A set of 16 microsatellite loci was developed and characterized for the Xantus’ hummingbird ( Hylocharis xantusii) by using 454 next-generation sequencing. Twenty-five H. xantusii samples from one population were genotyped; all loci were polymorphic, with the number of alleles ranging from three to ten. The mean observed heterozygosity was 0.681 for all loci. No significant linkage disequilibrium was detected, but five loci (Hxan05, 06, 09, 13 and 14) showed deviation from Hardy-Weinberg equilibrium. These microsatellite loci are the first to be characterized for H. xantusii. A moderate to high level of cross-species amplification was observed across the six hummingbird species (31% - 87.5%), with the best cross amplification results observed in the closest related species ( H. leucotis, Cynanthus latirostris, Calypte costae). The availability of these molecular tools allows assessing questions integrating population genetics, ecology, conservation, and evolutionary history for H. xantusii and for other phyogenetically related species.
Endemic species with a narrow distribution and specific habitat requirements are usually vulnerable to ecological disturbances and environmental changes (e.g. deforestation, introduced diseases, competition and predation pressures) [
The Xantus’ hummingbird Hylocharis xantusii (Lawrence 1860) is endemic to central and southern Baja California Peninsula (BCP); limited information is available regarding its biology and ecology [
H. xantusii belongs to the family Trochilidae which has the highest specialization rate among nectarivorous birds in the world; it is a medium-sized hummingbird with a remarkably sexual dimorphism, with males having orange bill and colorful plumage [
We developed and characterized 16 polymorphic microsatellite loci for H. xantusii using 454 pyrosequencing methods. We isolated the loci to be used as a tool in estimating genetic diversity, and for its potential use in further genetic estimations such as gene flow and the measure of population structure across entire distribution of the Xantus’ hummingbird. Additionally, we tested the transferability and level of polymorphism of the genetic markers developed in six related species, in order to confirm the utility of the markers for further broader comparative analysis.
A sample of 25 individuals of H. xantusii were collected from three localities; Santiago (23˚48'24"N, 109˚72'30"W), Sierra de la Laguna (26˚04'38"N, 110˚00'68"W) and San Dionisio (23˚55'86"N, 109˚86'55"W), for population characterization. These locations correspond to one genetic population characterized by mitochondrial genes [
Genomic DNA was extracted using a salt protocol [
GS-FLX Titanium instrument (Roche Applied Sciences, Indianapolis, Indiana, USA) at the UCSC Genome Sequencing Center (Santa Cruz, California, USA).
All 454 reads were converted to primer design following the methodologies of Abdelkrim et al. [
PCR reactions were performed in a 10 μL volume containing about 40 ng of DNA, 1× PCR buffer (20 mM Tris-HCl, pH 8.4, 50 mM KCl), 0.2 mM of each dNTP, 0.4 μM of each primer, 1.5 - 2.5 μM MgCl2, and 0.5 U Taq DNA polymerase (Invitrogen, Carlsbad, California, USA). The temperature profiles included an initial denaturation at 94˚C for 5 min, followed by 30 cycles at 94˚C for 1 min each and 30 s at the locus-specific annealing temperature (
Allele assignation was automated with GeneMapper 4.1 (Applied Biosystems). The minimum peak height acceptance was set to 100 Relative Fluorescence Units (RFU), and the minimum height ratio between peaks for heterozygotes to one third. All peaks assigned were manually checked for allele shape.
