With the aim of identifying novel thermostable esterases, comprehensive sequence databases and cloned fosmid libraries of metagenomes derived from an offshore oil reservoir on the Norwegian Continental Shelf were screened for enzyme candidates using both sequence-and function-based screening. From several candidates identified in both approaches, one enzyme discovered by the functional approach was verified as a novel esterase and subjected to a deeper characterization. The enzyme was successfully over-produced in Escherichia coli and was shown to be thermostable up to 90°C, with the highest esterase activity on short-chain ester substrates and with tolerance to solvents and metal ions. The fact that the thermostable enzyme was solely found by functional screening of the oil reservoir metagenomes illustrates the importance of this approach as a complement to purely sequence-based screening, in which the enzyme candidate was not detected. In addition, this example indicates the large potential of deep-sub-surface oil reservoir metagenomes as a source of novel, thermostable enzymes of potential relevance for industrial applications.
The globe provides a large spectrum of environments with very diverse physical and chemical conditions for life to exist [
Esterases are enzymes with several applications in industrial processes, and novel variants of these providing special properties are still in demand [
Oil reservoir samples were collected and processed as described earlier [
Twenty Pfam [
Approximately 11,520 fosmid clones carrying metagenomic DNA sequences originating from oil reservoir Well II (water phase sample) [
High throughput screening for short-chain esterase activity was performed in 384 well plates by addition of 5 µl crude cell extract to each well containing 40 µl reaction mixture (0.17 mM 4-nitrophenyl acetate substrate (Sigma-Aldrich, no. N8130) in 0.1 M phosphate buffer, pH 8, containing 4.4% EtOH), shaking of the plates (1600 rpm, 30 s) and absorption measurement at 410 nm immediately and after 100 min incubation at 37˚C. For screening for long-chain esterase activity, the same procedure was applied, with the exception of the reaction mixture containing 0.17 mM 4-nitrophenyl palmitate (Sigma-Aldrich, no. N2752), 4.4% EtOH and 1% Triton X-100 in 0.1 M phosphate buffer, pH 8, and performing absorption measurements at time points 0, 1 and 3 hours after 50˚C incubation.
Esterase positive clones identified in functional screening were subjected to fosmid isolation using the Promega Wizard Miniprep kit (arabinose induced cultures), and the genes of interest were identified by sequencing of respective fosmid clones and sub-cloning of candidate genes. Gene sequences were analyzed using BLASTx against the NCBI database. Amino acid sequences were analyzed on the Phylogeny.fr web server [
The esterase candidate genes were amplified using PCR from the relevant fosmid (primer sequences GGGGCC- ATGGGAGATAAGGAGGAGGG and GGGGATCCAAAGATAGAGGAGCAGATC for His-tagged enzyme, and sequences ATAAGGAGGAGGGCATATGGCTGA and GGGGATCCAAAGATAGAGGAGCAGATC for non-tagged enzyme), or synthesized as E. coli codon optimized versions (GenScript, Piscataway, NJ, USA) and sub-cloned in expression vector pET16b (with and without hexahistidyl-tag; however, only untagged protein was analyzed as enzyme isolation by heat incubation proved to be feasible). Enzymes were produced in E. coli BL21 (DE3) REPL (codon+) grown in shake flasks in 50 ml LB containing 100 µg/ml ampicillin. Gene expression was induced at OD600 = 1.0 using IPTG (0.5 mM final conc.). After continued incubation at 37˚C until observed OD600 decrease after approx. 7 h, the cultures were harvested by centrifugation (4000 rpm, 15 minutes, 4 ˚C) and cell pellets stored at −20˚C until extraction. Crude cell extracts were prepared by sonication in 2 ml 0.1 M Tris-HCl buffer, pH 8, per 1 g wet weight biomass (flat tip, duty cycle 50%, output control 4; 7 × 1 min). Cell debris was pelleted by centrifugation (20 000 x g, 20 min, 4˚C) and supernatant stored at −20˚C.
Batch cultivation for the production of esterase FS02 was performed in two 3 l Applicon fermentor vessels using 1.8 l 3xLB medium (Tryptone 30 g/l, Yeast extract 15 g/l, NaCl 10 g/l) each, containing 100 µg/ml ampicillin, with constant airation at 0.25 VVM (0.45 l/min) and 1000 rpm fixed stirrer speed. The cultivation medium was inoculated with 1.5% (27 ml) overnight culture (LB, 100 µg/ml ampicillin). Gene expression was induced at OD600 = 4 using (3 hours cultivation) 0.5 mM IPTG. Cultures were thereafter harvested after 6 hours of induction and thereafter treated as described above to obtain crude cell extracts. Crude cell extracts were heat treated at 65˚C for 30 minutes, centrifuged at top speed (13 000 x g) in a table top centrifuge for 5 minutes to precipitate denatured host proteins, aliquoted and stored at −20˚C.
Verification of lipase activity. Crude cell extracts were used to assess lipase enzyme function using the same assay procedure as applied for esterase screening in multi-well plates, however, up-scaled to 1 ml volume for cuvette measurements. To 880 µl master mix (4.4% EtOH and 1% Triton X-100 in 0.1 M phosphate buffer, pH 8), 20 µl substrate solution (20 mM 4-nitrophenyl palmitate in acetonitrile) was added, incubated at 37˚C for 30 s prior to addition of 100 µl cell extract and absorbance measurement at 420 nm every 2 seconds for 4 minutes. End point measurements were performed using the same setup but with measurements after 30, 60 and 120 minutes, with assay and incubations done at 37˚C.
Heat stability. Temperature stability of enzymes was determined by incubating crude extracts at elevated temperatures (65˚C - 100˚C) for different time periods (15 min - overnight), followed by SDS-PAGE and/or activity assay as described above. Thermal unfolding transition midpoint Tm of the enzyme of interest was analyzed using the Thermal Shift assay from Applied Biosystems on a 7500 rtPCR machine according to the manufacturer’s instructions.
pH optimum. The pH optimum of the enzyme of interest was analyzed by performing the esterase activity assay at 37˚C as described above but using buffer with different pH (0.1 M glycine buffer pH 2 - 3 and pH 9 - 12; 0.05 M citrate buffer pH 5, 0.1 M phosphate buffer pH 6 - 8).
