The tyrosine kinase receptor III, c-Kit/stem cell factor receptor and its ligand, human stem cell factor (huSCF) are the predominant regulator of mitogenesis in the hematopoietic stem and progenitor cells. However, gain-of-function mutations alter c-Kit auto-regulatory mechanisms to aberrant c-Kit signaling, leading to the onset or progression of cancerous transformations. The most common mutation of c-Kit is the substitution of aspartic acid residue in position 816 to valine (D816V), which is majorly responsible for its ligand-independent constitutive activation, and is implicated in hematopoietic malignancies. Currently, molecular targeted therapy is increasingly becoming a hot spot due to its specificity and low toxicity. As the molecular mechanisms responsible for D816V-c-Kit mediated tumorogenicity are largely unknown, in this study, we aimed to investigate the D816V-c-Kit signaling mediated downstream molecular targets. Specifically, we created c-Kit active mutant form D816V and performed inducible gene expression of mutant D816V-c-Kit in monomyelocytic cell line U937. Mutant D816V-c-Kit expressing cells revealed significantly enhanced cellular mitogenic activity compared to wild-type c-Kit expressing cells independent of huSCF. To examine the molecular targets regulating tumorogenic proliferation, we evaluated the consequences of mutant D816V-c-Kit expression on downstream gene expression profile by high throughput microarray technology. The levels of some of the relevant genes (PIK3CB, eIF4B, PRKCDBP, MOAP1) were validated by quantitative polymerase chain reaction. SLA, STAT5B, MAP3K2 and MAPK14 emerged as important downstream molecular targets of mutant D816V-c-Kit. Further, by dissecting the signaling pathways, we also demonstrated that the D816V-c-Kit mediated hematopoietic cell proliferation is dependent on molecular target p38 MAP kinase.
c-Kit and huSCF are encoded at the white spotting and steel loci of the mouse, respectively. Mutations at both the W and the Sl locus cause deficiencies in hematopoiesis, gametogenesis and melanogenesis [
Though, physiologically regulated tyrosine kinase activity of c-Kit is necessary for the controlled proliferation of hematopoietic stem and progenitor cells, mutational activations disturb c-Kit dynamic regulatory mechanisms, resulting in oncogenic transformation [
The complete coding sequence of the human c-Kit gene was excised as a BamH1 fragment (1 - 3.2 Kb) from pcDNA3-c-Kit vector (kindly gifted by Dr. Ronnstrand, Department of Experimental Clinical Chemistry, Austria). This fragment was further sub-cloned between BamHI restriction sites in sense orientation of PminCMV promoter using inducible expression vector pTRE2hyg (Clontech, USA). The sub-cloning of c-Kit gene was finally characterized by restriction analysis. The restriction analysis of recombinant wild type c-Kit-pTRE2hyg plasmid DNA using HindIII enzyme (Bioenzyme) generates three characteristic linear fragments of specific size; 4.9 Kb, 2.5 Kb and 1.1 Kb (
Human myelomonocytic leukemic cell line U937 was obtained from National Centre for Cell Science (NCCS, Pune, India). U937 cells were maintained in complete medium (RPMI-1640 medium supplemented with 1.0% sodium pyruvate, 10% FCS, 2 mM glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin) at 37˚C in a fully humidified atmosphere of 95% room air and 5% CO2. The culture was maintained thrice in a week in fresh complete medium. Exponentially growing cells with ≥94% viability were used for transfection. Approximately, 3 × 105/ml number of cells were transfected with p Tet-off plasmid DNA. Transfected cells were selected using puromycin (0.5 ng/µl) containing media. The Tet-off stable U937 cells were maintained by periodically adding doxycycline (1 µg/µl) after every two days. Tet-off transfected U937 cells were subsequently transfected with recombinant vectors-wild type c-Kit-TRE2hyg and D816V-c-Kit-TRE2hyg. Double transfected cells were selected using hygromycin containing culture medium and stable transfected positive clones were screened by limiting dilution. All transfections in U937 cells were performed using hilymax transfection reagent (Dojindo, Japan).
Transfection of wild-type and mutant D816V-c-Kit stable transfectants were assessed by flow cytometry. Briefly, one million exponentially growing transfectants were washed and incubated for one hour with 0.5 μg of primary mouse anti-human monoclonal c-Kit antibody (Santa Cruz, USA) at a 1:200 dilution on ice. After washing three times with staining buffer (2% FBS and 0.1% sodium azide in phosphate-buffered saline (PBS), cells were subsequently incubated with secondary FITC-labelled goat anti-mouse antibody (Santa Cruz Biotechnology, USA). These cells were washed to remove unbound secondary antibodies and analyzed by flow cytometry. Non-specific binding was assessed by using isotype-negative controls that were added at the same concentrations. After washing and resuspension, samples were analyzed on a Becton Dickinson (San Jose, CA) FACS Calibur flow cytometer.
