The aim of the study was to clarify the role of LGR5 in the process of formation and development of gastric cancer. The expression of LGR5 in gastric cancer and corresponding non-cancerous gastric tissues of 52 gastric cancer patients was assessed with the real-time fluorescence quantitative polymerase chain reaction (RT-PCR) and immunohistochemistry. We also analyzed the relationship between the expression level and clinicopathological characteristics. LGR5 gene and protein expression in gastric cancer tissues was in both cases significantly higher than in corresponding non-cancerous gastric tissues (both P < 0.05), but no significant relationship was found with clinicopathological parameters including tumor location, depth of invasion, differentiation, lymph node metastasis, stage, gender, age and carcinoembryonic antigen (CEA), and carbohydrate antigen 19-9 (CA19-9) level in peripheral blood pre-operation of patients (P > 0.05, respectively). Furthermore, LGR5 gene expression was markedly higher in gastric cancer tissues of Helicobacter pylori (HP)-positive patients than negative ones (P < 0.05). The result of the study showed that LGR5 might play a significant role in the process of formation and development of gastric cancer as an oncogene. Its effect might be strengthened by HP infection.
Stem cells are a kind of special cells with self-renewal ability, high proliferation and multi-directional differentiation potential, and play an important role in maintaining the integrity of tissue structure and function, repairing after injury and tumorigenesis. Tumor stem cells doctrine that tumor stem cells are primary cell lines in a class of self-renewal, infinite proliferation and multi-directional differentiation of cell subsets, is the tumor growth, metastasis, recurrence of the root causes. Leucine rich repeat containing G-protein-coupled receptor 5 (LGR5) is one of the known stem cell markers. It’s widely distributed in the body, mainly expressed in the muscles, placenta, spinal cord, brain tissue, breast, hair follicles, eyes, genitals and gastrointestinal tract [
After inform consent forms were signed, the specimens including gastric cancer and corresponding noncancerous gastric tissues in general surgery of affiliated hospital of North Sichuan Medical College during April to July in 2013 were collected. All cases were diagnosed as gastric adenocarcinoma with pathological biopsy both preoperation and postoperation. They who had taken anti-HP drug or chemotherapy or radiotherapy lately were removed. The clinicopathological characteristics of patients are summarized in
All samples consisted of gastric cancer and corresponding non-cancerous gastric tissues were obtained intraoperation just after they were cut off. Then part was put into −80˚C refrigerator quickly used for total RNA extraction. The left was dipped in formalin and then embedded with paraffins for INH.
Characteristics N = 52 | |
---|---|
Gender Male 41 | |
Female 11 | |
Age (years) Mean 58.6 ± 11.7 | |
Range 31 - 79 | |
Differentiation Well 2 | |
Moderate 14 | |
Poor 36 | |
Location of tumor Upper 13 | |
Middle 14 | |
Lower 25 | |
Depth of invasion [ | |
T2 10 | |
T30 | |
T4 32 | |
Lymph node metastasis * N0 20 | |
N1 10 | |
N2 14 | |
N3 8 | |
Stage [ | |
II 10 | |
III 24 | |
VI 3 |
14C-urea breath test simple, fast and inexpensive, sensitivity greater than 95%, specificity greater than 90%, HP infection for the first-line diagnosis [
104 gastric cancer and corresponding non-cancerous gastric tissues were ground into fine powder with mortars and pestles in liquid nitrogen. Then total RNA was extracted with TRizol Reagent (Tiangen, China). Later the quality of total RNA was assessed with ultraviolet spectrophotometer (SHIMADZU, Japan) and agarose gel electrophoresis (agarose from Sigma, America; electrophoresis apparatus from BIO-RAD, America). cDNA was synthesized using reverse transcription kit (BioBRK, China) according to instruction. RT-PCR thermocycler (ABI, America) and kit (Takara, Japan) including Pre Mix, Dye and DNase/RNase free ddH2O were used for cDNA amplification. 1 μl cDNA, 10 μl Pre Mix, 2 μl Dye, forward and reverse primer both 0.6 μl (10 pmol/μl) and 5.8 μl DNase/RNase free ddH2O were consisted in amplification system. LGR5 and β-actin primers were synthesized by Invitrogen Company. The primer sequence, reaction condition and product size are all in
Paraffins embedded 104 gastric cancer and corresponding non-cancerous gastric tissues were sectioned to 3 μm in thickness. After the slices were dipped in dimethylbenzene twice each for 10 min, they were put into 100% alcohol, 85% alcohol and 75% alcohol successively, and then washed with running water for deparaffinization. 3% H2O2 covered the whole tissues on slices for 20 min at room temperature and away from light in order to block endogenous peroxidase activity. Heat antigen retrieval was performed in 0.01 M citrate buffer (ph 6.0) at 95˚C for 20 min. Then slices were incubated with Rabbit anti LGR5 monoclonal antibody (ABCAM, England) at a dilution of 1:150 (final concentration: 6.67 μg/ml) at 4˚C overnight. At the next morning the slices were incubated with common secondary antibody (ABCAM, England) at room temperature for 15 min. After colorated with diaminobenzidine and counterstained with hematoxylin, the reaction products were visible. All slices were assessed by two professors of pathology who had no knowledge of any clinic pathological characteristics of the patients. Immunohistochemical results were evaluated for intensity and staining frequency of nuclear and cytoplasmic components. The intensity of staining was graded 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). The frequency was graded from 0 to 5 according to the percentage of positive cells as follows: 0, there was no cell stained; 1, ≤1%; 2, 2% to ≤10%; 3,11% to 50%; 4,51% to 80%; 5, ≥80%. Two scores were ≥1 points judged as positive for LGR5 expression [
T-test or One-way analysis of variance was used for PCR data statistics, and Chi-square test was used for INH results. P < 0.05 was considered to have statistical significance.