Substrate spectrum. Enzyme activity on a spectrum of commercial ester substrates of different chain lengths (C2-C18; p-nitrophenyl acetate, p-nitrophenyl-butyrate, p-nitrophenyl-decanoate, p-nitrophenyl-myristate, p-nit- rophenyl-palmitate and p-nitrophenyl-stearate) was analyzed using the assay procedure describe above.
Effect of selected additives on enzyme activity. Esterase activity in the presence of different additives was assayed as described above using p-nitrophenyl-butyrate as the substrate. Chemicals added were; metal ions (1 mM final concentrations from CaCl2∙2H2O, CoSO4∙7H2O, CuCl2∙2H2O, FeCl3, MgCl2∙6H2O, MnCl2∙4H2O, RbCl, ZnCl2, KCl, NaCl and Li-acetate*2H2O salt solutions, respectively), isopropanol, ethanol, methanol, acetone, acetonitrile, DMF and DMSO (1%, 10% and 30% each), Triton X-100, Tween 80 and SDS 5 (1% and 5% each) as well as DTT and EDTA (1, 5 and 10 mM each).
The established metagenomic sequence databases [
Functional screening for long-and short-chain esterases encoded in the 11,520 arrayed fosmid clones resulted in 13 positive hits from the initial screen. For identification of the genes of interest within the respective fosmids, fosmid DNA was isolated and subjected to a combination of end-sequencing and primer walking, supplemented by 454 pyrosequencing of pooled fosmid clones. For the end-sequencing and primer walking approach, technical difficulties appeared, and sequencing results could not be correlated with fosmid size determinations by gel electrophoresis (data not shown). After thorough evaluation of the fosmid library construction procedure, it was concluded that the encountered problems likely were associated with the amplification of the metagenomic DNA. Due to the low amount of DNA that could be isolated from the oil reservoir samples, target DNA was amplified using WGA based on Multiple Strand Displacement Amplification (MDA) [
The nucleotide sequence of the FS02 gene was used in BLASTx searches against the NCBI protein database, resulting in hits against hypothetical proteins or hydrolases of the alpha/beta superfamily (
Due to the apparently low production levels of FS02 enzyme in E. coli, the FS02 gene was synthesized in an E. coli codon usage optimized version (GenScript), cloned in the T7 expression vector pET16b and expressed in E. coli. Enzyme production based on the new gene version was found to be significantly higher compared to the
native gene sequence (data not shown). FS02 thermostability (
Batch-produced FS02 was successfully tested for heat stability by incubation at 65˚C for 30 minutes, thus leading to an FS02 enriched crude extract for subsequent studies. The enzyme’s temperature stability was analyzed in detail by incubation at different temperatures for various periods of time, demonstrating that FS02 is thermostable up to 90˚C for at least 1 hour without any notable decrease in activity, whereas a 100˚C incubation resulted in rapid inactivation of the enzyme (
In attempts to analyze the pH optimum of FS02, it was found that enzyme activity was high at pH 11, however, assay background was high as well at this pH (data not shown), and therefore pH 9 was chosen as standard pH in all subsequent additional enzyme characterizations. The substrate spectrum analysis of FS02 revealed a higher enzymatic activity on short-chain substrates compared to long-chain esters (
Despite relatively high standard deviations in replicate measurements (
similar to the observed activity increase of FS02 in the current work, enzymatic activity of an alkaline lipase was shown to be increased in the presence of e.g. methanol [
Esterases are used in several industrial processes [
One lipase/esterase candidate from functional screening, denoted FS02, was found to be active, highly thermostable, as well as showed high activity in the presence of various compounds, generating noteworthy results (
The discovery of an active and thermostable esterase in a metagenomic library originating from a deep sub- surface oil reservoir illustrates the powerful approach of functional metagenomics in search for novel enzymes with desired properties from poly-extreme environments. It also demonstrates the potential for biodiscovery from such environments as deep subsurface oil reservoirs. The finding of the described thermostable esterase represents only the top of the ice berg of what potentially can be found by harvesting and screening metagenomes from this special ecological niche.
This work is supported by the Research Council of Norway (grant numbers 187317/S30, and 208541/O10), Statoil ASA and SINTEF.
