Objectives: Dyshomeostasis of the dopaminergic system is implicated in the pathophysiology of eating disorders (EDs). We have previously reported an association between 3'-UTR VNTR (three prime untranslated region variable number of tandem repeat) of the Dopamine Transporter 1 ( DAT1) gene and ED with binge eating behavior (EDBEB). Here we investigated whether variants in the coding region of the DAT1 gene also associate with EDBEB. Methods: The coding region and exon-intron junctions of the DAT1 gene were screened by direct sequencing using genomic DNA from EDBEB patients (n = 90) and healthy subjects (n = 114) on whom 3'-UTR VNTR variants had been previously determined. Results: rs2270912 and rs28363130, two of five known polymorphisms found by this screen, were significantly associated with EDBEB patients by genotype ( p = 0.003, p = 0.011, respectively) and allele ( p = 0.003, p = 0.012, respectively) frequency compared with healthy subjects. Interestingly, these polymorphisms associate with the risk 3'-UTR VNTR variant of EDBEB. Conclusion: Although our sample size was small, we show here that rs2270912 and rs28363130 associates with EDBEB and might act with 3'-UTR VNTR as a haplotype. These findings support the notion that the DAT1 gene plays a key role in the dopaminergic system of EDBEB.
Eating disorders (EDs) are psychiatric disorders that include abnormal eating behaviors, such as refusing to eat (restrictive eating) and overeating (binge eating) or excretory behaviors to prevent weight gain by vomiting food or using laxatives and diuretics, which often develop among young women who are between the stages of late puberty and early adulthood [
The development of EDs has been indicated to be affected by not only a psychosocial sense of value, such as extreme obsession with weight, e.g., being skinny means being beautiful, but also genetic factors [
The dopamine system greatly affects emotions, substance dependence, and eating behaviors [
From our group, Shinohara et al. previously reported the association between EDBEB and 3'-UTR VNTRs in the DAT1 gene by comparing seven or nine VNTR short alleles with 10 or 11 VNTR long alleles [
In this study, we employed the sample sets previously used by Shinohara et al. [
Genomic DNA was extracted from the peripheral blood of test subjects using a QIAamp DNA Blood Kit (Qiagen, Tokyo, Japan). Genomic DNA was stored frozen at −20˚C until the tests mentioned below were conducted.
Intron-exon information of the DAT1 gene was confirmed from the DAT1 mRNA sequence (SLC6A3: NM_001044) and DAT1 gene sequence (NG_015885). Using this information, exons (from exon 2 to 14) that corresponded to the coding region of the DAT1 gene were amplified by polymerase chain reaction (PCR) using the genomic DNA of each test subject as a template. Each primer was designed using the nucleotide sequence of the DAT1 gene as a reference, with primers homologous to the upstream and downstream intron sequences bordering each exon (
Fragment | Forward primer (5' → 3') | Tm (˚C) | Reverse primer (5' → 3') | Tm (˚C) |
---|---|---|---|---|
Exon 2-1a | CTGAAGACCAAGAGGGAAGA | 52 | CAATGACGGACAGGAGAAAG | 52 |
Exon 2-2a | CAAGGAGCAGAACGGAGTG | 53 | GGAGGCTGAGATGGGACTT | 53 |
Exon 3 | TCCGAGGCCCCAAACTAAA | 51 | ATGATGCGGCTGGCTTGCT | 53 |
Exon 4-1a | TGATGGTGGCTCTGTGCTC | 53 | GTGGTCCCAAAAGTGTCGT | 51 |
Exon 4-2a | GGGCGCTGCACTATCTCTT | 53 | TCCAACCAAGGGGCTACCA | 53 |
Exon 5 | TTGACAGCCACCCACAGAGT | 54 | AGCACAAAACCCAACTGAGG | 52 |
Exon 6 | GCGTCCCAGGAAATGTTTG | 51 | CCCTGTGGACTGTGAAGCA | 53 |
Exon 7 | GCATCTTCCACCAGTCGTCT | 54 | TGTTCTCATCCAGGGACACC | 54 |
Exon 8 | CCTTCCCCAGACACAGTAA | 51 | AAAAAGGCTTTGCTGAGAG | 47 |
Exon 9 | TTCAGCAGAGCCGCACCAG | 55 | GAACCCAACTGCCGAGGAC | 55 |
Exon 10 | CCGACCCTGTGCTCTGTGT | 55 | GTGCTGCGGTTCTGTCTGG | 55 |
Exon 11 | GGGTTGAATTTTAGGGACTC | 50 | CACAGCCACCAAACAAGAGG | 54 |
Exon 12 | ACTGATGCCACCTCTTCTCC | 54 | CTCCAGCCACAGTGACAACC | 56 |
Exon 13 | GCCTGACCTCCGTATCTGCT | 56 | ACACCCACGGAGCCTTTCTG | 56 |
Exon 14 | GTGAGGGTGCTGGTAGGTGA | 56 | CTGGGGGCTAAGAACACTGA | 54 |
aAs the nucleotide sequences of exons 2 and 4 are long, each exon was split into overlapping fragments and amplified by each specific primer pair.