Wild-type and mutant D816V-c-Kit were stimulated with and without huSCF (100 ng/ml) for 24 hrs. Cells were lysed in an appropriate amount of RIPA lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM sodium chloride, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA), supplemented with 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, and 1× protease inhibitor. Lysates were incubated for 30 min on ice and then cleared by centrifugation at 14,000 xg for 15 min at 4˚C. Protein content was determined by BCA method (Thermo Scientific, USA). Immunoblotting was performed following a standard protocol. Briefly, samples were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membrane (Pall Life Science). The membrane was blocked using 3% BSA dissolved in TBS buffer containing 0.1% tween-20 (TBST) for 1hr at room temperature and incubated overnight at 4˚C with primary antibodies: primary anti-human mouse monoclonal p-c-Kit antibody (Santa Cruz Biotechnology, USA), primary anti-human mouse monoclonal p-P38 MAP kinase antibody (Santa Cruz Biotechnology, USA), and anti-β-actin (Santa Cruz Biotechnology, USA). After three 5 min washes with TBST, membranes were incubated with HRP-conjugated secondary antibodies (1:2000) for 1 hr at RT and washed three times with TBST buffer. Blots were developed using TMB stabilized substrate (Promega, Wisconsin). Membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology, USA) and bands were visualized using enhanced chemiluminescence method (Amersham Pharmacia Biotech Piscataway).
U937 cells expressing wild-type c-Kit or mutant D816V-c-Kit (2 × 104/well) were re-suspended in serum-free medium and seeded in triplicates in 96-well plates with 100 ng/ml huSCF (Invitrogen, USA) and without huSCF as control. After a 48 hr of stimulation, viable cells were evaluated using the Cell Titer 96 Aqueous One Solution cell proliferation assay kit (Promega, Wisconsin). Data was considered significant if results showed p-value ≤0.05. The effect of p38 MAP kinase inhibitor (Santa Cruz Biotechnology, USA) on cell growth rate was determined by plating cells (2 × 104/well) in a 96-well plate for 24 hrs at the indicated concentrations. Wild-type c-Kit cells and D816V-c-Kit cells were pre-incubated in the presence or absence of p38 MAP kinase inhibitor at concentration of 1 µM for 24 hrs. This was followed by the addition of 100 μl media with or without huSCF at 100 ng/ml.
Wild-type c-Kit expressing cells (induced) stimulated with huSCF (100 ng/ml) for 24 hrs in serum-starved media and mutant D816V-c-Kit expressing cells (induced) were harvested and stored in RNAlater (Ambion Inc., USA). RNA isolation, quality control, and hybridization were performed by Genotypic Technologies Pvt. Ltd (Bangalore, India) according to the manufacturer’s instructions (Affymetrix, Santa Clara, USA). Briefly, RNA was isolated using an RNeasy mini-kit (Qiagen, USA) and quantified in a Nanodrop spectrophotometer. The RNA sample purity ratios were more than 1.9 for ratios of 260/280 nm and 260/230 nm; the RNA Integrity Number (RIN) values were greater than 7.1 as evaluated on a bio-analyzer 2100 (Agilent Technologies, India). Following reverse transcription of RNA in each replicate into respective cDNA, Cy3-labelled cRNA was produced by in vitro transcription and hybridized to a whole genome array chip (human whole gene expression microarray, 8 × 60 K array, Agilent Technologies).