Anna Lewin,Trine Aakvik Strand,Tone Haugen,Geir Klinkenberg,Hans Kristian Kotlar,Svein Valla,Finn Drabløs,Alexander Wentzel, (2016) Discovery and Characterization of a Thermostable Esterase from an Oil Reservoir Metagenome. Advances in Enzyme Research,04,68-86. doi: 10.4236/aer.2016.42008
Search/candidate | Candidate contig/read ID | Pfam ID/Annotation | Identity (%) | Coverage (%) | e-value |
---|---|---|---|---|---|
Pfam1 | contig10634_532_4 | pfam00561-Abhydrolase_1 | 23.45 | 62.67 | 5.00E−12 |
Pfam2 | contig03006_2979_63 | pfam12695-Abhydrolase_5 | 19.62 | 100 | 4.00E−18 |
Pfam3 | contig03006_2979_63 | pfam12695-Abhydrolase_5 | 25.51 | 57.24 | 4.00E−11 |
Pfam4 | contig06306_3078_37 | pfam12697-Abhydrolase_6 | 24.39 | 69.64 | 1.00E−05 |
Pfam5 | contig03391_8603_101 | pfam13472-Lipase_GDSL_2 | 30.64 | 97.69 | 3.00E−30 |
Pfam6 | contig04922_8688_114 | pfam12695-Abhydrolase_5 | 27.37 | 59.31 | 5.00E−08 |
Pfam7 | contig05190_528_3 | pfam12695-Abhydrolase_5 | 28.75 | 52.41 | 3.00E−14 |
Pfam8 | contig07066_7149_180 | pfam12697-Abhydrolase_6 | 33.06 | 54.02 | 1.00E−20 |
Pfam9 | contig04904_2432_80 | pfam13472-Lipase_GDSL_2 | 16.98 | 52.60 | 8.00E−09 |
Pfam10 | FYXZCPA02FPU0B_473_1 | pfam07859-Abhydrolase_3 | 21.56 | 74.88 | 3.00E−07 |
Pfam11 | contig06801_3003_27 | pfam13472-Lipase_GDSL_2 | 32.95 | 100 | 3.00E−28 |
Pfam12 | contig03009_1909_60 | pfam06821-Ser_hydrolase | 37.50 | 97.08 | 1.00E−46 |
Pfam13 | contig08344_800_5 | pfam12697-Abhydrolase_6 | 18.59 | 78.13 | 2.00E−06 |
Pfam14 | contig03736_4913_82 | pfam12695-Abhydrolase_5 | 23.40 | 63.4483 | 1.00E−05 |
Pfam15 | contig06405_970_8 | pfam12697-Abhydrolase_6 | 30.00 | 99.1071 | 1.00E−50 |
Pfam16 | FYXZCPA02G140B_424_1 | pfam12695-Abhydrolase_5 | 33.33 | 62.7586 | 6.00E−18 |
Pfam16 | contig01573_4582_113 | pfam12695-Abhydrolase_5 | 25.29 | 100 | 1.00E−12 |
Pfam17 | contig05511_3393_28 | pfam12697-Abhydrolase_6 | 19.26 | 96.4286 | 1.00E−13 |
Pfam18 | FYXZCPA02IP2FT_387_1 | pfam12697-Abhydrolase_6 | 22.83 | 55.3571 | 6.00E−10 |
Pfam19 | contig02150_5033_123 | pfam12697-Abhydrolase_6 | 19.40 | 88.8393 | 7.00E−07 |
Pfam2 | contig03063_7553_90 | pfam12697-Abhydrolase_6 | 19.83 | 96.875 | 2.00E−19 |
Pfam21 | contig08668_499_3 | pfam12697-Abhydrolase_6 | 36.09 | 56.6964 | 2.00E−17 |
Pfam22 | FYXZCPA01BCVY3_478_1 | pfam12695-Abhydrolase_5 | 30.59 | 53.7931 | 4.00E−12 |
Pfam23 | contig01280_2950_36 | pfam12697-Abhydrolase_6 | 21.30 | 95.9821 | 9.00E−23 |
Pfam24 | contig07165_797_5 | pfam12695-Abhydrolase_5 | 16.50 | 100 | 1.00E−10 |
Pfam25 | contig00489_2553_26 | pfam00561-Abhydrolase_1 | 22.34 | 97.3333 | 1.00E−20 |
Pfam26 | contig06642_507_3 | pfam12697-Abhydrolase_6 | 24.18 | 61.6071 | 4.00E−16 |
Pfam27 | contig07477_1639_15 | pfam00561-Abhydrolase_1 | 18.12 | 62.2222 | 4.00E−12 |
Pfam28 | contig02638_1148_7 | pfam12695-Abhydrolase_5 | 27.91 | 50.3448 | 3.00E−08 |
Pfam29 | contig09772_490_3 | pfam12695-Abhydrolase_5 | 20.75 | 79.3103 | 4.00E−13 |
Pfam30 | contig01826_5617_105 | pfam12697-Abhydrolase_6 | 19.40 | 95.5357 | 1.00E−08 |
Pfam31 | contig11358_484_4 | pfam12697-Abhydrolase_6 | 35.40 | 50.4464 | 6.00E−33 |
Pfam32 | contig02573_1545_14 | pfam12697-Abhydrolase_6 | 21.43 | 66.5179 | 2.00E−08 |
Pfam33 | FYXZCPA02INS3R_479_1 | pfam13472-Lipase_GDSL_2 | 22.66 | 69.9422 | 4.00E−09 |
Pfam34 | FYXZCPA02I0GHD_502_1 | pfam12697-Abhydrolase_6 | 20.83 | 50.8929 | 5.00E−13 |
Pfam35 | FYXZCPA01DINQ9_368_1 | pfam12695-Abhydrolase_5 | 27.27 | 56.5517 | 4.00E−09 |
Pfam36 | FYXZCPA01CXWGZ_504_1 | pfam13472-Lipase_GDSL_2 | 21.35 | 50.8671 | 1.00E−12 |
Pfam37 | contig02497_4406_116 | pfam00561-Abhydrolase_1 | 18.70 | 89.7778 | 2.00E−10 |
Pfam38 | contig05216_3751_38 | pfam12697-Abhydrolase_6 | 25.58 | 92.8571 | 3.00E−22 |
Pfam39 | contig02933_3670_42 | pfam12697-Abhydrolase_6 | 19.70 | 80.3571 | 6.00E−13 |
Pfam40 | contig01893_2307_67 | pfam13472-Lipase_GDSL_2 | 36.72 | 98.2659 | 4.00E−28 |
Pfam41 | contig10277_498_3 | pfam12697-Abhydrolase_6 | 22.01 | 66.0714 | 1.00E−20 |
