE System for Rapid Amplification of cDNA Ends, Invitrogen, Carlsbad, USA) in accordance with the manufacturer’s instructions. Thefull-length chitinase genes were amplified using DNA polymerase (PrimeSTAR® Max DNA Polymerase, Takara Bio), in accordance with the manufacturer’s instructions. The PCR products were electrophoresed on a 2% agarose gel and the resolved DNA was extracted using Quantum Prep® Freeze ’N Squeeze spin columns (Bio Rad, Hercules, USA) and ligated into the pGEM-T Easy Vector (Promega). The base sequences were determined using the Big Dye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems, Waltham, USA) and domain prediction was performed using Inter Pro (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory, Hinxton, England).
Total RNA was extracted from the organs of H. japonicus and D. kwangtungensis. cDNA was synthesized from 1.0 μg of total RNA obtained from each organ and an oligo dT primer; 1.0 μg of the synthesized cDNA was amplified using PCR and primers for HjChi, DkChi, and fish β-actin amplification primers. The PCR parameters were 30 cycles of denaturation at 95˚C for 30 s, annealing at 53˚C for 30 s, and extension at 72˚C for 20 s.
Chitinolytic Activity was measured using p-Nitrophenyl-N-Acetyl-β-D-Gluco- saminide (pNP-GlcNAc), p-Nitrophenyl Di-N-Acetyl-β-Chitobioside (pNP- (GlcNAc)2), and p-Nitrophenyl Tri-N-Acetyl-β-Chitobioside (pNP-(GlcNAc)3) (Yaizu Suisan Kagaku Industry Co., Ltd., Shizuoka, Japan) as substrates in accordance with the method described by Ohtakara [
When 4 mMpNP-(GlcNAc)n (n = 1 - 3) was used as a substrate, the optimal pH was determined by assaying enzyme activity. Specifically, the solution was incubated for 20 min at 37˚C in 0.2 M phosphate-0.1 M citrate buffer (pH 2.5 - 8.0) using the same technique used for the measurement of chitinolytic activity.
Phylogenetic analysis based on the deduced amino acid sequences of HjChi and DkChi was performed using the chitinase genes obtained from many organisms. The analysis was performed using ClustalW2 program (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory, Hinxton, England) and the tree view program. A bacterial chitinase (GenBank: X03657) was used as an outgroup.
Using degenerate primers designed based on the deduced amino acid sequences of several vertebrate chitinases, the internal sequences of the cDNA of the stomach of H. japonicas and D. kwangtungensis were amplified by RT-PCR and fragments of 450 bp and 400 bp were obtained, respectively. From the nucleotide sequence of the obtained fragments, upstream and downstream amplification primers were designed. Using the 5'RACE method, the upstream region of the gene fragments, 300 bp and 500 bp, were amplified and the nucleotide sequence of the start codon was included in the gene fragments. In addition, gene fragments of 1300 bp and 1000 bp were obtained by the 3'RACE method, and the analysis of the nucleotide sequence identified a stop codon and polyadenylation signals (AATAAA), each found in the 3'UTR. Based on the untranslated regions of these nucleotide sequences, the full-length primer was designed to sandwich an open reading frame (ORF) and using an enzyme with 3'→5' exonuclease activity, the full-length gene of chitinase was amplified. Based on these methods, we obtained full length chitinase genes from the stomach of both H. japonicas and D. kwangtungensis. The full-length gene of the stomach chitinase of the H. japonicas (HjChi), consisted of 1592 bp and included a 1380 bp ORF encoding 480 amino acids (
A comparison of the deduced amino acid sequences of several varieties of
previously reported chitinase from P. olivaceus (DDBJ: AB121732, AB121733, AB121734) [
Organ-specific expression analysis of HjChi and DkChi chitinase genes from the stomach, intestines, liver, kidney, spleen, and gonads of H. japonicas and D. kwangtungensis was performed (
of biological defense is also suggested in the spleen and gonads for one variety of chitinase.