Transcripts which were reliably detected in all the replicates were considered for subsequent data analysis. The data was normalized by percentile shift normalization method using GeneSpring GX11 (Agilent technologies, India). Following normalization, average signal intensity of the probes showing at least 30% change in expression across the 3 donors were computed and ratios (treated/untreated) were log2 transformed. Statistical analysis of the data was performed using Cyber-T regularized t statistic [
Specific genes and their expression levels were validated using real-time PCR (RT-PCR) [
The p38MAPK inhibitor (SB202190) was tested for effects on impact-induced changes in viability in U937 cells at indicated concentrations [
Mutant D816V-c-Kit construct was validated by sequencing across the manipulated region. To study signaling pathways of D816V-c-Kit in progenitor cells, we used U937 cells transfected with wild-type and mutant D816V-c-Kit. Both wild-type c-Kit and the D816V mutant of c-Kit were stably transfected into the hematopoietic cell line U937 using the Tet-off inducible gene expression system [
The directed proliferation potential of D816V-c-Kit expressing (induced) cells as compared to wild-type c-Kit expressing (induced) cells was analyzed in vitro by MTS assay. As shown
Gene Symbol | Accession No. | Primer sequence | Size (bp) | Ta (˚C) |
---|---|---|---|---|
MOAP1 | NM_022151 | Sense: ACGAAGGGATATGGCAATGAG Antisense: AGGCACAGAAACGACAAAGG | 141 | 52 |
PIK3CB | NM_006219 | Sense: TGCGACCAGATGAGTGATGAAG Antisense: TGCCCTATCCTCCGATTACC | 142 | 52 |
eIF4B | NM_001417 | Sense: ATGGATGGTCTTGGATGATGG Antisense: AGTGTGGCATTTCAGTGGAG | 117 | 51 |
PRKCDBP | NM_145040 | Sense: ATGGAGAGTGTAGCCTGAGG Antisense: TTGGTGGATGTAGGATTCGC | 124 | 52 |
(induced) cells. The wild-type c-Kit expressing cells showed response to growth factor, huSCF by showing their higher proliferation in presence of huSCF. However, mutant D816V-c-Kit expressing cells displayed no significant change in proliferation in the presence or absence of huSCF.
Among the differentially regulated genes, genes involved in cell proliferation, PIK3R1 (0.82 fold, p = 0.02), FES (1.06 fold, p = 0.0353), eIF4B (1.11 fold, p = 0.02), ABL2 (0.67 fold, p = 0.0009), MAPK family, MAP2K3 (0.87 fold, p = 0.02), MAPK14 (1.49 fold, p = 0.00), Ras gene family, RAB7B (1.24 fold, p = 0.01), RAB3GAP1 (1.07 fold, p = 0.01), cell adhesion, ABL2 (0.67 fold, p = 0.00), LY9 (0.72 fold, p = 0.03), apoptosis, MOAP1 (−1.42 fold, p = 0.04), transcription factors, TAF5L/PCAF (1.09 fold, p = 0.01), nuclear receptors, U2AF (0.85 fold, p = 0.00), and metabolism, CYP2B6 (0.8 fold, p = 0.02), HMGCS1 (0.87 fold, p = 0.02) were altered in mutant D816V-c-Kit expressing cells. Expression of a number of other signaling molecules involved in mutant D816V-c-Kit mediated ligand-independent proliferation modulated were SLA (1.14 fold, p = 0.155) and STAT5 (2.32 fold, p = 0.103).
To verify expression levels of transcripts obtained from microarray, real-time PCR analysis was performed. Up-regulated genes chosen were PIK3R1 (0.82 fold) and eIF4B (1.11 fold); down-regulated genes were MOAP1 (−1.42 fold, p < 0.04) and PRKCDBP (−1.29 fold, p < 0.01). These genes depicted an identical pattern of alteration as seen by microarray expression analysis (
Further evaluation of biological processes and functions affected by mutant D816V-cKit expressing cells using DAVID bioinformatics resources identified upregulated genes to be functionally involved in MAPK signaling pathway (MAP2K3, MAPK14), mTOR signaling pathway (PIK3R1, EIF4B), cell cycle (eIF4B, ABL2), cell proliferation (INSIG1, FES, PIK3R1), transcription factors (TAF5L/PCAF, STAT5B) and cell adhesion (LY9). The down-regulated genes consisted of glyceroid metabolism (PPAP2C), basal cell carcinoma (MYCL1), cell differentiation (NDRG4, PDLIM7) and PCLKC (involved in negative regulation for cell growth). Significant (p < 0.04) over represented Gene Ontology terms (molecular function) in down and up-regulated genes is shown in
(a) Up-regulated genes | |||
---|---|---|---|
Term | Total No. of genes | No. of genes in dataset | p-value |
MAPK signaling pathway | 78 | 3 | 0.0174 |
Pathways in cancer | 341 | 5 | 0.0489 |
Metabolic pathways | 1084 | 4 | 0.0137 |
(b) Down-regulated genes | |||
Glycerolipid metabolism | 46 | 1 | 1.00E−09 |
ABC transporters | 46 | 1 | 1.00E−09 |
Basal cell carcinoma | 55 | 1 | 1.00E−09 |
Olfactory transduction | 390 | 8 | 0.0404 |
Analysis of %viability in U937 cells in the presence of p38 MAP kinase inhibitor (SB202190) at the indicated concentrations showed that p38 MAP kinase inhibitor showed no cytotoxicity at concentration of 1 µM in 24 hrs (