Pfam42 | FYXZCPA02IIP42_477_1 | pfam12697-Abhydrolase_6 | 36.59 | 54.4643 | 1.00E−29 |
Pfam43 | contig00476_8726_271 | pfam12697-Abhydrolase_6 | 24.03 | 98.6607 | 5.00E−36 |
---|---|---|---|---|---|
Pfam44 | FYXZCPA01E5UXP_460_1 | pfam12695-Abhydrolase_5 | 31.00 | 63.4483 | 3.00E−15 |
Pfam45 | contig04216_513_5 | pfam12695-Abhydrolase_5 | 30.00 | 64.1379 | 8.00E−20 |
Pfam46 | contig02413_18858_411 | pfam12695-Abhydrolase_5 | 25.70 | 100 | 2.00E−22 |
Pfam47 | contig00197_534_3 | pfam12695-Abhydrolase_5 | 29.00 | 64.1379 | 2.00E−19 |
Pfam48 | FYXZCPA02GZ6XY_538_1 | pfam12695-Abhydrolase_5 | 21.29 | 77.2414 | 3.00E−09 |
Pfam49 | FYXZCPA02GN27Q_460_1 | pfam12695-Abhydrolase_5 | 20.83 | 52.4138 | 1.00E−06 |
Pfam50 | FYXZCPA01DX4R7_474_1 | pfam12697-Abhydrolase_6 | 27.27 | 54.0179 | 3.00E−20 |
Pfam51 | contig00250_28097_740 | pfam12695-Abhydrolase_5 | 27.03 | 74.4828 | 1.00E−15 |
Pfam52 | FYXZCPA01A44W5_490_1 | pfam12695-Abhydrolase_5 | 24.49 | 81.3793 | 8.00E−10 |
Pfam53 | contig04095_6514_173 | pfam12697-Abhydrolase_6 | 18.71 | 67.4107 | 2.00E−06 |
Pfam54 | contig00394_1735_8 | pfam12695-Abhydrolase_5 | 20.60 | 100 | 3.00E−15 |
Pfam55 | contig07114_639_5 | pfam12695-Abhydrolase_5 | 24.77 | 65.5172 | 1.00E−17 |
Pfam56 | contig04783_1443_31 | pfam12697-Abhydrolase_6 | 24.00 | 51.3393 | 1.00E−11 |
Pfam57 | contig00882_9723_289 | pfam12697-Abhydrolase_6 | 22.07 | 93.3036 | 2.00E−16 |
Pfam58 | contig01290_10856_428 | pfam00561-Abhydrolase_1 | 16.30 | 97.3333 | 1.00E−11 |
Pfam59 | FYXZCPA02HSGF6_484_1 | pfam12697-Abhydrolase_6 | 33.06 | 53.5714 | 6.00E−20 |
Pfam60 | FYXZCPA02JVPXC_526_1 | pfam00561-Abhydrolase_1 | 16.55 | 62.6667 | 4.00E−07 |
Pfam61 | contig01615_9318_182 | pfam13472-Lipase_GDSL_2 | 34.66 | 100 | 3.00E−28 |
Pfam62 | FYXZCPA02H13EN_510_1 | pfam12695-Abhydrolase_5 | 30.00 | 60.6897 | 6.00E−15 |
Pfam63 | contig08515_1275_11 | pfam12697-Abhydrolase_6 | 20.32 | 80.8036 | 2.00E−18 |
Pfam64 | contig06241_7320_88 | pfam12697-Abhydrolase_6 | 25.31 | 91.9643 | 5.00E−26 |
Pfam65 | contig01479_20270_446 | pfam12697-Abhydrolase_6 | 30.33 | 100 | 1.00E−33 |
Pfam66 | contig05933_1877_36 | pfam00756-Esterase | 32.33 | 100 | 1.00E−58 |
Pfam67 | contig06201_5298_75 | pfam12695-Abhydrolase_5 | 24.00 | 64.1379 | 3.00E−10 |
Pfam68 | FYXZCPA01DJ12Y_449_1 | pfam12695-Abhydrolase_5 | 25.47 | 64.1379 | 4.00E−17 |
Pfam69 | contig01611_15601_375 | pfam12695-Abhydrolase_5 | 26.03 | 97.2414 | 2.00E−12 |
Pfam70 | contig00834_8473_222 | pfam00561-Abhydrolase_1 | 22.32 | 94.2222 | 9.00E−16 |
Pfam71 | contig01303_2032_11 | pfam12695-Abhydrolase_5 | 25.77 | 52.4138 | 2.00E−07 |
Pfam72 | GJ054VR02ISR5J_494_1 | pfam13472-Lipase_GDSL_2 | 15.79 | 57.2254 | 7.00E−08 |
Pfam73 | GJ054VR02HA4RF_492_1 | pfam12697-Abhydrolase_6 | 20.96 | 65.625 | 5.00E−13 |
Pfam74 | contig10048_381_3 | pfam12697-Abhydrolase_6 | 16.41 | 51.3393 | 5.00E−06 |
Pfam75 | contig07636_309_2 | pfam12695-Abhydrolase_5 | 25.00 | 54.4828 | 1.00E−06 |
Pfam76 | GJ054VR01C67B5_457_1 | pfam13472-Lipase_GDSL_2 | 26.47 | 64.1618 | 1.00E−15 |
Pfam77 | contig02952_2692_17 | pfam12697-Abhydrolase_6 | 24.64 | 85.2679 | 9.00E−27 |
Pfam78 | contig00620_19347_416 | pfam12697-Abhydrolase_6 | 26.22 | 97.3214 | 6.00E−29 |
Pfam79 | contig00889_16596_343 | pfam12697-Abhydrolase_6 | 25.77 | 100 | 4.00E−27 |
Pfam80 | contig03816_967_7 | pfam12695-Abhydrolase_5 | 24.48 | 84.1379 | 5.00E−09 |
Pfam81 | contig08847_841_6 | pfam12695-Abhydrolase_5 | 24.83 | 97.2414 | 2.00E−10 |
Pfam82 | contig05729_1202_11 | pfam02230-Abhydrolase_2 | 27.10 | 93.4272 | 1.00E−28 |
Pfam83 | contig10760_22051_6260 | pfam12697-Abhydrolase_6 | 27.39 | 97.7679 | 1.00E−29 |
Pfam84 | GJ054VR02FQQYK_497_1 | pfam12695-Abhydrolase_5 | 21.56 | 99.3103 | 1.00E−14 |
Pfam85 | contig00012_70893_20885 | pfam12695-Abhydrolase_5 | 16.50 | 100 | 2.00E−07 |
Pfam86 | contig02372_1061_6 | pfam12697-Abhydrolase_6 | 26.88 | 66.0714 | 1.00E−05 |
Pfam87 | contig00035_25497_6840 | pfam12695-Abhydrolase_5 | 20.50 | 99.3103 | 1.00E−08 |
Pfam88 | GJ054VR02IK5IL_506_1 | pfam12695-Abhydrolase_5 | 31.68 | 66.2069 | 1.00E−19 |