Fragment | Predenature | Denature | Annealing | Extension | Cycles | Extension | Size (bp) |
---|---|---|---|---|---|---|---|
Exon 2-1 | 94˚C, 2 min | 94˚C, 15 s | 64˚C, 30 s | 68˚C, 18 s | 35 | 68˚C, 4 min | 274 |
Exon 2-2 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 14 s | 35 | 68˚C, 4 min | 206 |
Exon 3 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 258 |
Exon 4-1 | 94˚C, 2 min | 94˚C, 15 s | 68˚C, 30 s | 68˚C, 18 s | 35 | 68˚C, 4 min | 271 |
Exon 4-2 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 243 |
Exon 5 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 291 |
Exon 6 | 94˚C, 2 min | 94˚C, 15 s | 66˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 311 |
Exon 7 | 94˚C, 2 min | 94˚C, 15 s | 58˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 350 |
Exon 8 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 291 |
Exon 9 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 18 s | 35 | 68˚C, 4 min | 289 |
Exon 10 | 94˚C, 2 min | 94˚C, 15 s | 68˚C, 30 s | 68˚C, 16 s | 35 | 68˚C, 4 min | 254 |
Exon 11 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 18 s | 35 | 68˚C, 4 min | 284 |
Exon 12 | 94˚C, 2 min | 94˚C, 15 s | 60˚C, 30 s | 68˚C, 21 s | 35 | 68˚C, 4 min | 233 |
Exon 13 | 94˚C, 2 min | 94˚C, 15 s | 68˚C, 30 s | 68˚C, 16 s | 35 | 68˚C, 4 min | 259 |
Exon 14 | 94˚C, 2 min | 94˚C, 15 s | 66˚C, 30 s | 68˚C, 16 s | 35 | 68˚C, 4 min | 251 |
electrophoresed using 2% agarose gel containing ethidium bromide, and each PCR product was confirmed as having the expected length after exposing the gel to ultraviolet (UV) light. The lengths of each PCR product are shown in
To investigate mutations in the DAT1 gene, the nucleotide sequence of each PCR product was analyzed by direct sequencing. PCR products were electrophoresed using 2% agarose gel containing ethidium bromide, and each PCR product with the predicted length was observed under UV light. Each PCR product was extracted from gels using a Microcon centrifugal filter (EMD Millipore Corp., Billerica, MA, USA) and purified. The nucleotide sequence of each purified PCR product was determined by direct sequencing using an ABI 377S DNA sequencer (PerkinElmer Japan Co., Ltd., Kanagawa, Japan).