Mutant D816V-c-Kit construct was validated by sequencing across the manipulated region. To study signaling pathways of D816V-c-Kit in progenitor cells, we used U937 cells transfected with wild-type and mutant D816V-c-Kit. Both wild-type c-Kit and the D816V mutant of c-Kit were stably transfected into the hematopoietic cell line U937 using the Tet-off inducible gene expression system [
D816V-c-Kit (induced) cells. Induced mutant D816V-c-Kit cells showed significant shift in fluorescence intensity compared to uninduced mutant D816V-c-Kit cells (with doxycycline in media) and isotype control. By western blotting, wild-type c-Kit expressing cells and mutant D816V-c-Kit expressing cells showed receptor expression using c-Kit monoclonal antibody (
The directed proliferation potential of D816V-c-Kit expressing (induced) cells as compared to wild-type c-Kit expressing (induced) cells was analyzed in vitro by MTS assay. As shown
Among the differentially regulated genes, genes involved in cell proliferation, PIK3R1 (0.82 fold, p = 0.02), FES (1.06 fold, p = 0.0353), eIF4B (1.11 fold, p = 0.02), ABL2 (0.67 fold, p = 0.0009), MAPK family, MAP2K3 (0.87 fold, p = 0.02), MAPK14 (1.49 fold, p = 0.00), Ras gene family, RAB7B (1.24 fold, p = 0.01), RAB3GAP1 (1.07 fold, p = 0.01), cell adhesion, ABL2 (0.67 fold, p = 0.00), LY9 (0.72 fold, p = 0.03), apoptosis, MOAP1 (−1.42 fold, p = 0.04), transcription factors, TAF5L/PCAF (1.09 fold, p = 0.01), nuclear receptors, U2AF (0.85 fold, p = 0.00), and metabolism, CYP2B6 (0.8 fold, p = 0.02), HMGCS1 (0.87 fold, p = 0.02) were altered in mutant D816V-c-Kit expressing cells. Expression of a number of other signaling molecules involved in mutant D816V-c-Kit mediated ligand-independent proliferation modulated were SLA (1.14 fold, p = 0.155) and STAT5 (2.32 fold, p = 0.103).
To verify expression levels of transcripts obtained from microarray, real-time PCR analysis was performed. Up-regulated genes chosen were PIK3R1 (0.82 fold) and eIF4B (1.11 fold); down-regulated genes were MOAP1 (−1.42 fold, p < 0.04) and PRKCDBP (−1.29 fold, p < 0.01). These genes depicted an identical pattern of alteration as seen by microarray expression analysis (
Further evaluation of biological processes and functions affected by mutant D816V-cKit expressing cells using DAVID bioinformatics resources identified upregulated genes to be functionally involved in MAPK signaling pathway (MAP2K3, MAPK14), mTOR signaling pathway (PIK3R1, EIF4B), cell cycle (eIF4B, ABL2), cell proliferation (INSIG1, FES, PIK3R1), transcription factors (TAF5L/PCAF, STAT5B) and cell adhesion (LY9). The down-regulated genes consisted of glyceroid metabolism (PPAP2C), basal cell carcinoma (MYCL1), cell differentiation (NDRG4, PDLIM7) and PCLKC (involved in negative regulation for cell growth). Significant (p < 0.04) over represented Gene Ontology terms (molecular function) in down and up-regulated genes is shown in
Analysis of %viability in U937 cells in the presence of p38 MAP kinase inhibitor (SB202190) at the indicated concentrations showed that p38 MAP kinase inhibitor showed no cytotoxicity at concentration of 1 µM in 24 hrs (
The vehicle, DMSO did not modify any investigated parameter in comparison with control culture. Investigation of the effect of p38 MAP kinase inhibitor in mutant D816V-c-Kit cells revealed significant reduction in cell proliferation. Mutant D816V-c-Kit expressing cells without huSCF showed more inhibition as compared to huSCF induced growth of mutant cells. Wild-type c-Kit expressing cells showed no effect on proliferation by p38 MAP kinase inhibitor either in presence or absence of huSCF. U937 cells showed no significant reduction in overall survival in the presence or absence of inhibitor, suggesting no cytotoxic effects on cell survival at dose of 1 µM at 24 hrs (
Receptor tyrosine kinases are one of the most important targets underlying oncogenesis as their deregulation increases cellular proliferation in hematological malignancies [
Therefore, in the present study, we tried to understand the molecular response of mutant form of c-Kit at D816V residue c-Kit for the following reasons: 1) c-Kit mutation at residue D816V significantly impairs the efficacy of cancer therapies, limiting the treatment options for therapies; 2) the signaling pathways activated by D816V-c-Kit remain largely unidentified and 3) this will aid in developing novel molecular inhibitors with the potential to overcome resistance mutations. We investigated the downstream signaling events in D816V-c-Kit expressing cells compared to wild-type c-Kit using high-throughput gene expression profiling. Specifically, we developed a stable mutant D816V-c-Kit expressing cellular system and studied its correlation with proliferation and altered signal transduction compared to wild-type c-Kit expressing cells. We selected human hematopoietic progenitor U937 cells as this cell population is huSCF and c-Kit null at mRNA transcript level, which would eliminate the interference of host endogenous c-Kit gene expression [
