Paramyosin is a rod-shaped muscle protein found exclusively in invertebrates, with <i> α </i> -helices coiled around each other to form a coiled-coil structure. Marine organisms in which the primary structure of paramyosin has been determined are mollusks, including abalone ( <i> Haliotis discus </i> ), mussels ( <i> Mytilus galloprovincialis </i> ), octopus ( <i> Octopus bimaculoides </i> ), and oyster ( <i> Crassostrea gigas </i> ). In contrast, the primary structure of squid paramyosin, which is of particular interest, has yet to be reported. In the present study, cDNA cloning of paramyosins from four squid species, the neon flying squid ( <i> Ommastrephes bartramii </i> ), the Humboldt squid ( <i> Dosidicus gigas </i> ), the golden cuttlefish ( <i> Sepia esculenta </i> ), and the clawed armhook squid ( <i> Gonatus onyx </i> ), was performed to determine the following: the 2605-bp <i> O. bartramii </i> paramyosin gene containing a 2574-bp open reading frame (ORF), the 2691-bp <i> D. gigas </i> paramyosin gene containing a 2640-bp ORF, the 2631-bp <i> S. esculenta </i> paramyosin gene containing a 2574 ORF, and the 2609-bp <i> G. onyx </i> paramyosin gene containing a 2574-bp ORF. The primary structure of the four squid paramyosins was found to contain heptad repeats and an ACD (assembly competence domain), which are characteristic of a coiled coil. A phylogenetic analysis was performed with paramyosin sequences from species including the four squid species examined in this study, the results of which indicated that the four squid paramyosins form a group independent from the paramyosins of other species, to which octopus paramyosins are closest.
Paramyosin is a protein found exclusively in invertebrate muscles [
Squid musculature consists of obliquely striated muscles that are different from vertebrate striated muscles [
Squid muscles are eaten in raw or cooked. As the muscle of squid is covered by four layers of skin and is tough in texture when eaten in raw, it is often prepared by scoring the surface with a knife [
Marine organisms in which the primary structure of paramyosin has been determined are mollusks, including abalone (Haliotis discus, Accession number: BAJ61596), mussels (Mytilus galloprovincialis, O96064), octopus (Octopus bimaculoides, XP-014783284), oyster (Crassostrea gigas, XP-011429255), scallops (Mizuhopecten yessoensis, XP-021345467), and a species of Lingula (Lingula anatina, XP-013380361). With regards to squid paramyosins, the amino acid composition has been described in the Japanese flying squid (Todarodes pacificus) [
Frozen mantle muscle from four squid species, O. bartramii, D. gigas, S. esculenta, and G. onyx, were purchased from IDO-SYOTEN Company (Iwate, Japan). The frozen mantle muscles were stored at −60˚C until use.
Initially, total RNA was prepared from 80 mg of the mantle muscle of each species using 0.8 ml ISOGEN II solution (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. cDNA was synthesized using total RNA and oligo dT primers with a reverse transcriptase (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. cDNA synthesis parameters were as follows: 42˚C for 60 min, followed 70˚C for 15 min. Primers were designed from the conserved sequences of the paramyosins of oyster, mussels, abalone, and octopus previously reported. PCR, 3' RACE, and 5' RACE methods were performed to obtain a DNA fragment, and this fragment was then sequenced. PCR for first-strand cDNA synthesis was performed using a Go Taq Master Mix (Promega Corporation, Tokyo, Japan). PCR parameters for the first PCR were as follows: Initial denaturation at 95˚C for 30 s, followed by 35 cycles of 95˚C for 30 s, 55˚C for 30 s, and 72˚C for 1 min. Nested PCR was performed using the same PCR parameters, except that samples of the first PCR products were 10-fold diluted. PCR parameters for the 3' RACE analyses were as follows: Initial denaturation at 95˚C for 30 s, followed by 30 cycles of 95˚C for 30 s, 55˚C for 30 s, and 72˚C for 1 min. The 5' RACE analyses were performed using kits provided by Invitrogen (Carlsbad, CA) according to the manufacturer’s instructions. PCR for full-length cDNA cloning was performed using platinum® Pfx Taq DNA polymerase (Invitrogen). The full-length PCR parameters were as follows: 95˚C for 2 min, followed by 30 cycles of 95˚C for 30 s, 51.5˚C for 30 s, and 72˚C for 3 min. DNA analysis was performed using BigDye Terminator v3.1 (Thermo Fisher Scientific, Kanagawa, Japan).
Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed by using 12.5% commercial polyacrylamide gels (e-PAGEL, ATTO Corporation, Tokyo, Japan) according to the method of [
The polyacrylamide gel applied to 1/50 (v/v) samples to CBB stained one was stained with AE-1360 Ez Stain Silver (ATTO, Tokyo, Japan). A gel slice was cut into small pieces and destained with destaining solution (15 mM K3 [Fe(CN)6], 50 mM Na2S2O3). Destained gel pieces were trypsinized as described in the manual for the In-Gel Tryptic Digestion Kit (Thermo Scientific, Waltham, MA). The peptide mixtures obtained were subjected to a nanoscale liquid chromatography-electrospray (Thermo Scientific) equipped with a captive spray ionization source (Michrom Bioresources, Auburn, CA) and an Advance UHPLC System (Michrom Bioresources).
The deduced amino acid sequences were aligned using the ClustalW program (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory). Subsequently, a phylogenetic tree was constructed based on the neighbor-joining method using software Mega6 software [
Initially, cDNA was synthesized from frozen muscle RNA. Using this cDNA as a template, PCR was performed with the primers (pmF-1,2 and pmR-1,2) designed from paramyosin sequences of oyster, octopus, abalone, and mussels, as previously reported, to obtain the internal sequence of squid paramyosins (
The full-length amplified fragments were inserted into the T-easy vector
(Promega Corporation) for cloning. The entire base sequence of paramyosin was determined through sequence analysis for these clones. The O. bartramii paramyosin gene was cloned as a 2605-bp fragment containing a 2574-bp ORF, encoding a polypeptide of 858 amino acids. The D. gigas paramyosin gene was cloned as a 2691-bp fragment containing a 2640-bp ORF, encoding a polypeptide of 880 amino acids. The G. onyx paramyosin gene was cloned as a 2609-bp fragment containing a 2574-bp ORF, encoding a polypeptide of 858 amino acids. The S. esculenta paramyosin gene was cloned as a 2631-bp fragment containing a 2574 ORF, encoding a polypeptide of 858 amino acids. The entire base sequence and the deduced amino acid sequence obtained for O. bartramii, D. gigas,
Primer name | Sequence | Primer name | Sequence |
---|---|---|---|
3'end | cDNA cloning | ||
pm3'F-2 | AAGTCTGCGCAAGCAGCTTG | pmF-1 | GNYTNMGNGARAARGAYGARGA |
pmDg3'F-1 | TCGGAGATGAACTCAGACAGG | pmF-2 | AARAARTAYGARACNGAYATHMG |
pmSe3'F-1 | CAACCGACTTTCCGATGAACTC | pmR-1 | AANGCYTCNGCYTCYTCNARNC |
pmGo3'F-1 | GTTGAGGCCAACAGACTTTCTG | pmR-2 | TTNCKNARNWSYTCNGCYTTYTT |
3′RACE primer | CTGTGAATGCTGCGACTACGAT | pmF-3 | GAYAAYYTNAAYGCNMGNTAYG |
pmR-3 | CGTTGAGTCTGTTCCGTCTAT | ||
5'end | pmR-4 | TCYTCRTCYTTYTCNCKNARNC | |
pmSe5'-1 | TCTCTTACGATTGAGCTCGC | pmF-4 | CARYTNATHATHGARATHGA |
pmSe5'-2 | TTCTGCAACGAGTTTCTCGG | pmR-5 | TTGCTAAGTTGGTTACGC |
AAP | GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG | pmR-6 | GTTACTTTCGGATTCCTC |
AUAP | GGCCACGCGTCGACTAGTAC | pmF-7 | NATHMGNGARYTNGARGAYG |
pmDgR-1 | AGGCTAGTTTCCACTTCC | ||
Full-length | pmSeR-1 | CATTCTGTCGATTGGCAGTATC | |
pm5'-F1 | CTTTCGGTATCACACTGC | pmSeR-2 | ATTTATACGGACTCGTGC |
pm5'-R1 | GCTGCTCTATTGCGATCA | pmSeR-3 | CATTCATTCTGCGTCTGAG |
pm5'-R2 | CTGCTCTATTGTGATCAGTG | pmGoR-2 | TCAAGAGCACTCTCAAGTTC |
pmGoR-7 | ATCTTGCTAAGTTGGGTACG |
S. esculenta, and G. onyx paramyosins were submitted to the DNA Data Bank of Japan (DDBJ) (Accession numbers: LC272578, LC272579, LC272580, and LC272083).
