The population dynamics of bacterial community was investigated in three Agricultural soils, designated as Loamy sand (A), Peaty coarse (B) and Loamy coarse sand (C) in North-East, Nigeria. The soil chemical properties were characterized to fully understand their nature. Metagenomic approach was used to extract soil DNA using the fast DNA Spin Kit extraction technique. The PCR-electrophoresed DNA bands were excised and subjected to a full scale Denaturing Gradient Gel Electrophoresis (DGGE) analysis. DGGE fingerprinting for the PCR-16S rDNA product revealed a diverse profile of complex population of bacterial community in the study area. The study shows that more bacterial community can be fully investigated using molecular techniques rather than traditional culture method. The implication of the results obtained is discussed.
Microorganisms are key players in important ecological processes such as soil structure formation, decomposition of organic matter and xenobiotic, recycling of essential elements (e.g. carbon, nitrogen, phosphorous and sulphur) [
The need to understand the microbial community that channel soil affair is quite imperative. These will pave way in knowing their activities and mechanistic role to the sustenance of ecosystem (e.g. energy flow, biogeochemical cycling, and ecological resilience). The target organisms, example bacteria are often incompletely assessed during traditional culture techniques, such as pour plate or even soil dilution methods. Advances in genomic and sequencing technologies have paved way for proper understanding of the complex nature of soil environment. This study intends to use the science of metagenomics to bring fore the nature of the bacterial community in three agricultural soils in Bauchi State North-Eastern Nigeria. It will involve the use of Polymerase Chain Reaction- Denaturing Gradient Gel Electrophoresis (PCR-DGGE) fingerprinting as a whole community analysis method. Other molecular approaches such as metaproteomics, metatranscriptome, and proteogenomics are vital for discovering and characterizing the vast microbial diversity and understanding their interactions with abiotic and biotic environmental factors [
The PCR-DGGE has the advantage of not requiring previous knowledge on microbial population. It has rapid and efficient separation technique of same length DNA sequence (amplified by PCR), which may vary a little as a single pair modification [
Soil samples were collected from three agricultural lands in Bauchi state, North- east, Nigeria. Agricultural activities are actively carried out on the loamy sand (A), and peaty coarse sand (B), while loamy coarse sand (C) was used for organic farming only.
Surface soils were sampled by removing the top 10 cm of soil surface with hand trowel. Approximately 100 g each were collected in replicates from each agricultural land [
Techniques used for the investigation of soil samples include, Soil pH determination using 1:1 (soil to water method, soil temperature determination using mercury-in-glass thermometer. Other analysis carried out involves determination of organic carbon, total nitrogen, soil particle size and available phosphorous, using Wakley and Black method [
DNA was isolated from soil samples using the fast DNA spin kit for soil fast prep® instrument. Five hundred milligram (500 mg) of soil sample was placed into a lysin matrix E tube. Also, 978 µl of Sodium phosphate buffer was added to the tube. This was followed by the addition of 122 µl MT buffer. The set-up was homogenized in the fast prep instrument at a speed of 6.0 for 4.0 seconds. The preparation was further centrifuged at 14,000 rpm for several minutes. The supernatant was transferred to a 2 ml eppendorf tube and 250 µl protein precipitation solution (PPS) was added, inverted by hand 10 times. The set-up was centrifuged at 14,000 rpm for 5 minutes and supernatant transferred to another 2 ml eppendorf tube. 1 ml of binding matrix suspension was added to the tube. The preparation was placed on a rotator for 2 minutes and allowed to stand for further 3 minutes. 500 µl of supernatant was carefully removed avoiding the binding matrix. An approximate volume of 600 µl of the matrix was transferred to a spinTM filter and centrifuged at 14,000 rpm for 1 minute. The catch-tube was replaced twice and 500 µl prepared SEWS-M was used to resuspend the pellets. The set-up was centrifuged at 14,000 rpm for 3 minutes and catch tube was replaced, by a clean one. The SPINTM filter was air dried at room temperature. 50 µl of DNase/pyrogen-free water placed above the SPINTM filter to resuspend binding matrix pellet. The set-up was centrifuged at 14,000 rpm for 1 minute to elute DNA into the clean catch tube. SPINTM filter was discarded and DNA was kept at −20˚C in tube for further application.
PCR amplification of 16S r RNA genes was carried out using the forward primer/63F and reverse primer/1387R. The amplification reaction was performed with ESCO-MAXI swift thermocycler PCR machine. PCR reaction on DNA samples were carried out using a standard set-up of 18.1 µl of distilled water, 2.5 µl of buffer, 1 µl of forward and reverse primers, 0.4 µl Tag polymerase and 1 µl of DNA template per reaction. Each reaction setting was mixed in a 0.2 ml PCR tube. The preparation was loaded on the PCR machine and lid fastened. The program used was 1 cycle of 95˚C for 5 minutes; 32 cycles of 95˚C for 45 seconds; 55˚C for 45 seconds; 72˚C for 2 minutes, followed by a final extension of 72˚C for 10 minutes. Amplification product were visualized after separation by electrophoresis in a 1% agarose gel and stained with 0.5% ethidium bromide. Results were visualized using UV-transilluminator versadoc imager.