Accession no. | Locus | Primer pair sequence (5’-3’) | Repeat motif | Ta (˚C) | MgCl2 [mM] | Size range (bp) | NA | HO | HE | PHW |
---|---|---|---|---|---|---|---|---|---|---|
KU681466 | Hxan01 | F: TTAAGCACCCCAGTCAAAGG R: CCCAATGTCAGGGATTTTGT | (AAAT)6 | 65 | 2.5 | 220 - 226 | 4 | 0.625 | 0.666 | |
KU681467 | Hxan02 | F: AAATCTTCATTTTGCATGCATTT R: CTTTGATGCCATCCCAATCT | (AAAC)7 | 65 | 2.5 | 120 - 156 | 3 | 0.542 | 0.426 | |
KU681468 | Hxan03 | F: GGCAGCCCAAATTGCTACTA R: TGTGCTGTTCTCCATCCATC | (TGGA)22 | 65 | 2.5 | 117 - 167 | 7 | 0.792 | 0.744 | |
KU681469 | Hxan04 | F: CACATTTGTGCTCTGATGGC R: GAGACAACTCAGGCATTCCC | (ATTT)6 | 70 | 2.5 | 169 - 201 | 7 | 0.667 | 0.742 | |
KU681470 | Hxan05 | F: CAATGTGCAGTCTCAGGGAA R: CTCCTGTGCTCAAGGGAGAG | (TGGA)5 | 70 | 2.5 | 135 - 178 | 5 | 0.292 | 0.490 | *** |
KU681471 | Hxan06 | F: GCCAGTGCAGAAGATGGACC R: AGCCTGGCTCCTCCGTAGTC | (CATC)5 | 60 | 2.5 | 132 - 172 | 5 | 0.417 | 0.661 | *** |
KU681472 | Hxan07 | F: TTCTCACAATGGGAGCCCTG R: GGGAGCAAGTGCATTCAGGA | (ACAG)5 | 70 | 2 | 88 - 156 | 10 | 0.792 | 0.853 | |
KU681473 | Hxan09 | F: CTCTGTGATCAGGCTTTTCCA R: AGTGTAGATATAGATGATAGAGACAGA | (TCTA)17 | 66 | 2.5 | 141 - 193 | 10 | 0.810 | 0.848 | ** |
KU681474 | Hxan11 | F: TGGGTTTTCAGTCTGATGGA R: TCTGGGGATTCACATAAGTA | (CATC)15 | 60 | 1.5 | 124 - 140 | 4 | 0.667 | 0.510 | |
KU681475 | Hxan12 | F: AATGGATGCATGGCTGGTG R: GCCTATGCATTCTCCCAGGC | (ATGG)11 | 60 | 1.5 | 110 - 134 | 6 | 0.917 | 0.674 | |
KU681476 | Hxan13 | F: CCACTCAGGAAGGCCAAAGA R: GGATGTACCACCAGCTTGCC | (TGGA)13 | 70 | 2 | 149 - 185 | 8 | 0.500 | 0.646 | *** |
KU681477 | Hxan14 | F: CATCACCCTAACAAACCCC R: GCACAGGGTGGGAGTAGTGC | (ATCC)14 | 70 | 2.5 | 99 - 176 | 8 | 0.522 | 0.831 | *** |
KU681478 | Hxan15 | F: GATGTTTCAGGGGAAGTCCG R: TAAATGAGAGCTGCCCCGTG | (ATCC)19 | 66 | 2.5 | 78 - 132 | 9 | 0.739 | 0.820 | |
KU681479 | Hxan16 | F: GTCACTGCCCAGCAACCACT R: TCAGGGGAGAAGCAGACCAC | (CAGA)10 | 68 | 2.5 | 73 - 125 | 10 | 1.000 | 0.810 | |
KU681480 | Hxan17 | F: TCAGGGGAGAAGCAGACCAC R: ACTGCCCAGCAACCCACTC | (TCTG)10 | 66 | 2.5 | 94 - 154 | 10 | 0.875 | 0.861 | |
KU681481 | Hxan18 | F: GCTGGTACCGGAGGTTGATG R: TGGATGAATGACGGAGGAGG | (CATT)13 | 68 | 2.5 | 133 - 169 | 5 | 0.739 | 0.681 |