In general, paramyosin forms a coiled coil structure that contains a heptad repeat consisting of hydrophobic amino acids and a 28-residue repeat consisting of charged amino acids [
The percentage similarity among paramyosin sequences was found to be 96% between O. bartramii and D. gigas, 88% between O. bartramii and G. onyx, 90% between O. bartramii and S. esculenta, 86% between D. gigas and G. onyx, 87% between D. gigas and S. esculenta, and 89% between G. onyx and S. esculenta
(
an exact match.
SDS-PAGE analysis showed that four squid mantle muscles was constituted three major myofibrillar proteins; myosin heavy chain around 250 kDa, paramyosin around 90 kDa and actin around 40 kDa (
and trypsinized. As an example, deduced amino acid sequence of O. bartramii paramyosin and the covered regions of the peptide fragments was shown in
study was actually expressed in each mantle muscles and existed as protein.
Phylogenetic analysis of paramyosin had been reported in fluke species and tapeworm species [
O. bartramii | D. gigas | S. esculenta | G. onyx | |
---|---|---|---|---|
O. bartramii | - | 96 | 90 | 88 |
D. gigas | 96 | - | 87 | 86 |
S. esculenta | 90 | 87 | - | 89 |
G. onyx | 88 | 86 | 89 | - |
in addition to the sequences from the four squid species determined in this study, in order to examine the characteristics of the paramyosin structure (
number | species name | number | species name |
---|---|---|---|
1 | Crassostrea gigas1 | 14 | Lingula anatina2 |
2 | Crassostrea gigas2 | 15 | Schistosoma japonicum |
3 | Crassostrea gigas3 | 16 | Clonorchis sinensis |
4 | Crassostrea gigas4 | 17 | Schistosoma haematobium |
5 | Haliotis discus discus | 18 | Paragonimus westermani |
6 | Haliotis discus hannai | 19 | Schistosoma mansoni |
7 | Biomphalaria glabrata1 | 20 | Echinococcus granulosus |
8 | Biomphalaria glabrata2 | 21 | Taenia saginata |
9 | Mytilus galloprovincialis | 22 | Taenia solium |
10 | Mizuhopecten yessoensis1 | 23 | Ommastrephes bartramii |
11 | Mizuhopecten yessoensis2 | 24 | Dosidicus gigas |
12 | Octopus bimaculoides | 25 | Sepia esculenta |
13 | Lingula anatina1 | 26 | Gonatus onyx |
shellfish species showed greater diversity compared to the other groups of species. Fluke [
The primary structures of four squid paramyosins were determined. In each sequence, heptad repeats (abcdefg) were identified, as well as hydrophobic amino acids in many of the a and d positions and charged amino acids in the e and g positions, representing a characteristic coiled-coil structure. A highly conserved ACD consisting of 29 residues was found in the C-terminal region, through which paramyosin molecules are suggested to polymerize.
The results of phylogenetic analysis showed that the four squid paramyosins form a group independent from the paramyosins of other species, to which octopus paramyosins are most closely related. Fluke and tapeworm paramyosins also formed independent groups, whereas shellfish paramyosins remained dispersed.
This research was supported in part by a grant from a scheme to revitalize agriculture and fisheries in diester area through deploying highly advanced technology.
Kajita, T., Takeda, Y., Yoshida, S., Yamada, K., Matsumiya, M. and Fukushima, H. (2018) cDNA Cloning of Paramyosin from Several Kinds of Squid Mantle Muscle. Advances in Bioscience and Biotechnology, 9, 11-25. https://doi.org/10.4236/abb.2018.91002