Pfam89 | contig03737_2033_16 | pfam12695-Abhydrolase_5 | 27.97 | 66.2069 | 5.00E−11 |
Pfam90 | contig01505_1164_6 | pfam12697-Abhydrolase_6 | 23.33 | 87.9464 | 7.00E−19 |
Pfam91 | contig00049_11245_240 | pfam12697-Abhydrolase_6 | 21.43 | 66.5179 | 3.00E−07 |
---|---|---|---|---|---|
Pfam92 | GJ054VR01EWNW0_530_1 | pfam12695-Abhydrolase_5 | 27.93 | 60.6897 | 2.00E−08 |
Pfam93 | GJ054VR01BPBL5_460_1 | pfam12697-Abhydrolase_6 | 29.51 | 50.4464 | 1.00E−24 |
Pfam94 | contig00454_19280_412 | pfam12697-Abhydrolase_6 | 30.17 | 100 | 1.00E−42 |
Pfam95 | contig00119_19232_365 | pfam12697-Abhydrolase_6 | 19.26 | 96.4286 | 1.00E−12 |
Pfam96 | contig00119_19232_365 | pfam12695-Abhydrolase_5 | 24.00 | 64.1379 | 1.00E−08 |
Pfam97 | GJ054VR01CNOSD_447_1 | pfam12695-Abhydrolase_5 | 25.25 | 57.931 | 4.00E−14 |
Pfam98 | contig00960_13684_281 | pfam12697-Abhydrolase_6 | 27.43 | 100 | 3.00E−39 |
Pfam99 | contig07622_1530_12 | pfam12697-Abhydrolase_6 | 25.00 | 82.5893 | 6.00E−23 |
Pfam100 | GJ054VR02H7I8R_531_1 | pfam00561-Abhydrolase_1 | 24.85 | 74.6667 | 2.00E−17 |
Pfam101 | GJ054VR02G60MH_452_1 | pfam12697-Abhydrolase_6 | 23.08 | 58.0357 | 5.00E−17 |
Pfam102 | GJ054VR02JWL8C_458_1 | pfam02230-Abhydrolase_2 | 20.98 | 58.216 | 8.00E−08 |
Pfam103 | contig07870_496_3 | pfam12697-Abhydrolase_6 | 15.20 | 72.3214 | 2.00E−06 |
Pfam104 | contig10986_45864_11909 | pfam12697-Abhydrolase_6 | 31.22 | 95.5357 | 2.00E−27 |
Pfam105 | GJ054VR01BULKR_485_1 | pfam13472-Lipase_GDSL_2 | 28.87 | 82.0809 | 2.00E−27 |
Pfam106 | contig01919_852_7 | pfam13472-Lipase_GDSL_2 | 30.99 | 94.7977 | 5.00E−25 |
Pfam107 | contig03267_4254_30 | pfam12695-Abhydrolase_5 | 25.00 | 80 | 2.00E−09 |
Pfam108 | contig00064_9159_317 | pfam00756-Esterase | 32.33 | 100 | 4.00E−54 |
Pfam109 | contig08275_501_3 | pfam12695-Abhydrolase_5 | 22.12 | 60.6897 | 3.00E−06 |
Pfam111 | GJ054VR01C7J7L_531_1 | pfam13472-Lipase_GDSL_2 | 32.41 | 57.8035 | 3.00E−17 |
Pfam112 | contig03549_307_2 | pfam12695-Abhydrolase_5 | 23.91 | 57.931 | 3.00E−16 |
Pfam113 | GJ054VR01DFKXI_458_1 | pfam12697-Abhydrolase_6 | 29.55 | 58.4821 | 3.00E−25 |
Pfam114 | GJ054VR02HLP9Q_442_1 | pfam12697-Abhydrolase_6 | 19.05 | 60.7143 | 4.00E−10 |
Pfam115 | contig00103_70784_19920 | pfam12697-Abhydrolase_6 | 24.02 | 96.875 | 3.00E−19 |
Pfam116 | contig01310_928_5 | pfam12695-Abhydrolase_5 | 30.28 | 70.3448 | 5.00E−23 |
Pfam117 | GJ054VR01B2IB1_498_1 | pfam12697-Abhydrolase_6 | 17.05 | 57.1429 | 4.00E−11 |
Pfam118 | contig00490_53254_1018 | pfam12697-Abhydrolase_6 | 26.75 | 98.2143 | 6.00E−23 |
Pfam119 | GJ054VR01D1B3V_512_1 | pfam12695-Abhydrolase_5 | 27.36 | 63.4483 | 7.00E−10 |
Pfam120 | GJ054VR01C6IR9_411_1 | pfam12695-Abhydrolase_5 | 19.05 | 68.9655 | 2.00E−16 |
Pfam121 | contig00981_111696_2437 | pfam00561-Abhydrolase_1 | 22.34 | 97.3333 | 2.00E−18 |
Pfam122 | contig00363_90062_1905 | pfam12697-Abhydrolase_6 | 19.70 | 80.3571 | 2.00E−11 |
Pfam123 | contig07913_1207_7 | pfam12697-Abhydrolase_6 | 18.80 | 99.5536 | 4.00E−07 |
Pfam124 | contig08413_774_5 | pfam12697-Abhydrolase_6 | 23.91 | 97.3214 | 2.00E−40 |
Pfam125 | contig00941_2929_50 | pfam12695-Abhydrolase_5 | 28.24 | 56.5517 | 7.00E−10 |
Pfam126 | contig00109_61254_1373 | pfam13472-Lipase_GDSL_2 | 22.99 | 100 | 1.00E−24 |
Pfam127 | contig00271_130367_2942 | pfam12695-Abhydrolase_5 | 27.37 | 59.3103 | 8.00E−07 |
E.C. no. 1 | contig01459_13828_351 | triacylglycerol lipase | 76.75 | 77.82 | 1.00E−90 |
E.C. no. 2 | FYXZCPA01D1H7X_445_1 | protein-glutamate methylesterase | 53.15 | 88.80 | 5.00E−29 |
E.C. no. 3 | FYXZCPA01EWMQU_502_1 | protein-glutamate methylesterase | 52.63 | 55.07 | 9.00E−06 |
E.C. no. 4 | FYXZCPA01ATIY8_536_1 | triacylglycerol lipase | 50.96 | 61.33 | 2.00E−38 |
E.C. no. 5 | contig01695_17539_381 | protein-glutamate methylesterase | 77.60 | 55.01 | 3.00E−84 |
E.C. no. 6 | contig07322_3581_40 | triacylglycerol lipase | 60.40 | 99.60 | 2.00E−70 |
E.C. no. 7 | FYXZCPA02J31IF_470_1 | protein-glutamate methylesterase | 94.55 | 69.62 | 3.00E−55 |
