Pseudomonas aeruginosa is one of the most important opportunistic human pathogens worldwide. High prevalence of Multi Drug Resistant P. aeruginosa (MDRPa) in Iran is a serious problem for antimicrobial therapy. Several studies have reported the MDRPa in Europe and Asia. Due to the use of broad-spectrum antibiotics, bacterial resistance is increasing in Iran, located in Middle East. The present cross-sectional study was designed to investigate the prevalence of class1 integron, resistance gene cassettes and antimicrobial susceptibility profiles among isolates of P. aeruginosa in Al-Zahra Hospital, Isfahan City, central part of Iran from Jan-Sep 2014. The aim of this study was to determine the antimicrobial susceptibility, the prevalence of Class1 integron, resistance gene a measuring in Iran. A total of 231 P. aeruginosa isolates were collected from clinical specimens including urine (50.6%), tracheal tube (25.5%), wound (13.4%), blood (6.1%), catheter (2.2%), cerebrospinal fluid (1.7%) and sputum (0.4%) isolates from hospitalized patients (mean age: 50.27 ± 24.12 years).The majority of patients (68%) were male. Isolates were collected from different parts of the hospital as follows: ICU, Internal Medicine, Emergency care, Pediatrics, Nephrology, Transplant Center, General surgery and Infectious. Revealed data show a high rate of MDR P. aeruginosa isolates in the studied area; also, the result signifies the spread of aadA6 among clinical isolates in hospitalized patients.
Pseudomonas aeruginosa is one of the most important opportunistic human pathogens responsible for 10% - 15 % of the nosocomial infections worldwide [
Plasmids, transposons and integrons are mobile genetic elements that they resort of earning resistance mechanisms cooperating to P. aeruginosa multidrug resistance [
A cross-sectional study was conducted in Al-Zahra Hospital in Isfahan City, located in central part of Iran from Jan-Sep 2014. Two hundred and thirty one P. aeruginosa strains were obtained from different specimens of inpatients coming from clinical cases, including 117 urine (50.6%), 59 tracheal tube (25.5%), 31 wound (13.4%), 14 blood (6.1%), 5 catheter (2.2%), 4 cerebrospinal fluid (1.7%) and 1 sputum (0.4%) isolates. These samples were collected from different parts of the hospital as follows: ICU1, Internal Medicine, Emergency care, Pediatrics, Nephrology, Transplant Center, General surgery and Infectious.
At first, primary isolation was performed by phenotypic characteristics on blood agar and McConkey(Merck, Germany), then the isolates identification was carried out and confirmed to the species level by standard biochemical tests including Gram stain, catalase and oxidase test, O/F (Oxidation Fermentation) test (Merck, Germany), pyocyanin pigment production and growth at 42˚C [
Antimicrobial susceptibility test was performed on isolates using the Kirby-Bauer disk-diffusion breakpoint assay on Mueller-Hinton agar (Merck, Germany); and the cultures were incubated for 24 h at 37˚C. The following antibiotic disks (Mast, Bootle, Merseyside, UK) were used for susceptibility test: imipenem (10 µg), meropenem (10 µg) aztreonam (30 µg), cefepime (30 µg), ceftazidime (30 µg), amikacin (30 µg), gentamicin (10 µg), ciprofloxacin (5 µg), norfloxacin (10 µg), t obramycin (30 µg), piperacillin/tazobactam (100/10 µg) and colistin (10 µg). Pseudomonas aeruginosa (ATCC 27853) and Escherichia coli (ATCC 25922) were used as the quality control strains in every susceptibility test [
DNA extraction was carried out on MDR P. aeruginosa by boiling method. The template DNA stored at −20˚C until polymerase chain reaction (PCR) amplification was performed.MDR P. aeruginosa isolates were screened for the presence of class 1 integron by using 4 specific primers located on intI1 gene, qacED, sulI and gene cassette regions. Master mix component was as follow: 10× PCR buffer in a final concentration of 1×, MgCl2 (50 mM) in a final concentration of 1.5 mM, 10 mM dNTPs Mix in a final concentration of 0.2 mM, Forward and Reverse primers in a final concentration of 0.4 µM. PCR amplification was performed in a total volume of 25 µl (24 µl of PCR master mix plus 1 µl of template DNA). Amplification was carried out in a thermocycler (Eppendorf Master cyclers, MA) using the published paper programs [
Sequencing was done by Sanger’s method (Applied Biosystems 3730/3730xl DNA Analyzers Sequencing; Bioneer). The sequences were analyzed using Chromas Pro version 1.7.5 Technelysium (http://www.technelysium.com.au/). Nucleotide sequences were compared using online BLAST software (http://www.ncbi.nlm.nih). The sequences obtained from the gene cassette analysis have been deposited in GenBank under accession numbers FJ908755 for aadB, FJ908756 for aadA6 and orfDgenes, KJ679405 for aacA7, blaOXA-2, aacA8 and HF546976 for blaNDM-1 gene.