After achieving the doxycycline inducible regulated transgene surface expression of c-Kit genetic construct in the hematopoietic progenitor cell line U937, we further analyzed the proliferation of these cells towards huSCF in vitro. We used serum-free media to avoid non-specific activation of c-Kit by other serum proteins, thus to reduce signal-to-noise ratio. Our results revealed significantly enhancedproliferation of the mutant D816V-c-Kit expressing U937 cells as compared to wild-type c-Kit expressing cells. D816V-c-Kit expressing cells showed similar proliferation in presence or absence of huSCF (ligand-independent) whereas wild-type c-Kit cells showed proliferation in presence of huSCF only (ligand-dependent). huSCF showed no contribution for D816V mediated leukemogenicity in D816V-c-Kit expressing U937 cells unlike in mast cells [
Further, we attempted here to dissect downstream molecular targets of mutant D816V-c-Kit by microarray approach using an exhaustive 44,000 probe array. Our study provides a comprehensive analysis of transcriptome of D816V-c-Kit expressing cells. We employed three independent D816V-c-Kit transfection experiments and routinely cultured flasks to account for biological variance. Interesting set of genes responsible for factor independent proliferation is reported here for the first time. A search for the genes regulated by D816V-c-Kit revealed up-regulation of genes involved in cellular proliferation including PIK3R1, FES, INSIG1, eIF4B; and mitogen-activated protein kinases (MAPK) signaling pathway genes, MAP2K3 and MAPK14. The constitutively activated D816V-c-Kit mutation leads to the recruitment of major pro-oncogenic signaling cascades, such as the PI3K signaling, STAT, or RAS/MAPK pathway [
MOAP1 and PRKCDBP down-regulation in mutant D816V-c-Kit expressing cells compared to wild-type c-Kit expressing cells were also validated by quantitative PCR. MOAP1 gene encodes protein which functionally mediates caspase-dependent apoptosis by its interaction with apoptosis regulator protein [
Few up-regulated microarray outcome genes, selectively, SLA (1.14 fold, p < 0.15) and STAT5B (2.32 fold, p < 0.10), did not meet the selection criteria, however, exhibit statistically significant change in expression when assessed by quantitative RT-PCR. This difference arises because of the sensitivities of the two techniques and use of different statistical analysis methods. It has been reported that SLA recruits ubiquitin ligases, which tag mutant D816V-c-Kit for degradation, contributing to its lower surface expression compared to wild-type c-Kit [
Genes known to be regulated by MAPK signaling (MAP2K3 and MAPK14) were also shown to be modulated by D816V-c-Kit expressing cells. Growing evidence suggests that p38 MAP kinase subgroup of MAPKs is involved in cell proliferation, cell transformation and tumor progression [
Overall, the results of this study indicate that mutant D816V-c-Kit expressing cells show upregulation of gene expression of BCR-ABL, PI3K, SLA, p38 MAPK and STAT5 pathways for cellular proliferation (
Present study demonstrated that D816V-c-Kit mutant is a key molecular player displaying efficacy for factor- independent hematopoietic cellular hyper-proliferation. Genes (PIK3R1, eIF4B, SLA, MAPK14, STAT5) modulated upon mutant D816V-c-Kit induction reveals transformation of huSCF-dependent cells to factor independent proliferation. A better understanding of the relationship between MAP kinase signal transduction system and the regulation of cell proliferation is essential for the rational design of novel pharmaco-therapeutic approaches [
We are thankful to Dr. R.P. Tripathi, Director of INMAS for providing us necessary facilities. Authors also thank the Ministry of Defence, Department of Defence Research and Development for research grant. We thank Mrs. Namita Kalra for help during data acquisition by flow cytometry. Shilpa Sharma in particular thanks Indian Council of Medical Research (ICMR) for the award of Senior Research Fellow and Research Associateship.
Shilpa Sharma,Gurudutta Gangenahalli, (2016) Gene Expression Profiling of Human c-Kit Mutant D816V. Journal of Cancer Therapy,07,439-454. doi: 10.4236/jct.2016.76046