E.C. no. 8 | contig07990_2621_29 | protein-glutamate methylesterase | 74.50 | 99.43 | 2.00E−157 |
E.C. no. 9 | contig10134_349_3 | protein-glutamate methylesterase | 51.76 | 60.43 | 5.00E−17 |
---|---|---|---|---|---|
E.C. no. 10 | contig01574_9423_255 | protein-glutamate methylesterase | 54.29 | 50.72 | 4.00E−04 |
E.C. no. 11 | contig04439_2235_47 | protein-glutamate methylesterase | 54.96 | 52.49 | 2.00E−72 |
E.C. no. 12 | contig07769_983_5 | protein-glutamate methylesterase | 54.31 | 92.80 | 2.00E−31 |
E.C. no. 13 | contig05129_1344_6 | protein-glutamate methylesterase | 59.58 | 97.90 | 3.00E−121 |
E.C. no. 14 | contig01573_4582_113 | carboxymethylenebutenolidase | 54.38 | 85.38 | 6.00E−52 |
E.C. no. 15 | contig09355_501_4 | protein-glutamate methylesterase | 62.50 | 84.55 | 1.00E−34 |
E.C. no. 16 | FYXZCPA01C4V38_432_1 | triacylglycerol lipase | 51.41 | 56.71 | 9.00E−19 |
E.C. no. 17 | contig05158_2403_20 | protein-glutamate methylesterase | 50.85 | 50.64 | 8.00E−25 |
E.C. no. 18 | contig04980_2741_49 | protein-glutamate methylesterase | 53.38 | 97.79 | 2.00E−35 |
E.C. no. 19 | contig00779_27300_655 | protein-glutamate methylesterase | 77.68 | 99.44 | 2.00E−160 |
E.C. no. 20 | FYXZCPA02JFV78_481_1 | protein-glutamate methylesterase | 50.00 | 68.80 | 2.00E−20 |
E.C. no. 21 | contig01548_1890_12 | protein-glutamate methylesterase | 54.29 | 50.72 | 2.00E−05 |
E.C. no. 22 | FYXZCPA02HPIN0_465_1 | 6-phosphogluconolactonase | 95.48 | 53.63 | 3.00E−74 |
E.C. no. 23 | contig00680_7380_200 | protein-glutamate methylesterase | 62.16 | 97.76 | 2.00E−75 |
E.C. no. 24 | FYXZCPA01AW52H_501_1 | protein-glutamate methylesterase | 64.38 | 58.40 | 4.00E−24 |
E.C. no. 25 | contig04738_1406_28 | protein-glutamate methylesterase | 52.21 | 83.70 | 6.00E−27 |
E.C. no. 26 | contig01007_1067_9 | triacylglycerol lipase | 75.79 | 82.25 | 1.00E−70 |
E.C. no. 27 | contig01899_519_4 | triacylglycerol lipase | 50.29 | 50.88 | 3.00E−48 |
E.C. no. 28 | contig04083_1665_9 | protein-glutamate methylesterase | 50.42 | 93.60 | 8.00E−28 |
E.C. no. 29 | contig00864_10444_246 | protein-glutamate methylesterase | 54.79 | 99.47 | 2.00E−53 |
E.C. no. 30 | contig01748_3935_54 | triacylglycerol lipase | 65.05 | 90.88 | 5.00E−117 |
E.C. no. 31 | contig01312_6616_156 | triacylglycerol lipase | 78.60 | 98.28 | 9.00E−86 |
E.C. no. 32 | contig00956_967_6 | protein-glutamate methylesterase | 60.07 | 79.17 | 4.00E−93 |
E.C. no. 33 | contig03179_1774_53 | protein-glutamate methylesterase | 50.56 | 73.55 | 3.00E−22 |
E.C. no. 34 | contig05175_614_5 | protein-glutamate methylesterase | 51.35 | 88.80 | 2.00E−29 |
E.C. no. 35 | contig04148_2863_53 | protein-glutamate methylesterase | 51.11 | 59.42 | 4.00E−04 |
E.C. no. 36 | contig01109_4523_139 | protein-glutamate methylesterase | 51.33 | 98.67 | 2.00E−41 |
E.C. no. 37 | FYXZCPA02IIP42_477_1 | 3-oxoadipate enol-lactonase | 75.84 | 55.19 | 2.00E−60 |
E.C. no. 38 | FYXZCPA01CK4RL_454_1 | protein-glutamate methylesterase | 52.70 | 58.73 | 6.00E−16 |
E.C. no. 39 | contig06284_1669_16 | protein-glutamate methylesterase | 51.26 | 95.20 | 9.00E−30 |
E.C. no. 40 | FYXZCPA02GN27Q_460_1 | acetylcholinesterase | 56.49 | 57.09 | 5.00E−41 |
E.C. no. 41 | contig01142_9836_320 | protein-glutamate methylesterase | 78.51 | 97.58 | 3.00E−52 |
E.C. no. 42 | contig05497_1971_21 | protein-glutamate methylesterase | 50.00 | 92.11 | 2.00E−45 |
E.C. no. 43 | contig00811_7133_147 | protein-glutamate methylesterase | 72.13 | 100.00 | 1.00E−141 |
E.C. no. 44 | contig03571_4243_108 | protein-glutamate methylesterase | 51.22 | 58.91 | 2.00E−56 |
E.C. no. 45 | contig00177_37689_2549 | protein-glutamate methylesterase | 64.58 | 99.18 | 7.00E−137 |
E.C. no. 46 | contig01355_5503_132 | protein-glutamate methylesterase | 51.30 | 92.00 | 2.00E−26 |
E.C. no. 47 | contig07567_976_5 | triacylglycerol lipase | 56.25 | 52.03 | 2.00E−61 |
E.C. no. 48 | contig04073_10150_130 | 6-phosphogluconolactonase | 70.09 | 92.24 | 7.00E−73 |
E.C. no. 49 | contig04394_3033_83 | protein-glutamate methylesterase | 60.83 | 96.77 | 3.00E−37 |