The mean age of the studied patients was 50.27 ± 24.12 years, which ranged from under one to 91 years. Demographic information of patients in this study has been summarized in
The resistance pattern of P. aeruginosa isolates in this study revealed that 192 (83.1%) were Multi Drug Resis-
Reference | PCR product (bp) | PCR conditions | Sequence (5′ → 3′) | Primer |
---|---|---|---|---|
6 | This work | 94˚C, 30 s; 55˚C, 30 s; 72˚C, 1 min (35 cycles) | AAA ACC GCC ACT GCG CCG TTA | IntI f |
GAA GAC GGC TGC ACT GAA CG | IntI r | |||
7 | 236 | 94˚C, 1 min; 48˚C, 45 s; 72˚C, 1 min (35 cycles) | ATCGCAATAGTTGGCGAAGT | qacED1-f |
CAAGCTTTTGCCCATGAAGC | qacED1-r | |||
7 | 437 | 94˚C, 1 min; 48˚C, 45 s; 72˚C, 1 min (35 cycles) | CTTCGATGAGAGCCGGCGGC | SulI-f |
GCAAGGCGGAAACCCGCGCC | SulI-r | |||
7 | Variable | 94˚C, 1 min; 48˚C, 45 s; 72˚C, 1 min (35 cycles) | GGCATCCAAGCAGCAAG | In5'CS |
AAGCAGACTTGACCTGA | In3'CS |
Patient characteristic | IntI positive n (%) N = 146 (63.2) | IntI negative n (%) N = 85 (36.8) | P value |
---|---|---|---|
Age | |||
< 40 Years | 33 (43.4% ) | 43 (56.6% ) | <0.001 |
≥40 Years | 113 (72.9%) | 42 (27.1% ) | |
Sex | |||
Male | 102 (65%) | 55 (35%) | |
Female | 44 (59.5%) | 30 (40.5%) | |
Ward | |||
Transplant center | 28 (96.6%) | 1 (3.4%) | <0.001 |
ICU | 48 (67.6%) | 23 (32.4%) | |
Internal medicine | 20 (52.6%) | 18 (47.4%) | |
Infectious | 3 (60%) | 2 (40%) | |
General surgery | 26 (53.1%) | 23 (46.9%) | |
Paediatrics | 4 (25%) | 12 (75%) | 0.02 |
Emergency | 10 (71.4%) | 4 (28.6%) | |
Nephrology | 7 (77.8%) | 2 (22.2%) | |
Sample type | |||
Urine | 83 (70.9%) | 34 (29.1%) | 0.01 |
Catheters | 3 (60%) | 2 (40%) | |
Blood | 6 (42.9%) | 8 (57.1%) | |
Wound | 17 (54.8%) | 14 (45.2%) | |
Tracheal tube | 35 (59.3%) | 24 (40.7%) | |
CSF | 1 (25%) | 3 (75%) | |
Sputum | 1 (100%) | 0 (0%) | |
Drug resistance | |||
Multi drug-resistance | 146 (76%) | 46 (24%) | <0.001 |
Extensively-drug resistance | 78 (88.6%) | 10 (11.4%) | <0.001 |
tant (MDR). Eighty (38.1%) P. aeruginosa isolates were resistant to all antibioticstested in this study. Resistanceor intermediate resistance (non-susceptible) was mostly observed toimipenem (63.6%), meropenem (63.6%), gentamicin (81.4%), amikacin (69.7%), ceftazidime (61.9%),ciprofloxacin (69.7%), tobramycin (74.5%), cefepime (61.9%), norfloxacin (68.4%), aztreonam (60.6%), colistin (58.9%) and piperacillin-tazo- bactam (56.7%) (
PCR assay was performed to detect integrin integrase genes (intI1), qacED, and sulI genes, and gene cassette regions (5CS/3CS) among 192 clinical MDR P. aeruginosa isolates. Out of 192 isolates, 146 (76%) were positive for class 1 integron by amplifying the intI1 gene. Nucleotide sequence analysis of the class 1 integron variable regions revealed the presence of 3 different fragment sizes of approximately 0.8, 1.2 and 2.5 kb (
isolates (62.5%) carried class 1 integron with sizes of approximately 1.2 kb, twenty three isolates (12%) with sizes of approximately 2.5 kb and three isolate (1.5) with sizes of approximately 0.8 kb.