Primer name | Primer sequence | Product size (bp) | Reaction condition |
---|---|---|---|
LGR5 | CTCCCAGGTCTGGTGTGTTG GAGGTCTAGGTAGGAGGTGAAG | 149 | 1) 95˚C 30 sec 1 cycle |
2) 95˚C 3 sec | |||
β-actin | F GAGCTACGAGCTGCCTGAC R GTAGTTTCGTGGATGCCAC | 120 | 60˚C 30 sec 40 cycles |
The mean ΔCT value of LGR5 in gastric cancer and corresponding non-cancerous gastric tissues were 7.67 ± 1.80; 9.11 ± 2.37 (t = −4.01, P < 0.05)
The mean ΔCT value of LGR5 in gastric cancer tissues of HP positive and negative patients were 6.71 ± 1.63 and 8.59 ± 1.44 respectively. The variation was significant (P < 0.05;
The CEA data of 3 patients and CA19-9 of 2 patients were lost, so they were removed when made those two statistics analysis. No significant relationship was found between LGR5 and clinic pathological characteristics, including gender, age, tumor’s location, depth of invasion, differentiation, lymph node metastasis, stage and CEA, CA19-9 level in peripheral blood reoperation,
Group | N | LGR5 p |
---|---|---|
Mean ΔCT ± S | ||
+ | 22 | 6.71 ± 1.63 < 0.05 |
_ | 19 | 8.59 ± 1.44 |
Characteristics Number of patients Expression of LGR5 gene Mean ΔCT ± SD T/F P | |||
---|---|---|---|
Gender | |||
Male | 419.26 ± 2.30 | 0.91 | 0.86 |
Female | 119.09 ± 2.49 | ||
Age (year) | |||
-49 | 158.34 ± 2.44 | ||
50 - 59 | 129.38 ± 2.38 | −0.19 | 0.45 |
60 - 69 | 159.81 ± 2.66 | ||
70- | 109.45 ± 1.37 | ||
Stage | |||
I | 157.91 ± 1.74 | ||
II | 88.25 ± 2.27 | 1.05 | 0.38 |
III | 197.16 ± 1.58 | ||
IV | 78.38 ± 1.83 | ||
Lymph node metastasis | |||
N0 20 | 7.68 ± 1.95 | ||
N1 10 | 7.92 ± 1.83 | 0.42 | 0.74 |
N2 14 | 7.38 ± 1.67 | ||
N3 8 | 8.38 ± 2.05 | ||
Differentiation | |||
Moderate - well 16 | 7.76 ± 1.82 | −0.09 | 0.93 |
Poor 36 | 7.71 ± 1.91 | ||
Tumor, s location | |||
Upper 13 | 7.87 ± 1.52 | ||
Middle 14 | 7.87 ± 2.25 | 0.14 | 0.87 |
Lower 25 | 7.57 ± 1.79 | ||
Depth of invasion | |||
T1 - T2 20 | 8.26 ± 1.56 | 0.63 | 0.63 |
T3 - T4 32 | 7.51 ± 1.88 | ||
CEA | |||
(+) 6 | 8.89 ± 2.79 | −0.29 | 0.79 |
(−) 43 | 9.26 ± 2.35 | ||
CA19-9 | |||
(+) 8 | 9.93 ± 2.66 | 0.71 | 0.50 |
(-) 42 | 9.11 ± 2.34 |
The difference between positive rate of LGR5 protein in gastric cancer and corresponding non-cancerous gastric tissues, 86.5% (45/52) and 17.3% (9/52), was significant in statistics (P < 0.01) (see
Leucine rich repeat containing G-protein-coupled receptor 5 is an independent G protein coupled receptor molecule, belonging to the G protein coupled hormone receptor family [
of which 5 are selective cutters, encoding a polypeptide chain consisting of 907 amino acid residues, including 21 signal peptides, 540 external functional regions, 263 transmembrane regions, 83 C-terminal tail. The coding product Lgr5 protein is characterized by 17 leucine-rich repeats in the externally functional region, N-terminal and C-terminal flank-rich cysteine sequences with 4 glycosylation sites, 7 spiral transmembrane areas highly conserved [
Studies have found that [
Xu, X.L., Lv, Q.J., Xie, P., Wei, S.J. and Wang, C.S. (2018) Study on the Relationship between Expression of LGR5 and Clinicopathological Characteristics in Gastric Cancer Patients. Health, 10, 159-169. https://doi.org/10.4236/health.2018.101013