E.C. no. 50 | contig00873_13383_308 | protein-glutamate methylesterase | 55.26 | 55.07 | 5.00E−05 |
E.C. no. 51 | contig00238_4315_99 | protein-glutamate methylesterase | 60.21 | 82.65 | 1.00E−101 |
E.C. no. 52 | contig01644_12678_360 | protein-glutamate methylesterase | 51.79 | 52.58 | 5.00E−23 |
E.C. no. 53 | contig05752_1086_9 | protein-glutamate methylesterase | 54.70 | 63.59 | 5.00E−87 |
---|---|---|---|---|---|
E.C. no. 54 | contig06520_2685_59 | protein-glutamate methylesterase | 51.20 | 98.81 | 2.00E−90 |
E.C. no. 55 | FYXZCPA01D95YE_442_1 | protein-glutamate methylesterase | 50.00 | 54.03 | 4.00E−09 |
E.C. no. 56 | contig12591_616_6 | protein-glutamate methylesterase | 50.43 | 53.99 | 1.00E−22 |
E.C. no. 57 | contig01479_20270_446 | protein-glutamate methylesterase | 50.82 | 93.85 | 6.00E−32 |
E.C. no. 58 | contig04528_7408_175 | protein-glutamate methylesterase | 62.18 | 96.75 | 5.00E−41 |
E.C. no. 59 | contig01961_1964_14 | protein-glutamate methylesterase | 62.50 | 89.82 | 6.00E−120 |
E.C. no. 60 | contig05933_1877_36 | carboxylesterase | 72.10 | 97.18 | 6.00E−119 |
E.C. no. 61 | FYXZCPA02JFTDD_499_1 | protein-glutamate methylesterase | 50.00 | 56.97 | 5.00E−32 |
E.C. no. 62 | contig02175_3096_107 | protein-glutamate methylesterase | 54.46 | 99.11 | 5.00E−49 |
E.C. no. 63 | contig05606_1287_8 | protein-glutamate methylesterase | 65.03 | 55.04 | 2.00E−58 |
E.C. no. 64 | contig08366_295_2 | protein-glutamate methylesterase | 51.81 | 65.35 | 2.00E−18 |
E.C. no. 65 | contig03691_2959_22 | protein-glutamate methylesterase | 58.57 | 51.85 | 8.00E−20 |
E.C. no. 66 | contig06683_514_3 | protein-glutamate methylesterase | 50.39 | 94.85 | 8.00E−33 |
E.C. no. 67 | GJ054VR02IO0TL_534_1 | triacylglycerol lipase | 50.39 | 59.76 | 7.00E−53 |
E.C. no. 68 | GJ054VR01CUP6J_454_1 | protein-glutamate methylesterase | 52.94 | 75.56 | 6.00E−23 |
E.C. no. 69 | contig00456_28478_646 | protein-glutamate methylesterase | 50.23 | 96.09 | 7.00E−49 |
E.C. no. 70 | contig03921_533_3 | protein-glutamate methylesterase | 64.22 | 88.62 | 7.00E−38 |
E.C. no. 71 | contig10760_22051_6260 | triacylglycerol lipase | 81.57 | 99.22 | 2.00E−115 |
E.C. no. 72 | contig04473_1195_7 | protein-glutamate methylesterase | 50.43 | 85.19 | 4.00E−26 |
E.C. no. 73 | GJ054VR02GCI2F_479_1 | protein-glutamate methylesterase | 50.00 | 97.60 | 1.00E−33 |
E.C. no. 74 | GJ054VR01EFZ0J_498_1 | protein-glutamate methylesterase | 62.50 | 59.02 | 3.00E−49 |
E.C. no. 75 | contig07065_401_2 | protein-glutamate methylesterase | 50.00 | 60.87 | 6.00E−06 |
E.C. no. 76 | contig02240_1506_10 | protein-glutamate methylesterase | 50.00 | 55.61 | 1.00E−27 |
E.C. no. 77 | contig05971_806_4 | protein-glutamate methylesterase | 51.69 | 73.55 | 6.00E−23 |
E.C. no. 78 | GJ054VR02JO9KC_470_1 | protein-glutamate methylesterase | 51.28 | 95.12 | 5.00E−27 |
E.C. no. 79 | contig04043_1277_11 | protein-glutamate methylesterase | 50.44 | 83.70 | 1.00E−27 |
E.C. no. 80 | contig00960_13684_281 | protein-glutamate methylesterase | 65.05 | 90.88 | 5.00E−117 |
E.C. no. 81 | GJ054VR01B5TSY_488_1 | protein-glutamate methylesterase | 78.51 | 97.58 | 2.00E−52 |
E.C. no. 82 | GJ054VR02II30F_510_1 | protein-glutamate methylesterase | 51.96 | 81.60 | 6.00E−27 |
E.C. no. 83 | contig00732_3200_23 | protein-glutamate methylesterase | 57.14 | 50.72 | 8.00E−04 |
E.C. no. 84 | GJ054VR02H7I8R_531_1 | dihydrocoumarin hydrolase | 60.23 | 63.77 | 2.00E−59 |
E.C. no. 85 | contig00987_35243_1622 | protein-glutamate methylesterase | 64.58 | 99.18 | 7.00E−137 |
E.C. no. 86 | contig03267_4254_30 | Carboxymethylenebutenolidase | 53.18 | 67.98 | 4.00E−42 |
E.C. no. 87 | contig00064_9159_317 | carboxylesterase | 72.10 | 97.18 | 6.00E−119 |
E.C. no. 88 | GJ054VR02JYT6B_479_1 | protein-glutamate methylesterase | 62.03 | 63.20 | 1.00E−24 |
E.C. no. 89 | contig00955_1565_14 | triacylglycerol lipase | 78.09 | 60.75 | 6.00E−71 |
E.C. no. 90 | contig07351_1200_9 | protein-glutamate methylesterase | 54.29 | 50.72 | 6.00E−04 |