The distribution of chitinolytic enzyme activity in H. japonicas and D. kwangtungensis was investigated using pNP-(GlcNAc)n (n = 2, 3) as a substrate for the measurement of chitinase activity (
was remarkably low in all organs. Similarly, in D. kwangtungensis, the highest activity for the substrate pNP-(GlcNAc)n (n = 2, 3) was observed in the stomach and minimal activity against pNP-(GlcNAc)2 was also detected in the liver. In H. japonicas, the activity of pNP-(GlcNAc)3 was higher than pNP-(GlcNAc)2 in almost all organs, and the chitinase displayed a similar degradation pattern to the chitinase encoded by the gene AFCase-2 [
The effect of pH on chitinolytic activity was determind in the stomach of the H. japonicus and D. kwangtungensis using pNP-(GlcNAc)n (n = 2, 3) as substrate (
In order to determine the systematic position of the chitinases of Chondrichthyes, HjChi and DkChi, discovered in this study, and that of other fish chitinases, we performed phylogenetic analysis based on the homology of the deduced amino acid sequence of family 18 chitinases of other organisms (
Dasyatis akajei (LC350288), Triakis scyllium (LC350287), M. manazo (LC085613), and S. torazame. The chitinases of Chondrichthyes group were identified to be similar to stomach chitinases and were more similar to the chitinases produced mainly within the stomach, such as AMCase, AFCase-1, and AFCase-2, more than the mammalian macrophage-produced chitotriosidase and the Actinopterygii produced FCase-3, and was particularly similar to the AFCase-2. Further, as in this study, the chitinases of Chondrichthyes were placed in the same group, whether of shark or ray origin; thus, we named the four chitinases obtained from sharks and rays as Chondrichthyes chitinase. These results indicated that fish possess chitinases with different functions and structures because of adaptation and that this was dependent on the feeding habitat and environment. Consequently, each chitinase group was formed based on a network classification by phylogenetic analysis.
Novel chitinase genes were obtained from the stomach of H. japonicas, HjChi (ORF: 1380 bp) and the stomach of D. kwangtungensis, DkChi (ORF: 1440 bp). Although the amino acid sequence of the linker region was unique, the domain structure predicted from the deduced amino acid sequence was a common structure in vertebrate chitinases. Organ-specific analysis identified the expression of HjChi occurred mainly in the stomach of H. japonicas, which indicated a primary role in the digestion of food, whereas DkChi was expressed in all organs of D. kwangtungensis, which was suggestive of a variety of physiological roles. Moreover, chitinase activity against pNP-(GlcNAc)3 was comparatively high in the stomach, spleen, and gonads, whereas chitinase activity against pNP- (GlcNAc)2 was substantially lower in all organs. In contrast, a very high value was obtained for chitinase activity against pNP-(GlcNAc)n (n = 2, 3) in the stomach of D. kwangtungensis. Hex activity was widely observed throughout the body of both species of fish. In addition, the optimal pH of the stomach chitinase of both H. japonicas and D. kwangtungensis was similar to that reported for the stomach chitinase of Actinopterygii. Based on our phylogenetic analysis, HjChi and DkChi do not belong to previously reported groups; thus, a new group, Chondrichthyes chitinase, was established owing to the similarities with AMCase, AFCase-1, and AFCase-2, which are mainly expressed in the stomach, unlike chitotriosidase and FCase-3. These results suggested the existence of class- specific chitinase in the fish kingdom. Hence, it was possible to classify chitinase groups, along with the application of phylogenetic analysis. Our studies are expected to lead to efficient chitin degradation and production of chitin oligosaccharides of specific chain length by obtaining knowledge of chitinase of various properties of fish kingdom. In addition, we are going to try expression of protein in future.
This work was supported in part by College of Bioresource Science, Nihon University Grant (2017).
Watanabe, M., Kakizaki, H., Kanai, M., Kawashima, S., Hamaguchi, K., Mizuno, H., Ueno, T., Yasukawa, C., Agata, R., Ikeda, M., Fukushima, H., Ueda, M. and Matsumiya, M. (2018) Chondrichthyes Chitinase: Molecular Cloning, Distribution, and Phylogenetic Analysis. Open Journal of Marine Science, 8, 136-151. https://doi.org/10.4236/ojms.2018.81007