**P < 0.01, ***P < 0.001 = significance of deviation from Hardy-Weinberg equilibrium after 1000 permutation.
Presence and frequency of null alleles were assessed using FreeNA software [
The 454 pyrosequence reaction resulted in 143,625 reads, from which only 815 reads contained a microsatellite motif and were suitable for primer design. Out of the 55 chosen loci for PCR and polymorphism screening, 10 exhibited inconsistent amplification patterns, 14 were monomorphic, and 31 were polymorphic. Within the 31 polymorphic loci, only tretra-nucleotide loci recording successfully more than 50% of the genotypes (
There was no previous information available for any microsatellite development technique for Hylocharis xantusii species. There are just a few hummingbird studies using microsatellite loci [
GenBank accession numbers, locus ID designation, primer sequences, repeat motifs, number of alleles, observed and expected heterozygosity for the 16 microsatellite loci developed for H. xantusii are listed in
Of the six phylogenetically related hummingbird species that were used in this work to validate the effectiveness of the novel microsatellites (
C. costae is the only co-distributed species with H. xantusii. While H. leucotis is the only sister species of Xantus’ hummingbird, but with a continental distribution. C. latirostris is the most phylogenetic related species to H. xantusii and H. leucotis [
In the other three species (Archilochus alexandri, Amazilia candida, and A. rutila) the number of alleles per locus (two for most of the loci), and the polymorphism values (56%, 44% and 31% respectively), were low compared to other cross-species amplification assays for birds groups [
Although it has been observed that avian genomes show a low frequency of microsatellites compared with other organisms [
Locus | H. xantusii NA | H. leucotis (n = 10) | C. costae (n = 9) | C. latirostris (n = 6) | A. alexandri (n = 5) | A. candida (n = 5) | A. rutila (n = 5) | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Polym = 14 (87.5%) | Polym = 14 (87.5%) | Polym = 12 (75%) | Polym = 9 (56.3%) | Polym = 7 (43.7%) | Polym = 5 (31.3%) | ||||||||||||||||
NA | HO | HE | NA | HO | HE | NA | HO | HE | NA | HO | HE | NA | HO | HE | NA | HO | HE | ||||
Hxan01 | 4 | 3 | 0.200 | 0.54** | Monomorphic | 3 | 0.167 | 0.403 | 2 | 0.250 | 0.469 | Monomorphic | Monomorphic | ||||||||
Hxan02 | 3 | 2 | 0.400 | 0.320 | 4 | 1.000 | 0.735 | 2 | 0.167 | 0.153 | Monomorphic | 2 | 1.000 | 0.500 | Monomorphic | ||||||
Hxan03 | 7 | 2 | 0.400 | 0.320 | 3 | 0.444 | 0.593 | 5 | 0.667 | 0.611 | 2 | 0.250 | 0.219 | 2 | 0.500 | 0.375 | 2 | 1.000 | 0.500 | ||
Hxan04 | 7 | 2 | 0.300 | 0.255 | 2 | 0.444 | 0.346 | Monomorphic | 2 | 0.750 | 0.469 | Monomorphic | Monomorphic | ||||||||
Hxan05 | 5 | 2 | 0.300 | 0.495 | 2 | 0.222 | 0.444 | Monomorphic | 2 | 0.250 | 0.469 | Monomorphic | Monomorphic | ||||||||
Hxan06 | 5 | 2 | 0.000 | 0.48** | 3 | 0.556 | 0.66** | 2 | 0.500 | 0.375 | Monomorphic | Monomorphic | Monomorphic | ||||||||
Hxan07 | 10 | 5 | 0.500 | 0.715** | 4 | 0.667 | 0.66* | 3 | 0.667 | 0.486 | 2 | 1.000 | 0.5* | 3 | 1.000 | 0.625 | 2 | 0.500 | 0.375 | ||
Hxan09 | 10 | 5 | 0.800 | 0.635 | 2 | 0.667 | 0.444 | 2 | 0.333 | 0.278 | Monomorphic | 2 | 1.000 | 0.500 | Monomorphic | ||||||
Hxan11 | 4 | 3 | 0.400 | 0.62** | 4 | 0.444 | 0.691** | 3 | 0.500 | 0.625** | - | - | - | - | - | - | - | - | - | ||
Hxan12 | 6 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | ||
Hxan13 | 8 | - | - | - | 2 | 0.444 | 0.494 | - | - | - | - | - | - | - | - | - | - | - | - | ||
Hxan14 | 8 | 6 | 0.400 | 0.73* | 6 | 0.556 | 0.778 | 4 | 0.833 | 0.736 | 3 | 0.500 | 0.625* | 2 | 1.000 | 0.500 | 2 | 1.000 | 0.500 | ||
Hxan15 | 9 | 6 | 0.333 | 0.833* | 4 | 0.444 | 0.568 | 5 | 0.333 | 0.681 | 2 | 0.500 | 0.375 | Monomorphic | 2 | 0.000 | 0.500 | ||||
Hxan16 | 10 | 3 | 0.000 | 0.656** | 5 | 0.286 | 0.775** | 5 | 0.600 | 0.720 | 2 | 0.250 | 0.219 | 4 | 1.000 | 0.750 | - | - | - | ||
Hxan17 | 10 | 8 | 0.500 | 0.8* | 2 | 0.500 | 0.375 | 8 | 0.667 | 0.778 | Monomorphic | - | - | - | 2 | 1.000 | 0.500 | ||||
Hxan18 | 5 | 3 | 0.300 | 0.605** | 4 | 0.222 | 0.561** | 2 | 0.667 | 0.444 | 3 | 0.500 | 0.531 | 3 | 0.500 | 0.625 | Monomorphic | ||||
Mean | 6.94 | 3.71 | 0.35 | 0.41 | 3.36 | 0.49 | 0.53 | 3.67 | 0.51 | 0.51 | 2.22 | 0.47 | 0.39 | 2.57 | 0.86 | 0.55 | 2.00 | 0.70 | 0.48 | ||
**P < 0.01, ***P < 0.001 = significance of deviation from Hardy-Weinberg equilibrium after 1000 permutation; - = no amplification.