Hardy-Weinberg equilibrium analysis (HWE) of each obtained genotype and an association study of the patient group with the healthy subject group were conducted using SNPAlyze Ver.8.0.1 Standard (DYNACOM, Chiba, Japan). However, some identified polymorphisms were not analyzed according to the Hardy-Weinberg equilibrium; therefore, the Cochran-Armitage trend test was performed for the association study. Statistical power was evaluated using single nucleotide polymorphism (SNP) tools (http://www.bioinformatics.org/snp-tools-excel) [
Exons 2-14 of the DAT1 gene were amplified by PCR using genomic DNA from each test sample (total of 204 samples: 90 samples from the patient group and 114 samples from the healthy subject group) as the template and using primers designed such that each primer was homologous to the upstream and downstream intron sequences that bordered each exon. The nucleotide sequence of each sequence was then analyzed by direct sequencing. Five polymorphisms, namely rs460000 (C → A) located in intron 3, rs6347 (A → G) located in exon 9, rs2270912 (C → T) located in exon 10, rs429699 (G → A) located in intron 11, and rs28363130 (A → G) located in intron 13, were identified; however, all these polymorphisms were already registered in GenBank® (https://www.ncbi.nlm.nih.gov/genbank/). Furthermore, rs6347 and rs2270912 were polymorphisms that did not cause amino acid substitutions, although they were located in exons (
dbSNP ID | Sequence change | Positiona | Protein variant | Location |
---|---|---|---|---|
rs460000 | C → A | 12719 | - | Intron 3 |
rs6347 | A → G | 34132 | Ser 405 Ser | Exon 9 |
rs2270912 | C → T | 35708 | Asn 466 Asn | Exon 10 |
rs429699 | G → A | 36417 | - | Intron 11 |
rs28363130 | A → G | 42520 | - | Intron 13 |
aThe position of each identified polymorphism was relative to the first nucleotide of exon 1 of the DAT1 gene (NG_015885).
The possible genotypes of rs460000 (C → A) were C/C, C/A, and A/A, with the number of test samples in each genotype being 25 (27.8%), 48 (53.3%), and 17 (18.95%), respectively, in the patient group and 27 (23.7%), 60 (52.6%), and 27 (23.7%), respectively, in the healthy subject group. HWE showed a p value of 0.530 in the patient group and a p value of 0.708 in the healthy subject group; thus, no significant differences were observed in either group, and they agreed with the HWE.
The possible genotypes of rs6347 (A → G) were A/A, A/G, and G/G, with the number of test samples in each genotype being 67 (74.7%), 23 (25.6%), and 0 (0%), respectively, in the patient group and 98 (86.0%) 13 (11.4%), and 3 (2.6%), respectively, in the healthy subject group. The HWE showed no significant differences in the patient group (p = 0.346); thus, the values agreed with HWE. However, it showed significant differences in the healthy subject group (p = 0.027), and the values did not agree with the HWE.
The possible genotypes of rs2270912 (C → T) were C/C, C/T, and T/T, with the number of test samples in each genotype being 83 (92.2%), 7 (7.8%), and 0 (0%), respectively, in the patient group and 114 (100%), 0 (0%), and 0 (0%), respectively, in the healthy subject group. No samples with T/T were present in both the groups, and no samples with C/T were present in the healthy subject group; therefore, the HWE analysis was not performed.
The possible genotypes of rs429699 (G → A) were G/G, G/A, and A/A, with the number of test samples in each genotype being 35 (38.9%), 41 (45.6%), and 14 (15.6%), respectively, in the patient group and 48 (42.1%), 53 (46.5%), and 13 (11.4%), respectively, in the healthy subject group. The HWE showed a p value of 0.823 in the patient group and a p value of 0.839 in the healthy subject group; thus, no significant differences were observed in either group, and the differences agreed with the HWE.
The possible genotypes of rs28363130 (A → G) were A/A, A/G, and G/G, with the number of test samples in each genotype being 82 (91.1%), 8 (8.9%), and 0 (0%), respectively, in the patient group and 113 (99.1%), 1 (0.9%), and 0 (0%) in the healthy subject group. As no samples with G/G were present in either group, the HWE analysis was not performed. Furthermore, genotype frequency and HWE of each genotype in the patient and healthy subject groups are shown in
The allelic frequency of each C and A allele of rs460000 was 54.4% (98 alleles) and 45.6% (82 alleles), respectively, in the patient group and 50.0% (114 alleles) and 50.0% (114 alleles), respectively, in the healthy subject group. Thus, no significant difference was observed in the allelic frequency between the two groups (p = 0.357).