The isolation sites and samples found in this study have been summarized in
Multi Drug Resistant P. aeruginosa is a serious challenge for treatment of nosocomial contagion, and a suitable antibiotic choice to initiate remedy is necessary for optimizing the clinical consequence [
ICU (No) | Transplant center (No) | Nephrology (No) | General surgery (No) | Emergency care (No) | Infectious (No) | Internal medicine (No) | Paediatrics (No) | |
---|---|---|---|---|---|---|---|---|
Urine | 24 | 23 | 9 | 24 | 12 | 2 | 18 | 5 |
Tracheal tube | 39 | 0 | 0 | 3 | 0 | 2 | 11 | 4 |
Blood | 4 | 2 | 0 | 4 | 0 | 1 | 3 | 0 |
Wound | 1 | 2 | 0 | 15 | 2 | 0 | 6 | 5 |
Catheter | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
Sputum | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
CSF | 0 | 0 | 0 | 3 | 0 | 0 | 0 | 1 |
Total | 71 | 28 | 9 | 49 | 14 | 5 | 38 | 17 |
Resistance No. (%) | Intermediate No. (%) | Sensitive No. (%) | |
---|---|---|---|
Gentamicin | 97.3 | 0 | 2.7 |
Ciprofloxacin | 93.2 | 2.7 | 4.1 |
Tobramycin | 91.8 | 1.4 | 6.8 |
Norfloxacin | 91.8 | 0.7 | 7.5 |
Ceftazidime | 84.9 | 0.7 | 14.4 |
Cefepime | 84.2 | 1.4 | 14.4 |
Imipenem | 84.2 | 4.8 | 11 |
Meropenem | 86.3 | 2.1 | 11.6 |
Colistin | 67.1 | 2.1 | 30.8 |
Amikacin | 79.5 | 7.5 | 13 |
Aztreonam | 79.5 | 0.7 | 19.9 |
Piperacillin-tazobactam | 56.8 | 23.3 | 19.9 |
Iran [
The results of the present investigation showed thatthe screening for integrons in P. aeruginosa clinical isolates (192 MR and 39 Non-MR) from the Al-Zahra hospital; and146/231 isolates carry class 1 integrons. Out of these 192 MR isolates, 146 (76%) were positive for the presence of class 1 integrons. Several reports have revealed the presence of aminoglycoside resistance genes associated with integrons found in gram-negative bacteria [
The high resistance level against aminoglycoside antibiotics (gentamicin, amikacin and tobramycin) was observed in this study. Resistance to this class of antibiotics in P. aeruginosa is usually associated with the production of aminoglycoside adenylyltransferase which leads to resistance to aforementioned antibiotics [
High resistance among P. aeruginosa strains against the following antibiotics: gentamicin, ciprofloxacin, tobramycin, norfloxacin, ceftazidime, cefepime, imipenem, meropenem, amikacin, aztreonam isolated from sputum, tracheal tube, urine and wounds was observed. The resistance rate of P. aeruginosa isolates from sputum, tracheal tube, urine, wound, blood, catheter andcerebrospinal fluid was reported as 100%, 89.8%, 83.8%, 80.6%, 64.3%, 60% and 50% respectively. In the present study, piperacillin/tazobactam and colistin was the most efficient antibiotics against P. aeruginosa and the antibiotic susceptibility test results showed 43.3% susceptible to piperacillin-tazobactam and 41.1% susceptible to colistin compared with other studies carried out on P. aeruginosa isolated from burn patients in Tehran in which reported 87.2% resistance to piperacillin-tazobactam [
Genes giving resistance to aminoglycosides and ß-lactams are frequently found in integrons from P. aeruginosa isolates and the most popular aminoglycoside resistance gene cassettes related to aad and aac families [
This is noticeable that orfD has unknown functions and can potentially translate as a polypeptide chain. An ORF (open reading frame) is a portion of a DNA molecule that contains no stop codons, when translated into amino acids [
Class D β-lactamases (oxacillinases) (OXA type enzymes) belongs to functional group 2d and molecular class D [
Study done among clinical isolates of Pseudomonas aeruginosa in 5hospitals Iran, Tehran reported class 1 integron containing aadB, aadA6-orfD, aacA4 and blaoxa10 [
In conclusion, our data show that high rate resistant to multiple drugs among P. aeruginosa signifies the spreads of aadA6 among clinical isolates in hospitalized patients in Al-Zahra hospital. There is a significant relationship to antibiotic resistance and class 1 integron and mobile genetic elements play a major role in the development of a resistance gene.
This study was approved by the Kashan University of Medical Sciences Ethics Committee, Kashan, Iran. We thank the Research council of Kashan University of Medical Sciences for supporting this project; we would like to thank the personnel of the Al-Zahra Hospital in Isfahan, Iran for their co-operation.
Maryam Mirahsani,Ahmad Khorshidi,Rezvan Moniri,Hamid Reza Gilasi, (2016) Prevalence of Class 1 Integron, Resistance Gene Cassettes and Antimicrobial Susceptibility Profiles among Isolates of Pseudomonas aeruginosa in Iran. Open Journal of Medical Microbiology,06,87-96. doi: 10.4236/ojmm.2016.62012