E.C. no. 91 | contig05469_1382_15 | protein-glutamate methylesterase | 54.76 | 59.42 | 8.00E−05 |
E.C. no. 92 | contig04613_1156_8 | protein-glutamate methylesterase | 55.10 | 87.50 | 5.00E−10 |
E.C. no. 93 | contig05233_960_7 | protein-glutamate methylesterase | 51.43 | 50.72 | 2.00E−04 |
E.C. no. 94 | contig06045_1712_10 | protein-glutamate methylesterase | 62.61 | 72.78 | 6.00E−37 |
E.C. no. 95 | contig05435_745_4 | protein-glutamate methylesterase | 50.00 | 81.63 | 2.00E−06 |
E.C. no. 96 | contig00154_53031_1113 | protein-glutamate methylesterase | 50.85 | 50.64 | 6.00E−25 |
---|---|---|---|---|---|
E.C. no. 97 | GJ054VR02F0FR6_436_1 | protein-glutamate methylesterase | 61.74 | 51.11 | 6.00E−28 |
E.C. no. 98 | GJ054VR01A7XTC_544_1 | protein-glutamate methylesterase | 80.21 | 51.28 | 5.00E−78 |
E.C. no. 99 | contig06676_1954_11 | protein-glutamate methylesterase | 54.29 | 53.60 | 1.00E−15 |
E.C. no. 100 | contig01396_3317_22 | triacylglycerol lipase | 51.28 | 80.29 | 3.00E−79 |
E.C. no. 101 | contig09830_293_3 | protein-glutamate methylesterase | 58.76 | 59.88 | 5.00E−29 |
E.C. no. 102 | contig00023_26624_552 | 6-phosphogluconolactonase | 69.06 | 96.12 | 1.00E−76 |
E.C. no. 103 | GJ054VR02GMPRP_548_1 | triacylglycerol lipase | 84.03 | 62.34 | 5.00E−58 |
E.C. no. 104 | GJ054VR01EH9PQ_550_1 | protein-glutamate methylesterase | 50.00 | 67.86 | 1.00E−05 |
E.C. no. 105 | GJ054VR01CJYLF_496_1 | protein-glutamate methylesterase | 50.00 | 50.38 | 3.00E−10 |
E.C. no. 106 | contig00373_119927_2499 | protein-glutamate methylesterase | 74.36 | 100.00 | 2.00E−157 |
E.C. no. 107 | GJ054VR01BUKCP_412_1 | triacylglycerol lipase | 59.12 | 53.52 | 2.00E−46 |
Protein hit | Score | Query coverage | E-value | Ident |
---|---|---|---|---|
Hypothetical protein AF0514 (Archaeoglobus fulgidus DSM 4304) | 377 | 100% | 2e−131 | 99% |
Hypothetical protein Ferp 1969 (Ferroglobus placidus DSM10642) | 227 | 97% | 3e−72 | 60% |
Putative hydrolase of alpha/beta superfamily (Archaeoglobus sulfaticallidus) | 214 | 96% | 4e−67 | 55% |
Hypothetical protein Arcve 1663 (Archaeoglobus veneficus SNP6) | 190 | 99% | 1e−57 | 52% |
Hydrolase of alpha/beta superfamily (Natronobacterium gregoryi SP2) | 100 | 100% | 8e−23 | 31% |
Hypothetical protein HacjB3 (Halalkalicoccus jeotgali) | 99.0 | 96% | 3e−22 | 32% |
Hypothetical protein (Haloferax larsenii) | 98.6 | 93% | 5e−22 | 32% |
Hypothetical protein (Haloferax elongans) | 98.2 | 93% | 5e−22 | 32% |
Alpha/beta hydrolase (Halostagnicola larsenii XH-48) | 97.8 | 98% | 7e−22 | 32% |
Hydrolase of alpha/beta superfamily-like protein (Natrialba taiwanensis) | 96.7 | 97% | 2e−21 | 32% |
Hydrolase of alpha/beta superfamily-like protein (Natroncoccus amylolyticus) | 97.4 | 98% | 2e−21 | 32% |
Alpha/beta hydrolase (Halosarcina pallida) | 94.4 | 91% | 1e−20 | 34% |
Uniprot ID | NCBI RefSeq | Archaea/Bacteria | Species | Annotation | Identity to FS02 |
---|---|---|---|---|---|
W0JIR4 | WP_049951831.1 | A | Halostagnicola larsenii | alpha/beta hydrolase | 32% |
L0ALB7 | WP_005580491.1 | A | Natronobacterium gregoryi | alpha/beta hydrolase | 31% |
M0DBB1 | WP_008384884.1 | A | Halogeometricum pallidum | alpha/beta hydrolase | 34% |
N0BCB5 | WP_015590857.1 | A | Archaeoglobus sulfaticallidus | hydrolase of the alpha/beta superfamily | 55% |
D3S043 | WP_012966445.1 | A | Ferroglobus placidus | hypothetical protein | 60% |
O29736 | WP_010878021.1 | A | Archaeoglobus fulgidus | hypothetical protein | 99% |
C1F9B1 | WP_012680666.1 | B | Acidobacterium capsulatum | alpha/beta hydrolase | 30% |
Q022D1 | WP_011684934.1 | B | Solibacter usitatus | hypothetical protein | 33% |
I7ZH91 | WP_007184188.1 | B | Hydrocarboniphaga effuse | hypothetical protein | 27% |
A6VBB3 | WP_003150434.1 | B | Pseudomonas aeruginosa | alpha/beta hydrolase | 29% |
I4C162 | WP_052315987.1 | B | Desulfomonile tiedjei | hypothetical protein | 29% |
A0LIX5 | WP_011698547.1 | B | Syntrophobacter fumaroxidans | alpha/beta hydrolase family protein | 26% |
Submit your manuscript at: http://papersubmission.scirp.org/