The allelic frequency of each A and G allele of rs6347 was 87.2% (157 alleles) and 12.8% (23 alleles), respectively, in the patient group and 91.7% (209 alleles) and 19% (83 alleles), respectively, in the healthy subject group. Thus, no significant difference was observed in the allelic frequency between the two groups (p = 0.151).
The allelic frequency of each C and T allele of rs2270912 was 96.1% (173 alleles) and 3.9% (7 alleles), respectively, in the patient group and 100% (228 alleles) and 0% (0 allele), respectively, in the healthy subject group. Therefore, a significant difference was observed in the allelic frequency between the two
Genotype | HWE p value | Allele | P valueb | ||||
---|---|---|---|---|---|---|---|
rs460000 | C/Ca | C/Aa | A/Aa | Ca | Aa | ||
Patient | 25 (27.8%) | 48 (53.3%) | 17 (18.9%) | p = 0.530 | 98 (54.4%) | 82 (45.6%) | p = 0.357 |
Healthy subject | 27 (23.7%) | 60 (52.6%) | 27 (23.7%) | p = 0.708 | 114 (50.0%) | 114 (50.0%) | |
rs6347 | A/A | A/G | G/G | A | G | ||
Patient | 67 (74.4%) | 23 (25.6%) | 0 (0.0%) | p = 0.346 | 157 (87.2%) | 23 (12.8%) | p = 0.151 |
Healthy subject | 98 (86.0%) | 13 (11.4%) | 3 (2.6%) | p = 0.027 | 209 (91.7%) | 19 (8.3%) | |
rs2270912 | C/C | C/T | T/T | C | T | ||
Patient | 83 (92.2%) | 7 (7.8%) | 0 (0.0%) | N/Ac | 173 (96.1%) | 7 (3.9%) | p = 0.0024 |
Healthy subject | 114 (100%) | 0 (0.0%) | 0 (0.0%) | N/Ac | 228 (100%) | 0 (0.0%) | |
rs429699 | G/G | G/A | A/A | G | A | ||
Patient | 35 (38.9%) | 41 (45.6%) | 1 (15.6%) | p = 0.823 | 111 (61.7%) | 69 (38.3%) | p = 0.443 |
Healthy subject | 48 (42.1%) | 53 (46.5%) | 13 (11.4%) | p = 0.839 | 149 (65.4%) | 79 (34.6%) | |
rs28363130 | A/A | A/G | G/G | A | G | ||
Patient | 82 (91.1%) | 8 (8.9%) | 0 (0.0%) | N/Ac | 172 (95.6%) | 8 (4.4%) | p = 0.0057 |
Healthy subject | 113 (99.1%) | 1 (0.9%) | 0 (0.0%) | N/Ac | 227 (99.6%) | 1 (0.4%) |
aData presented as number of subjects and percentage. bP values were calculated by the Cochran-Armitage Trend Test. cN/A means not applicable.
groups (p = 0.0024). Statistical power analyses for allelic frequencies of rs2270912 could not be performed because no alleles of rs2270912 with T were found in the healthy subject group.
The allelic frequency of each G and A allele of rs429699 was 61.7% (111 alleles) and 38.3% (69 alleles), respectively, in the patient group and 65.4% (149 alleles) and 34.6 % (79 allele), respectively, in the healthy subject group. Thus, no significant difference was observed in the allelic frequency between the two groups (p = 0.443).