Confirmed 16S r RNA PCR products from soil DNA were subjected to GC clamp-PCR analysis with group specific oligonucleotide probes. The nucleotide sequences of the primers are as follows:
p2-5’ATTACCGCGGCTGCTGG-3’ and p35’CGCCCGCGCGCGCGGCGGGGCGGGGCGGGGGCACGGGGGCCTACGGGAGGCAGCAG-3’.
A combination of p2 and p3 primers was used to amplify the 16S rDNA regions. PCR amplification was performed with a DNA machine DYAD thermocycler using 1 µl of PCR lysate, 1 µl of each p2 and p3, 1 µl of DNTPs, 2.5 µl buffer, 1.8 µl of sterile water and 0.4 µl of taq polymerase. Each reaction was placed in 0.2 ml PCR tube. The program used was 95˚C for 5 minutes, 95˚C for 1 minute, and 65˚C for 1 minute for 20 cycles, decreased by 0.5˚C in every cycle, and incubated at 72˚C for 3 minutes. This was followed by incubation for 95˚C for 1 minute, 55˚C for 1 minute and 72˚C for 1 minute for 5 cycles. Final incubation was carried out at 72˚C for 3 minutes. Confirmed PCR-GC clamp products were loaded onto DGGE Bio-Rad gel electrophoresis system, with an already loaded casket of acryl amide based gel. The DCODE buffer chamber was filled to the required level with Tris acetate electrophoresis buffer. The buffer in the DCODE apparatus was pre-heated to 60˚C. When the temperature was about 50˚C, heating was interrupted and the gel plates were attached to the core assembly. The gel comb was removed and wells rinsed with water inside the DCODE system. About 15 µl of PCR product with 3 µl 6× loading dye were carefully loaded. The lid was placed back on the electrophoresis tank and system switched. The run was performed at 17 hours at 90 volts. Gel was disassembled from casket by carefully removing one glass plate. The gel was placed in a tray with cyber-gold staining solution, incubated for 30 minutes and analyzed using UV-transilluminator VERSADOC imager.
The bacterial community survey of soil samples investigated is loamy sand (A), peaty coarse sand (B) and loamy coarse sand (C). The characterization of the properties of the soils studied is summarized in
The direct DNA isolation from soils studied showed high percentage of bacterial community in the soil samples studied. The DNA concentrations were
Sampling sites | |||
---|---|---|---|
Soil types | Loamy sand (A) | Peaty coarse (B) | Loamy Coarse (C) |
Temperature (˚C) | 28 | 27 | 30 |
pH | 6.2 | 7.1 | 5.2 |
Organic carbon (%) | 0.90 | 1.44 | 1.25 |
Total nitrogen (%) | 0.09 | 0.24 | 0.10 |
Available phosphorus (mg/kg) | 8.09 | 8.01 | 9.08 |
Initial soil moisture (%) | 18 | 24 | 16 |
Exchangeable cations (Cmol/mg) | |||
K | 0.01 | 0.03 | 0.02 |
Ca | 0.80 | 0.78 | 0.95 |
Mg | 0.02 | 0.04 | 0.06 |
Na | 0.01 | 0.10 | 0.01 |
Particle size (%) | |||
Sand | 85 | 87 | 61.5 |
Silt | 7 | 7 | 10.5 |
Clay | 8 | 6 | 28.0 |
Values were taken from composite soil sample and average of three replications.
over and above the average 3000 kb on the molecular ladder used during electrophoresis. The three soil samples provided high quality DNA probe, as confirmed and quantified by gel electrophoresis (
Likewise, to further determine complex nature of microbial community, the Denaturing Gradient Gel Electrophoresis (DGGE) fingerprinting of the three soils was carried out. The PCR-DGGE analysis provided a well-defined comparison for the microbial composition of the various soil samples (
of particular part of the original profile. In the analysis conducted, two approaches were jointly carried out on PCR products used in GC-clamp set-up. Brighter bands, with fully differentiated separation were observed in purified 16s r RNA products, though this is usually done for convenience sake.
Specific hybridization and characterization of the band were not carried out to ascertain microbial types within mixed population studied.
Umar, A.F., Tahir, F. and Agbo, E.B. (2017) Polymerase Chain Reaction-Denaturing Gradient Gel Electro- phoresis (PCR-DGGE) Profile of Bacterial Community from Agricultural Soils in Bau- chi, North-East Nigeria. Advances in Microbiology, 7, 480-486. https://doi.org/10.4236/aim.2017.76037