genetic differentiation (see
For example, in hummingbird species like the wedge-tailed sabrewing (Campylopterus curvipennis), which has a complex evolutionary history [
In general, all genetic studies based on the development of novel microsatellite have shown the effectiveness in the cross-species amplification, regardless of the group, geographic distribution and life history [
It was found that the isolation of microsatellite loci for H. xantusii using next generation sequencing was successful due to the number of polymorphic loci and the number of alleles per locus obtained. These markers are
Species | Distribution | n | loci | Alleles/ locus | HO | HE | Reference |
---|---|---|---|---|---|---|---|
Hylocharis xantusii | Endemic of the BCP | 25 | 16 | 3 - 10 | 0.29 - 0.9 | 0.42 - 0.86 | This work |
Hylocharis leucotis | Southwestern US to Nicaragua | 10 | 14 | 2 - 8 | 0.2 - 0.8 | 0.25 - 0.83 | This work |
Calyptecostae | Western US and Mexico | 9 | 14 | 2 - 6 | 0.22 - 0.9 | 0.34 - 0.77 | This work |
Campylopterus curvipennis | Mexico, Belize, Guatemala, Honduras | 160 | 10 | 4 - 20 | 0.18 - 0.65 | 0.30 - 0.64 | [ |
Hymenolaimus malacorhynchos | New Zealand’s endangered | 1 | 13 | 2 - 4 | - | - | [ |
Garrulax elliotii | Endemic of eastern Himalayas | 80 | 10 | 2 - 9 | 0.0 - 0.86 | 0.07 - 1 | [ |
Columba janthina janthina | Endemic islands east Asia | 15 | 7 | 1 - 7 | 0.0 - 0.67 | 0.0 - 0.64 | [ |
Columba janthina nitens | Endemic islands east Asia | 25 | 2 | 1 - 3 | 0.0 - 0.08 | 0.0 - 0.08 | [ |
Pomatostomus ruficeps | Endemic to Australia and New Guinea | 1197 | 9 | 11 - 21 | - | 0.74 - 0.91 | [ |
Laruss aundersi | Global and vulnerable | 30 | 9 | 4 - 15 | 0.58 - 0.89 | 0.58 - 0.9 | [ |
Varieties of geese | Native of Poland | 160 | 14 | 3 - 19 | 0.45 - 0.55 | 0.38 - 0.51 | [ |
Breeds of chickens | Egypt traces | 251 | 29 | 3 - 20 | 0.22 - 0.84 | 0.32 - 0.88 | [ |
Columba livia var. domestica | Europe, Asia, Africa | 22 | 18 | 2 - 18 | 0.23 - 0.91 | 0.35 - 0.94 | [ |
Rhynchotus rufescens | South America | 24 | 6 | 2 - 12 | 0.27 - 0.82 | 0.27 - 0.86 | [ |
Ciconia boyciana | North China to southeast of Russia | 23 | 11 | 2 - 8 | 0.0 - 0.86 | 0.22 - 0.85 | [ |
- = no data available.
potentially useful for multiple hummingbird species. Moderate to high levels of cross-species amplification were observed across the six hummingbird species (31% - 87.5%), with the best results obtained in closely related species, also showing higher levels of polymorphism (NA). The availability of these molecular tools enables to address questions integrating population genetics, ecology, conservation, and evolutionary history for H. xantusii and for other phylogenetically related species.
We thank Franco Cota and Abelino Cota for field assistance, and Mabilia Urquidi-Gaume for English edition. Carlos Garza from NOAA who helped with the next generation sequencing at UCSC Genome Sequencing Center (Santa Cruz, CA). The Mexican government issued the permit (SGPA/DGVS/10182/11 and 06983/13) for the individuals collected in this research. CGRS acknowledges CONACyT for a student fellowship (No. 8492). Funding was provided by the Consejo Nacional de Ciencia y Tecnología, Mexico granted to FJGL (CONACyT project CB-2008-01-106925), and to RRE (CONACyT project155956).
Cristina González-RubioSanvicente,RicardoRodríguez-Estrella,Oscar AdriánLozano-Garza,Francisco J.García-De-León, (2016) Genetic Diversity of the Endemic Xantus’ Hummingbird Using 16 Novel Polymorphic Microsatellite Loci, and Their Cross Amplification between Six Related Species. Open Journal of Genetics,06,19-27. doi: 10.4236/ojgen.2016.61003