The allelic frequency of each A and G allele of rs28363130 was 95.6% (172 alleles) and 4.4% (8 alleles), respectively, in the patient group and 99.6% (227 alleles) and 0.4% (1 allele), respectively, in the healthy subject group. A significant difference was observed in the allelic frequency of rs28363130 between the two groups (p = 0.0057); however, the statistical power was 0.60 for the analysis of allelic frequencies of rs28363130. Genotype and allele frequencies of each polymorphism in EDBEB and healthy subject groups are shown in
The associations of EDBEB with rs2270912, rs28363130, and 3'-UTR VNTR were investigated using haplotype analysis. However, the sample number was small, and homozygous rs2270912 T alleles, homozygous rs28363130 G alleles, and homozygous short 3'-UTR VNTRs were not found in our sample sets. Therefore, haplotype frequencies alone were reported. Genetically, 27 haplotypes could be present; however, only six haplotypes were confirmed in the study. Among these haplotypes, the haplotype C/C-A/A-Long/Long
(rs2270912-rs28363130-3'-UTR VNTR) was found to have the highest frequency in the patient group (76.7%: 69/90 samples) and the healthy subject group (91.2%: 104/114 samples) (
All seven patient samples with the rs2270912 T allele, which was not found in the healthy subject group, possessed the short 3'-UTR VNTR, which is a risk allele for developing EDBEB. Furthermore, six of eight patient samples with the rs28363130 G allele had the short 3'-UTR VNTR; moreover, these six samples possessed the rs2270912 T allele (C/T-A/G-Long/Short; 6.7%: 6/90 samples) (
An association study of the DAT1 gene with EDBEB was conducted using 204 genomic DNA samples obtained from 90 patients with EDBEB and 114 healthy subjects among Japanese females. All five polymorphisms found in the DAT1 gene in this study were already known. However, among these five polymorphisms, rs2270912 and rs28363130 showed a significant association with EDBEB. A significant association of rs6347 with EDBEB regarding the genotype frequency was found, although no significant association was found regarding
Haplotypea | Patientb | Healthy subjectb |
---|---|---|
C/T-A/G-Long/Short | 6.7% (n = 6) | 0.0% (n = 0) |
C/T-A/A-Long/Short | 1.1% (n = 1) | 0.0% (n = 0) |
C/C-A/G-Long/Short | 0.0% (n = 0) | 0.9% (n = 1) |
C/C-A/A-Long/Short | 13.3% (n = 12) | 7.9% (n = 9) |
C/C-A/G-Long/Long | 2.2% (n = 2) | 0.0% (n = 0) |
C/C-A/A-Long/Long | 76.7% (n = 69) | 91.2% (n = 104) |
Total | 100% (n = 90) | 100% (n = 114) |
aShown in the order of rs2270912, rs28363130, and 3'-UTR VNTR; bData presented as number of percentage and subjects.
allele frequency. Among the seven EDBEB samples with the rs2270912 T allele, six possessed the rs28363130 G allele and the short 3'-UTR VNTR allele.
The polymorphism rs2270912 (C → T) located in exon 10 is a silent mutation, which does not cause amino acid substitution. Silent mutations in the exon that are known as protein function, which is encoded by a gene containing a silent mutation, would not be affected because no amino acid substitution occurs. An increasing body of evidence revealed that silent mutations may have the ability to change in its encoded protein expression and structure [
Rs28363130 (A → G) is a SNP found in intron 13 and located 13 bases upstream from the 5' end of exon 13. Introns are regions of DNA that are removed during splicing after RNA transcription; therefore, rs28363130 itself does not influence the protein function encoded by the DAT1 gene. However, intronic SNP may be involved in splicing and regulating transcription. The presence of a transcriptional regulatory region specific to the G allele, which causes a risk of developing EDBEB, as well as the expression of miRNA, is predicted to be present in the region that contains rs28363130 by in silico analysis using RegRNA2.0 (http://regrna2.mbc.nctu.edu.tw/). This suggests that rs28363130 may affects the DAT1 gene expression. However, in future, these in silico analysis derived predictions are requires validation by direct testing.
According to the Human Transporter Database (HTD: http://htd.cbi.pku.edu.cn/index.php) and the 1000 Genomes Project [
On the basis of the haplotype analysis of rs2270912, rs28363130, and 3'-UTR VNTRs reported by Shinohara et al., where an association with patients with EDBEB was found, it was discovered that six of seven patients with EDBEB who had the rs2270912 T allele also possessed the rs28363130 G allele and the short 3'-UTR VNTR allele (haplotype: C/T-A/G-Long/Short; 6.7%: 6/90 patients). In our sample sets, this haplotype was not present in the healthy subject group. Unfortunately, MAFs of rs2270912 and rs28363130 were extremely low, being 0.00367 and 0.00230, respectively. Moreover, a homozygote of each rs2270912 T allele, rs28363130 G allele, and short 3'-UTR VNTR was not present in our sample sets. Therefore, statistical analysis was not performed, and haplotype frequencies alone are presented in
Regarding 3'-UTR VNTR, there is a report that DAT1 expression is decreased in the striatum in the subject group with short 3'-UTR VNTR-440, where nine tandem repeats were observed in the 3'-UTR VNTR [
The polymorphisms found in this study are SNPs that have not been identified by GWASs, which comprehensively searched for SNPs related to the diseases by a genome-wide search from thousands to tens of thousands of samples. Generally, GWASs use linkage disequilibrium directed toward known SNPs with MAFs of >1%. Therefore, unknown SNPs and SNPs with <1% MAF cannot be analyzed. Moreover, SNPs that show an association with diseases by GWAS are not necessarily associated with the diseases. Therefore, detailed analyses that focus on SNP regions that show an association with diseases are sometimes necessary. While SNPs that we identified are known SNPs, MAFs of these SNPs are <1%. Therefore, it appears that they cannot be detected by GWASs.
The prevalence of ED among young women has increased. However, molecular-supported subclassification and treatment methods for ED have not been completely established. While there is no question that abnormal eating behaviors and weight fluctuations are the main clinical conditions for patients with ED, changes in the diagnosis and the course of treatment are highly dependent on the presence or absence of binge eating behaviors. This study’s elucidation of the association between patients with EDBEB and DAT1, an important gene involved in the dopaminergic system that greatly affects the eating habits of patients with EDBEB, is considered to be very significant for elucidating the molecular disease state of ED and for clinical perspectives, including diagnosis and treatment.
In our study, only the Japanese sample sets were used. Furthermore, the sample size was small (n = 204). Therefore, the statistical power for detection was low. Moreover, optimum primer sets could not be constructed for analyzing the polymorphisms of exon 15; therefore, the entire exon of the coding region of the DAT1 gene could not be analyzed. Nonetheless, we were able to identify two polymorphisms that are believed to be associated with patients with EDBEB and indicate an association between these mutations and polymorphisms in 3'-UTR VNTR. To identify the DAT1 gene plays a key role in the dopaminergic system of EDBEB, it will be needed to conduct statistical haplotype analysis of rs2270912, rs28363130, and 3'-UTR VNTRs using a larger sample size and functional analysis of rs2270912, rs28363130, and 3'-UTR VNTRs by direct testing in future.
We received detailed guidance from Dr. Kunihiko Shioe and Dr. Nobutaka Motohashi (Department of Neuropsychiatry and Clinical Ethics, Integrated Graduate School of Medicine and Engineering, University of Yamanashi). We received cooperation from Dr. Shigenobu Kanba (Department of Neuropsychiatry, Graduate School of Medicine), Dr. Hiroko Mizuno (Hiroko Mizuno Mental Clinic), and Dr. Yutaka Ono (Center for the Development of Cognitive Behavior Therapy Training) in the collection of samples. We also received advice from Mie Nakazawa, a technician (Department of Neuropsychiatry and Clinical Ethics, Integrated Graduate School of Medicine and engineering, University of Yamanashi), regarding concentration measurement and PCR conditions.
None of the authors of this paper have any involvement, financial or otherwise, that might bias this work.
Hirata, T., Uemura, T., Shinohara, M. and Hirano, M. (2017) Association between Dopamine Transporter Gene (DAT1) Polymorphisms and Eating Disorders with Binge Eating Behavior. Open Journal of Psychiatry, 7, 329-343. https://doi.org/10.4236/ojpsych.2017.74028